Application of KML29 in preparing medicine for inhibiting Japanese encephalitis virus infection

By using a drug formulation prepared with KML29 to inhibit JEV RNA expression and NS5 protein expression, the problem of effective treatment of JEV infection was solved, achieving significant viral inhibition and low toxicity.

CN121534057APending Publication Date: 2026-02-17NANJING AGRICULTURAL UNIVERSITY
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202511707205.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-20
Publication Date
2026-02-17

AI Technical Summary

Technical Problem

Currently, there is a lack of effective clinical treatments to address Japanese encephalitis virus (JEV) infection, especially given the high mortality rate and neurological sequelae caused by JEV, which is prevalent in Southeast Asia and the Western Pacific region.

Method used

Using KML29 as the sole active ingredient, it is prepared into various drug forms such as tablets, sprays, granules, capsules, oral liquids, injections, or suspensions to inhibit JEV RNA expression and NS5 protein expression, thereby reducing viral replication.

Benefits of technology

KML29 significantly inhibits JEV replication and reduces NS5 protein expression, exhibiting a good selection index and demonstrating excellent application prospects. It also has low toxicity and is suitable for the prevention or treatment of JEV.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121534057A_ABST
    Figure CN121534057A_ABST
Patent Text Reader

Abstract

The invention discloses application of KML29 in preparation of a medicine for inhibiting Japanese encephalitis virus infection, discovers that KML29 can significantly inhibit Japanese encephalitis virus replication, and discovers that KML29 not only inhibits transcription of Japanese encephalitis virus, but also can reduce expression of NS5 protein. Therefore, the KML29 can be used for preventing or treating the Japanese encephalitis virus.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, and particularly relates to the use of KML29 in the preparation of a medicine for inhibiting Japanese encephalitis virus infection. BACKGROUND

[0002] Japanese encephalitis virus (JEV) belongs to the family of Flaviviridae and is one of the members of the family of mosquito-borne viruses, which can cause a serious zoonosis. Although symptomatic Japanese encephalitis is rare, the mortality rate of encephalitis patients can be as high as 30%, and in addition, 30% to 50% of encephalitis patients will have permanent neurological, cognitive or behavioral sequelae. Children aged 0-15 years are most affected, and have stronger neurological complications than adults. Japanese encephalitis virus is endemic in 24 countries in the Southeast Asia and the Western Pacific region, putting more than 3 billion people at risk of infection. With the intensification of global warming leading to the expansion of mosquito territory, the virus is likely to spread to new areas. Although vaccines against JEV have been marketed, there is currently no effective clinical treatment method, so the development of a new antiviral drug is of great significance for the control and treatment of JEV.

[0003] The molecular formula of KML29 is C 24 H 21 F6NO7, with a molecular weight of 549.42, is a monoacylglycerol lipase (MAGL) inhibitor that can selectively inhibit the activity of MAGL. It has analgesic and anti-neuroinflammatory effects and can be used as a potential strategy for treating inflammation and neuropathic pain without producing cannabis-like side effects. SUMMARY

[0004] The purpose of this section is to summarize some aspects of the embodiments of the present application and briefly introduce some preferred embodiments.

[0005] As one aspect of the present application, the present application provides the use of KML29 in the preparation of a medicine for inhibiting Japanese encephalitis virus infection.

[0006] The KML29 further comprises a pharmaceutically acceptable salt of KML29.

[0007] The KML29 further comprises a pharmaceutically acceptable carrier and / or excipient of KML29.

[0008] The medicine comprises one or more of tablets, sprays, granules, capsules, oral liquids, injections, suspensions containing the KML29.

[0009] The KML29 can inhibit the expression of Japanese encephalitis virus RNA.

[0010] The KML29 can inhibit the expression level of Japanese encephalitis virus NS5 protein.

[0011] The KML29 can significantly inhibit Japanese encephalitis virus replication, and the KML29 can not only inhibit the transcription of Japanese encephalitis virus, but also can reduce the expression of NS5 protein. Therefore, the KML29 can be used for preventing or treating Japanese encephalitis virus. BRIEF DESCRIPTION OF DRAWINGS

[0012] In order to more clearly illustrate the technical solutions of the embodiments of the present application, the drawings needed in the embodiment description will be briefly introduced as follows:

[0013] Figure 1 The toxicity of different concentrations of compound KML29 on BHK-21 cells is shown in the following table: 1 μM, 2.5 μM, 5 μM, 10 μM, 20 μM represent that the BHK-21 cells are treated with 1 μM, 2.5 μM, 5 μM, 10 μM, 20 μM of KML29 respectively.

[0014] Figure 2 The inhibition of different concentrations of compound KML29 on the expression level of JEV RNA is shown in the following table.

[0015] Figure 3 The inhibition of different concentrations of compound KML29 on the expression level of JEV NS5 protein is shown in the following table.

[0016] Figure 4 The fluorescence of rotavirus inhibited by different concentrations of compound KML29 is shown in the following table.

[0017] Figure 5 The selectivity index of compound KML29 for inhibiting the proliferation of JEV on cells of different species is shown in the following table. DETAILED DESCRIPTION

[0018] In order to make the above-mentioned purposes, features and advantages of the present application more obvious and easy to understand, the specific embodiments of the present application will be described in detail below.

[0019] The BHK-21 cells used in the following examples are cultured in a 37℃, 5% CO2 incubator. The KML29 is purchased from MedChemExpress (MCE) company, and its chemical molecular structure is shown in the following formula:

[0020]

[0021] Different concentrations of KML29 used in the following examples are first diluted to 20 mM with DMSO, and then diluted to 0.2 μM, 1 μM or 5 μM with DMEM medium.

[0022] Other reagents used in the related experiments are commercially available, and the methods involved are well known unless otherwise specified.

[0023] The Japanese encephalitis virus strain used is Japanese encephalitis virus (NJ-2008) preserved by the Animal Medical College of Nanjing Agricultural University and subcultured in BHK-21 cells.

[0024] In order to verify whether KML29 can be prepared as a unique active ingredient for preventing and treating Japanese encephalitis virus, the following tests were performed respectively:

[0025] 1. Cytotoxicity of compound KML29:

[0026] Cytotoxicity of small molecule KML29 was detected by CCK-8 method on BHK-21 cells. BHK-21 cells were cultured in 96-well plates with DMEM medium containing 10% FBS, and different concentrations of KML29 dissolved in DMSO were added to the wells (1 μM, 2.5 μM, 5 μM, 10 μM and 20 μM treated cells as experimental groups, while blank control group (medium + DMSO) and negative control group (cells + medium + DMSO) were set. The culture plates were incubated in an incubator for 24 h, 10 uL of CCK-8 solution was added to each well of the plate, and the culture plates were incubated in an incubator for another 1 h. The absorbance at 450 nm was measured using a microplate reader, and the cell survival rate of each concentration was calculated according to the formula [ (OD 实验组 -OD 空白组 ) / (OD 阴性对照 -OD 空白组 ) × 100%].

[0027] The results are shown in Figure 1 KML29 has little cytotoxicity, and even when the concentration reaches 20 μM, the cell survival rate can still reach more than 90%, indicating that the cytotoxicity is small.

[0028] 2. Effect of compound KML29 on RNA level during JEV infection and replication:

[0029] BHK-21 cells were cultured in 24-well plates with DMEM medium containing 10% FBS, and the experimental group was treated with JEV (MOI = 0.05) for 2 h, and then KML29 at concentrations of 0.2 μM, 1 μM and 5 μM and DMSO diluent were used as cell maintenance liquid, respectively, and the blank control group was treated with no JEV and medium. In addition, the cells treated with JEV and DMSO were used as the infection blank group. Then the cell plate was placed at 37℃, 5% CO2, and cultured for 24 h, and then the cells and supernatant were extracted to extract RNA and reverse transcribed into cDNA, and the corresponding primers were used to detect the viral genome copy number by fluorescent quantitative PCR. The total volume of the RT-qPCR reaction system was 20 μL, including 10 μL of 2 X AceQ Universal SYBR qPCR Master Mix, 0.4 μL of upstream and downstream primers, 2 μL of template, and supplemented with sterile deionized water to 20 μL. The reaction conditions were as follows: 95℃, 5 min; 95℃, 10 s, 60℃, 30 s, for a total of 40 cycles. Among them, the upstream primer of JEV was AGAGCGGGGAAAAAGGTCAT, and the downstream primer was TTTCACGCTCTTTCTACAGT. The upstream primer of β-actin was GTGATCTCCTTCTGCATCCTGTC, and the downstream primer was CTCCATCATGAAGTGCGACGT.

[0030] The results of JEV viral RNA level experiment are shown in Figure 2 The inhibition effect of different concentrations of KML29 on JEV replication is shown in the figure, which shows that KML29 has obvious inhibitory effect on the expression of JEV viral RNA, and the inhibition rate can be as high as 80% or more at a concentration of 5 μM.

[0031] 3. Effect of compound KML29 on the expression level of NS5 protein of JEV:

[0032] BHK-21 cells were cultured in 24-well plates with DMEM medium containing 10% FBS, and the experimental group was treated with JEV (MOI = 0.05) for 2 h, and then KML29 at concentrations of 0.2 μM, 1 μM and 5 μM and DMSO diluent were used as cell maintenance liquid, respectively. The blank control group was treated with no JEV and medium. In addition, the cells treated with JEV and DMSO were used as the infection blank group. Then the cell plate was placed in 37℃, 5% CO2, and cultured for 24 h, and the cell culture was collected. RIPA lysis buffer was added for lysis at 4℃ for 15 min, and 5×SDS-PAGE loading buffer was added for protein denaturation treatment (100℃, 10 min), and then centrifuged to take the supernatant. The supernatant was electrophoresed (120 V, 60 min), and then transferred to 0.2 μM nitrocellulose membrane (NC membrane) (330 mA, 2 h). Then 5% skim milk powder was used for blocking for 2 h, the blocking solution was discarded, 1×PBST was added for washing, then the primary antibody was added and incubated overnight in the refrigerator at 4℃, 1×PBST was used for washing, the secondary antibody was added for incubation for 1 h, 1×PBST was used for washing, and then ECL luminescent liquid was used for exposure to detect the expression difference of NS5 protein.

[0033] The experimental results are shown in Figure 3 Compared with the infection control group (DMSO), the expression level of NS5 protein in the experimental group (KML29+JEV) was significantly reduced. The results showed that the compound KML29 could significantly inhibit the expression level of NS5 protein of JEV.

[0034] 4. Observation of the effect of compound KML29 on JEV replication under fluorescence:

[0035] BHK-21 cells were cultured in 96-well plates with DMEM medium containing 10% FBS, and the experimental groups were inoculated with JEV (MOI = 0.05) for 2 h, and then KML29 at concentrations of 0.2 μM, 1 μM and 5 μM and DMSO diluent were used as cell maintenance liquid, and the blank control group was treated with JEV and medium. Then the cell plate was placed in a 37°C, 5% CO2condition for 24 h, then the supernatant was discarded, the cells were washed with pre-cooled PBS for 2-3 times, the liquid in the hole was sucked, 200 μL of ice methanol was added for 15 min, the cells were washed with pre-cooled PBS for 2-3 times, the target primary antibody was added, and the incubation was carried out on a 4°C shaking table overnight, and the PBS was washed for 3 times, each for 3-5 min, the same species source fluorescent secondary antibody was added in the dark, and the incubation was carried out at 37°C for 1 h, and the PBS was washed for 3 times, each for 3-5 min, the cell nucleus was stained with DAPI staining solution, and the incubation was carried out at room temperature in the dark for 5-10 min, and the PBS was washed for 3 times, each for 3-5 min, 200 μL of PBS was added to each well, and the fluorescence was observed using an inverted fluorescence microscope.

[0036] The experimental results are shown in Table 1. Figure 4 Figure 4 It is shown that the fluorescence in the infection control group (DMSO + JEV) is bright, and the fluorescence gradually decreases after treatment with different concentrations of KML29. The above results show that the compound KML29 can significantly inhibit the replication of JEV, and the inhibition is more obvious with the increase of the concentration of the compound.

[0037] 5. The selectivity index (SI) of KML29 in inhibiting the proliferation of JEV:

[0038] The CCK-8 method was used to determine the CC 50 The cytotoxicity of the small molecule KML29 on cells was detected by the CCK-8 method. The cells were cultured in 96-well plates with DMEM medium containing 10% FBS, and DMSO was added to dissolve different concentrations of KML29 (1 μM, 2.5 μM, 5 μM, 10 μM and 20 μM) to treat the cells as experimental groups, and blank control group (medium + DMSO) and negative control group (cells + medium + DMSO) were set. The culture plate was incubated in an incubator for 24 h, 10 uL of CCK-8 solution was added to each well of the plate, and the culture plate was incubated in an incubator for 1 h, and the absorbance at 450 nm was measured using a microplate reader, the cell survival rate was calculated according to the formula, and the CC 50 curve was fitted.

[0039] ​Determine the EC of KML29 on baby hamster kidney cells BHK-21, porcine kidney cells PK-15, and human cervical cancer cells Hela using RT-qPCR 50 。Detect the nucleic acid content of JEV using RT-qPCR, and the detailed operation method is as described above. Calculate the virus inhibition rate according to the formula and fit the EC 50 curve.

[0040] Calculate the selectivity index according to SI = CC 50 / EC 50 The judgment criteria are as follows: if SI < 1, the test sample is ineffective; if 1 < SI < 2, the drug is low-effective and toxic; if 2 < SI < 10, the drug is low-toxic and effective; if SI > 10, the drug is low-toxic and highly effective. Generally, it is considered that the drug has good application prospects when SI > 10.

[0041] The experimental results are as Figure 5 shown. The selectivity index of KML29 on murine BHK-21 cells is 57.09, on porcine PK-15 cells is 19.94, and on human Hela cells is 22.02. These data indicate that the selectivity indices of KML29 on the three selected cell lines are all greater than 10, proving that KML29 has excellent application prospects.

[0042] In summary, KML29 can be used as the sole active ingredient to prepare a drug for preventing and treating rotavirus. Of course, the prepared drug not only contains KML29, but also contains pharmaceutically acceptable carriers and / or excipients; the dosage form of the drug is one of tablets, sprays, granules, capsules, oral liquids, injections, suspensions.

[0043] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not restrictive. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the spirit and scope of the technical solutions of the present invention, and they should all be covered within the scope of the claims of the present invention.

Claims

1. Use of KML29 in the preparation of drugs that inhibit Japanese encephalitis virus infection.

2. The use according to claim 1, characterized in that: The KML29 also includes pharmaceutically acceptable salts of KML29.

3. The use according to claim 1, characterized in that: The KML29 also includes pharmaceutically acceptable carriers and / or excipients for KML29.

4. The use according to claim 3, characterized in that: The drug includes one or more of the following: tablets, sprays, granules, capsules, oral liquids, injections, and suspensions containing KML29.

5. The use according to claim 1 or 2, characterized in that: The KML29 can inhibit the expression of Japanese encephalitis virus RNA.

6. The use according to claim 1 or 2, characterized in that: The KML29 can inhibit the expression level of the Japanese encephalitis virus NS5 protein.

Citation Information

Patent Citations

  • Heterocyclic spiro compounds as MAGL inhibitors

    CN112469473A

  • Cannabinoid receptor agonists and serine hydrolase enzyme inhibitor based anxiolytic therapeutic product

    CN113573710A

  • Application of MAGL inhibitor in preparation of medicine for preventing or treating hepatitis

    CN115429799A