Primer probe combination for detecting viral nervous necrosis virus, RPA (recombinase polymerase amplification) visual kit and application thereof

Abstract

The invention belongs to the technical field of marine aquaculture industry detection, and particularly relates to a primer probe combination for detecting viral nervous necrosis virus, an RPA (recombinase polymerase amplification) visual kit and application thereof. The invention relates to a primer probe combination for detecting viral nervous necrosis virus. The primer probe combination comprises an upstream primer F2, a Biotin downstream primer Biotin-R2 and a fluorescent nfo probe nfo-P2. The kit disclosed by the invention is visual; the specificity is high; the detection sensitivity is high and can reach 100 copies / mu L; the accuracy is high and reliable; the method is convenient and fast to operate, suitable for field detection and wide in application scene.

Description

Technical Field

[0001] This invention belongs to the field of marine aquaculture detection technology, specifically involving primer and probe combinations for detecting viral nerve necrosis virus, RPA visualization kits, and their applications. Background Technology

[0002] Viral nervous necrosis virus (VNNV) is an RNA virus. Its viral particles are non-enveloped, spherical or icosahedral structures, belonging to the single-stranded, two-segmented RNA virus family. They are 25–35 nanometers in diameter and consist of a core and a capsid. It is the pathogen causing viral nervous necrosis in fish. VNNV belongs to the Nodaviridae family, also known as Nodavirus, and belongs to the genus β-Nodavirus. VNNV is neurophagous, primarily affecting the brain and retina of marine fish. Fish viral nervous necrosis has an extremely high mortality rate, reaching up to 100% in fry. In my country, it is classified as a Class II animal disease. Currently, based on the VNNV RNA2 gene sequence, it is divided into four genotypes: spotted flounder nervous necrosis virus, red-spotted grouper nervous necrosis virus, trevally nervous necrosis virus, and redfin pufferfish nervous necrosis virus. To date, the number of hosts infected by VNNV has expanded from marine fish to freshwater fish and even to invertebrates, reaching over 120 species. In regions with consistently high temperatures, VNNV easily triggers viral neuronecrosis in fish, causing significant damage to the marine fish farming industry. VNNV is the number one killer in marine fish farming.

[0003] VNNV is highly dangerous to fry and juvenile fish, and can be transmitted both vertically and horizontally. The morbidity and mortality rates of VNNV infection vary among different marine fish species. The earliest onset of symptoms is one day after hatching, but symptoms generally appear 1-3 weeks after hatching, with mortality rates reaching 100%. While the mortality rate in adult fish is relatively low, increasing reports in recent years indicate that adult fish in many species also experience high mortality rates. Currently, there are no effective means of controlling VNNV, as most transmission occurs vertically; prevention and eradication can only be achieved through testing and purging of parent fish.

[0004] On the other hand, due to the large number of VNNV genotypes discovered and the continuous emergence of variants, a new batch emerges almost every three years, resulting in nearly a thousand VNNV strains. Therefore, focusing on the diagnosis, eradication, and prevention of VNNV is one of the key measures to reduce the harm of this disease. Currently, common detection methods for VNNV mainly include cell culture, nested PCR, real-time fluorescent RT-PCR (reverse transcription polymerase chain reaction), RT-LAMP (reverse transcription loop-mediated isothermal amplification), RT-RAA (reverse transcription recombinase-assisted amplification), RPA (recombinase polymerase amplification), colloidal gold test strips, and ELISA (enzyme-linked immunosorbent assay). However, all of the above methods currently require laboratory environmental monitoring and instruments of different specifications, and cannot accurately and quickly detect VNNV on-site or in the absence of instruments. Summary of the Invention

[0005] To address the aforementioned technical problems, this invention provides a primer-probe combination for detecting viral nerve necrosis virus, an RPA visualization kit, and their applications, including: A primer-probe combination and RPA visualization kit for detecting viral nerve necrosis virus, including upstream primer F2, downstream primer Biotin-R2, fluorescent nfo probe nfo-P2, and LFD lateral flow immunoassay strip; The viral neuronecrosis virus mentioned is a fish viral neuronecrosis virus; A primer-probe combination and RPA visualization kit for detecting viral neuronecrosis virus, comprising a primer-probe combination, and also including A buffer, B butter and LFD lateral flow immunoassay strip; The A buffer, B butter, and LFD lateral flow immunoassay strips were sourced from Anpu Future Biotechnology Co., Ltd. The RPA visualization kit described above is used in the detection of viral nerve necrosis virus.

[0006] A method for detecting viral neuronecrosis virus (NNV) using RPA detection involves using a primer-probe combination for detecting NNV and an RPA visualization kit to perform an RPA reaction on the nucleic acid of the sample to be tested, followed by detection of the reaction product using an LFD lateral flow immunoassay strip.

[0007] The RPA reaction temperature is 30℃~45℃, and the reaction time is 10min~35min.

[0008] The temperature for testing using the lateral flow immunoassay strip was room temperature, and the time was 4 to 6 minutes.

[0009] Preferably, a primer-probe combination and RPA visualization kit for detecting viral nerve necrosis virus includes upstream primer F2, downstream primer Biotin-R2, fluorescent nfo probe nfo-P2, A buffer, B butter, and LFD lateral flow immunoassay strip.

[0010] Preferably, the upstream primer F2 has the following nucleotide sequence: 5'-tcgctggagtgttcgactgagcgttccatctcttg-3'.

[0011] Preferably, the downstream primer Biotin-R2 has the following nucleotide sequence: 5'-Biotin-tctgtgaacgtcttgttgaagttgtcccagatgccc-3'.

[0012] Preferably, the fluorescent NFO probe nfo-P2 has the following nucleotide sequence: 5'FAM-aaaacgattccctttccacaaatgacttca(THF)agtccatcctcctag-C3Spacer.

[0013] Preferably, buffer A and butter B are the best.

[0014] Preferably, 40 μL of thoroughly ground fish brain tissue homogenate sample is transferred to a centrifuge tube, 160 μL of release solution is added (sample: release solution = 1:4), the mixture is vortexed to mix thoroughly, allowed to stand at room temperature for 5 min, and then incubated for 3 to 5 s. The resulting supernatant of the lysate is the extracted total RNA of the sample, which can be directly used for amplification reaction; this is the optimal method.

[0015] Preferably, the amplification reaction is incubated at 42℃ for 15 min; after the reaction, the amplification product is diluted 10 times, 10 μL of the amplification product is added to 90 μL of sterile water and mixed evenly, and 80 μL of the diluted solution is dropped onto the nucleic acid test strip for detection. The control line and the test line are observed within 5 min to read the test results; this is the optimal method.

[0016] Preferably, good amplification and detection results can be obtained at 15 minutes, with 15 minutes being the optimal time for amplification.

[0017] Preferably, 10 μM is the optimal primer concentration.

[0018] Preferably, when the concentration is below 100 copies / μL, the bands and detection lines are no longer clear, indicating that the method has high sensitivity and the lowest detection limit can reach 100 copies / μL.

[0019] Preferably, the extracted total RNA can be aliquoted and stored long-term at -85℃ to -65℃, or stored for short-term storage at -30℃ to -15℃.

[0020] This invention also protects an application for detecting viral nerve necrosis virus.

[0021] Compared with the prior art, the present invention has the following beneficial effects: 1. This invention provides a primer-probe combination for detecting viral neuronecrosis virus, including upstream primer F2, downstream primer Biotin-R2, and fluorescent nfo probe nfo-P2, which can accurately and rapidly detect viral neuronecrosis virus on-site and in the absence of instruments.

[0022] 2. In this invention, nucleic acid amplification is first performed using recombinase polymerase amplification (RPA) technology, and then the amplification results are visualized using LFD lateral flow immunoassay strips.

[0023] 3. The kit of the present invention has high specificity; high detection sensitivity, reaching 100 copies / μL; high accuracy and reliability; and is simple and quick to operate, with a wide range of applications.

[0024] The principle of this invention: RPA (Reactive Amplification) is an emerging isothermal nucleic acid amplification technology. Its greatest advantages are its speed and sensitivity, and the fact that it does not require complex temperature cycling equipment such as PCR instruments, making it revolutionary in in vitro diagnostics and on-site testing. LFD (Lateral Flow Chromatography) is a rapid diagnostic technique based on capillary action, allowing liquid samples to flow laterally on a solid support, typically a nitrocellulose membrane, and detecting the presence of specific target analytes or substances in the sample through immunochemical reactions and antigen-antibody specific binding. Attached Figure Description

[0025] Figure 1 The results of 1.8% agarose gel electrophoresis of RPA amplification products with three primer pairs are shown.

[0026] Figure 2 In the table, (a) shows the 1.8% agarose gel electrophoresis results of RPA amplification products at different temperatures, 1-6 at 30℃, 35℃, 38℃, 42℃, 45℃, and 50℃; (b) shows the RPA-LFD results at different temperatures, 1-6 at 30℃, 35℃, 38℃, 42℃, 45℃, and 50℃.

[0027] Figure 3In the table, (a) 1-6 show the 1.8% agarose gel electrophoresis results of RPA amplification products at 10 min, 15 min, 20 min, 25 min, 30 min and 35 min; (b) 1-6 show the RPA-LFD results at 10 min, 15 min, 20 min, 25 min, 30 min and 35 min.

[0028] Figure 4 The results of 1.8% agarose gel electrophoresis of RPA amplification products with different concentrations of upstream primer F2 and downstream primer R2.

[0029] Figure 5 In the image, (a) shows the RPA amplification results after using upstream primer F2 and downstream primer Biotin-R2 labeled with Biotin, with values ​​of 3.7 × 10⁸ for 1-8. 7 (a) Results of 1.8% agarose gel electrophoresis with eight concentration gradients from 1.7 copies / μL to 3.7 copies / μL, and negative controls 9 and 10; (b) Results of RPA amplification using upstream primer F2 and downstream primer Biotin-R2 labeled with Biotin, with values ​​of 3.7 × 10⁸ for 1-8. 7 RPA-LFD results for eight concentration gradients from copies / μL to 3.7 copies / μL, with 9 and 10 serving as negative controls.

[0030] Figure 6 In the table, (a) shows the 1.8% agarose gel electrophoresis results after RPA amplification using upstream primer F2 and downstream primer Biotin-R2 labeled with Biotin, with 1-6 representing six concentration gradients of 100 copies / μL, 80 copies / μL, 60 copies / μL, 40 copies / μL, 20 copies / μL, and 10 copies / μL, and 7 and 8 representing the negative control; (b) shows the RPA-LFD results after RPA amplification using upstream primer F2 and downstream primer Biotin-R2 labeled with Biotin, with 1-6 representing six concentration gradients of 100 copies / μL, 80 copies / μL, 60 copies / μL, 40 copies / μL, 20 copies / μL, and 10 copies / μL, and 7 and 8 representing the negative control.

[0031] Figure 7In the table, (a) shows the RPA amplification results after using upstream primer F2 and Biotin-labeled downstream primer Biotin-R2, with 1-8 representing viral neuronecrosis virus (VNNV), lymphocystis virus (LCDV), infectious hematopoietic necrosis virus (IHNV), infectious pancreatic necrosis virus (IPNV), viral hemorrhagic septicemia virus (VHSV), leukoplakia syndrome virus (WSSV), koi herpesvirus (KHV), and koi spring viremia virus (SVCV), and 9 representing the negative control results using 1.8% agarose gel electrophoresis; (b) shows the RPA amplification results after using upstream primer F2 and Biotin-labeled downstream primer Biotin-R2, with 1-6 representing six concentration gradients of 100 copies / μL, 80 copies / μL, 60 copies / μL, 40 copies / μL, 20 copies / μL, and 10 copies / μL, and 7 and 8 representing the negative control RPA-LFD results.

[0032] Figure 8 In the figures, (a) shows the 1.8% agarose gel electrophoresis results after RPA amplification using upstream primer F2 and downstream primer Biotin-R2 labeled with Biotin, with 1-3 being 3 sea bass, 4 being the positive control, and 5 being the negative control; (b) shows the RPA-LFD results after RPA amplification using upstream primer F2 and downstream primer Biotin-R2 labeled with Biotin, with 1-3 being 3 sea bass, 4 being the positive control, and 5 being the negative control. Detailed Implementation

[0033] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods.

[0034] Key terms and abbreviations are as follows: Saltwater fish: Marine fish.

[0035] Viral nervous necrosis virus (VNNV)

[0036] Recombinase polymerase amplification (RPA) is a technique that utilizes recombinase polymerase to amplify and amplify polymerases.

[0037] Lateral flow dipsticks (LFD) are a technique used in lateral flow chromatography.

[0038] RPA-LFD: Recombining RPA with lateral flow dipsticks (LFD); recombinase polymerase amplification combined with lateral flow chromatography.

[0039] Primer: Primer.

[0040] Probe: probe.

[0041] Visual reagent kit.

[0042] The inventive concept of this invention is as follows: Considering the impact of different primer sequences on amplification specificity in existing technologies, this invention first designed a pair of primers with the highest specificity and verified their effectiveness compared to other control primers. Temperature affects the enzyme's action and thus the amplification of nucleic acids; the optimal temperature was determined in the RPA reaction system. Secondly, the effective number of cycles and the shortest amplification time were determined to be 15 minutes. Primer concentration also affects amplification specificity; too low or too high a concentration will produce impurities. To save reagents and minimize or eliminate impurities, 10 μM was ultimately selected as the optimal primer concentration. The detection limit of this invention reaches 100 copies / μL. The target gene sequence, primer sequence, and probe sequence of this invention differ from existing technologies. Furthermore, this application uses an NFO probe and a Biotin-labeled downstream primer. This invention does not require instruments, achieves the same high specificity and detection sensitivity, is simple and quick to operate, is more suitable for on-site detection, and has wider application value.

[0043] The technical solution of the present invention will be further studied using the following examples. The A buffer and B butter are from Anpu Future Biotechnology Co., Ltd., with the catalog number WLRN8209KIT; the nucleic acid test strip is an LFD lateral flow immunoassay strip from Anpu Future Biotechnology Co., Ltd., with the catalog number WLFS8204.

[0044] Target sequence / standard plasmid synthesis: Based on the RGNNV AF5349983 sequence, the 372Nc sequence was selected from its RNA2 region; the taatacgactcactatagggtcacctg sequence was added. Synthesized at Shanghai Sangon Biotech Co., Ltd., and inserted into the pUC57 cloning plasmid. The specific sequences are as follows:

[0045] 5'-taatacgactcactatagggtcacctgtcgctggagtgttcgactgagcgttccatctcttgagacacctgaagagaccaccgctcccatcatgacacaaggttccctgtacaacgattccctttccacaaatgacttcaagtccatcctcctaggatccacaccactggatattgccc ctgatggagcagtcttccagctggaccgtccgctgtccattgactacagccttggaactggagatgttgaccgtgctgtttattggcacctcaagaagtttgctggaaatgctggcacacctgcaggctggtttcgctggggcatctgggacaacttcaacaagacgttcacaga-3', SEQ ID NO.1.

[0046] Example 1: Determination of Optimal Primers Based on highly conserved sequences of fish nerve necrosis virus matched on NCBI (AF5349983, AF550395, AF550394, MF144241, KY930894, Nc008041), a pair of specific primers and a detection probe were designed. The primers and probe were synthesized by Shanghai Bioengineering Technology Service Co., Ltd. After RPA amplification, the primer pair with the optimal amplification efficiency was selected by gel electrophoresis analysis for NFO probe design. The primer sequences are as follows:

[0047] Upstream primer F1: 5'-ccatcatgacacaaggttccctgtacaacgattc-3', SEQ ID NO.2.

[0048] Downstream primer R1: 5'-caataaacagcacggtcaacatctccagttccaag-3', SEQ ID NO.3.

[0049] Upstream primer F2: 5'-tcgctggagtgttcgactgagcgttccatctcttg-3', SEQ ID NO.4.

[0050] Downstream primer R2: 5'-tctgtgaacgtcttgttgaagttgtcccagatgccc-3', SEQ ID NO.5.

[0051] Upstream primer F3: 5'-agtgctgtgtcgctggagtgttcgactgagcgt-3', SEQ ID NO.6.

[0052] Downstream primer R3: 5'-tccagctggaagactgctccatcaggggcaa-3', SEQ ID NO.7.

[0053] Biotin downstream primer Biotin-R2: 5'-Biotin-tctgtgaacgtcttgttgaagttgtcccagatgccc-3' Fluorescent NFO probe NFO-P2: 5'FAM-aaaacgattccctttccacaaatgacttca(THF)agtccatcctcctag-C3Spacer, SEQ ID NO. 8.

[0054] Select the optimal primers using the following method: S1. Extraction of RNA from fish nerve necrosis virus Transfer 40 μL of thoroughly homogenized fish brain tissue sample to a centrifuge tube, add 160 μL of release buffer (fish brain tissue homogenate sample: release buffer = 1:4), vortex to mix thoroughly, incubate at room temperature for 5 min, centrifuge for 5 s, and the resulting supernatant of the lysate is the extracted total RNA. Add according to Table 1.

[0055] Table 1 RPA Reaction System S2, incubate at 42℃ for 30 min. After the reaction is complete, add RNA extraction solution to the reaction tube at a 1:1 ratio and mix well to purify the RPA amplification product. Vortex the liquid until white foam appears, then centrifuge at 12000 rpm for 5 min. The supernatant obtained is the RPA amplification product. Sterile water is used as a negative control. The target band is detected by 1.8% agarose gel electrophoresis (AGE) at 120V for 20 min.

[0056] S3. Three primer pairs (F1 / R1, F2 / R2, F3 / R3) were screened using RPA detection, with water as a negative control. Results are as follows: Figure 1 As shown, all three RPA primer pairs amplified the target band, while no band appeared in the negative control. Among them, the target bands of F2 and R2 amplified by these primer pairs were clear and bright with relatively few impurities, indicating good amplification effect. Therefore, F2, R2, or Biotin-R2 should be preferred as primer pairs for subsequent experiments.

[0057] Example 2: Determination of Optimal Temperature S1. After extracting the RNA of fish nerve necrosis virus, add it according to Table 2: Table 2 RPA Reaction System II S2. The prepared RPA-LFD reaction system was incubated at 30℃, 35℃, 38℃, 42℃, 45℃ and 50℃ for 15 min at each of the six temperatures. After the reaction, (a) the target band was detected by 1.8% agarose gel electrophoresis (AGE) at 120V for 20 min; (b) the amplification product was diluted 10 times, 10 μL of the amplification product was added to 90 μL of sterile water and mixed well, and 80 μL of the diluted solution was dropped onto the nucleic acid test strip for detection. The control line and the test line were observed within 5 min to read the test results. Figure 2 As shown, the detection of the target gene can be carried out normally within the range of 30℃~45℃, with 42℃ and 45℃ showing the best results. However, 42℃, which is easier to achieve during on-site testing, was selected as the optimal detection temperature.

[0058] Example 3 S1. After extracting the RNA of fish nerve necrosis virus, add it according to Table 3: Table 3 RPA Reaction System III S2. At the reaction temperature (42℃), (a) the RPA amplification products were subjected to 1.8% agarose gel electrophoresis for 10 min, 15 min, 20 min, 25 min, 30 min, and 35 min; (b) the reaction time of the prepared RPA-LFD reaction system was set to 10 min, 15 min, 20 min, 25 min, 30 min, and 35 min, respectively, for 6 time gradients. After the reaction, the amplification product was diluted 10 times, 10 μL of the amplification product was added to 90 μL of sterile water and mixed evenly, and 80 μL of the diluted solution was dropped onto the nucleic acid test strip for detection. The control line and the test line were observed within 5 min to read the test results. Figure 3 As shown, good amplification and detection results can be achieved at 15 minutes, which is determined to be the optimal reaction time.

[0059] Example 4: Confirmation of primer concentration S1. Extraction of RNA from fish nerve necrosis virus.

[0060] S2. The concentrations of F2 and R2 were set to 0.5 μM, 1 μM, 5 μM, 10 μM, 15 μM and 20 μM, respectively, with water as a negative control. The reaction system is shown in Table 4.

[0061] Table 4 RPA Reaction System IV S3. Perform 1.8% agarose gel electrophoresis, such as... Figure 4 As shown, at concentrations of 10 μM and above, the bands were bright and free of impurities. To save reagents and resources, 10 μM was ultimately chosen as the optimal primer concentration.

[0062] Example 5: Confirmation of the sensitivity of this application S1. Extraction of RNA from fish nerve necrosis virus S2. Systems established using different primers for 3.7 × 10⁻⁶ 7 Sensitivity detection was performed using RNA dilutions at eight concentration gradients from 3.7 copies / μL to 3.7 copies / μL, with water as a negative control. The reaction system is shown in Tables 5A-B. Table 5A RPA Reaction System Five Table 5B RPA Reaction System VI S3. (a) After RPA amplification according to Table 5A, detect the results using 1.8% agarose gel electrophoresis; (b) After RPA amplification according to Table 5B, perform the detection on the nucleic acid test strip, observe the control line and test line within 5 minutes, and read the test results. Figure 5 As shown, the detection limit is 3.7 × 10⁻⁶. 2 Between 3.7 × 10 copies / μL.

[0063] Example 6: Reconfirmation of the sensitivity of this application S1. Extraction of RNA from fish nerve necrosis virus.

[0064] S2. Using different primers, the established system was effective against 3.7 × 10⁻⁶. 2 Sensitivity detection was performed using eight concentration gradients of RNA dilutions ranging from 3.7 copies / μL to 3.7 copies / μL, with water serving as a negative control. The reaction system is shown in Tables 6A-B. Table 6A RPA Reaction System VII Table 6B RPA Reaction System VIII S3. (a) After RPA amplification according to Table 6A, detect the results using 1.8% agarose gel electrophoresis; (b) After RPA amplification according to Table 6B, perform the detection on the nucleic acid test strip, observe the control line and test line within 5 minutes, and read the test results as follows. Figure 6As shown, the bands and detection lines are no longer clear when the concentration is below 100 copies / μL, indicating that the method has high sensitivity and the lowest detection limit can reach 100 copies / μL.

[0065] Example 7 S1. The specificity of the RPA and RPA-LFD detection systems was tested using viral neuronecrosis virus (VNNV), lymphocystitis virus (LCDV), infectious hematopoietic necrosis virus (IHNV), infectious pancreatic necrosis virus (IPNV), viral hemorrhagic septicemia virus (VHSV), leukoplakia syndrome virus (WSSV), koi herpesvirus (KHV), and koi spring viremia virus (SVCV). Water was used as a negative control. The reaction systems of the RPA and RPA-LFD detection systems are shown in Tables 7A-B.

[0066] Table 7A RPA Reaction System IX Table 7B RPA Reaction System S2. (a) After RPA amplification according to Table 7A, detect the results using 1.8% agarose gel electrophoresis; (b) After RPA amplification according to Table 7B, perform the detection on the nucleic acid test strip, observe the control line and test line within 5 minutes, and read the test results as follows. Figure 7 As shown, the established RPA-LFD visualization detection has high specificity for VNNV.

[0067] Example 8 RNA extraction from S1 and S3 sea bass.

[0068] S2, reaction conditions and reaction system are described in Example 7.

[0069] S3. (a) After RPA amplification, detection was performed using 1.8% agarose gel electrophoresis; (b) After RPA amplification, detection was performed on nucleic acid test strips. The control line and test line were observed within 5 minutes to read the test results. The results are as follows: Figure 8 As shown, none of the samples were found to be infected.

[0070] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. If such modifications and variations fall within the scope of equivalents of this invention, then this invention also intends to include these modifications and variations.

Claims

1. A primer probe combination for detecting a viral nervous necrosis virus, characterized by, The primer probe combination comprises an upstream primer F2, a Biotin downstream primer Biotin-R2 and a fluorescent nfo probe nfo-P2. The nucleotide sequence of the upstream primer F2 is as follows: 5'-tcgctggagtgttcgactgagcgttccatctcttg-3'; The nucleotide sequence of the Biotin downstream primer Biotin-R2 is as follows: 5'-Biotin-tctgtgaacgtcttgttgaagttgtcccagatgccc-3'; The nucleotide sequence of the fluorescent nfo probe nfo-P2 is as follows: 5'FAM-aaaacgattccctttccacaaatgacttca(THF)agtccatcctcctag-C3Spacer.

2. The primer probe combination for detecting a viral nervous necrosis virus according to claim 1, wherein The viral nervous necrosis virus is a fish viral nervous necrosis virus.

3. A RPA visualization kit for detecting a viral nervous necrosis virus, characterized by, The primer probe combination of claim 1 further comprises a buffer and an LFD lateral flow immunochromatographic test strip.

4. The primer probe combination according to claim 1 or the RPA visualization kit according to claim 3, characterized in that, The application is used in detecting the viral nervous necrosis virus.

5. The RPA visualization kit for detecting a viral nervous necrosis virus according to claim 3, wherein The buffer comprises A buffer and B butter, which are from Ampure Biotech Co., Ltd.

6. The RPA visualization kit for detecting a viral nervous necrosis virus according to claim 3, wherein The LFD lateral flow immunochromatographic test strip is from Ampure Biotech Co., Ltd.

7. A method of detecting a viral nervous necrosis virus using the RPA visualization kit as claimed in claim 3, characterized in that, The primer probe combination is used to perform RPA reaction on nucleic acid of a sample to be detected in a buffer environment, and then the LFD lateral flow immunochromatographic test strip is used to detect the reaction product.

8. The method of detecting a neuropathogenic virus according to claim 7, wherein, The reaction temperature of the RPA reaction is 30-45 DEG C, and the reaction time is 10-35 min.

9. The method of claim 7, wherein, The temperature for detection by the LFD lateral flow immunochromatographic test strip is room temperature, and the time is 4-6 min.

Images