Primers for rapid identification of E-genome gossypium species in diploid and tetraploid gossypium and their applications

By designing specific primers T8-E, rapid identification of E-genome cotton species in diploid and tetraploid Gossypium species was achieved using PCR technology, solving the problem of cotton species DNA confusion and realizing efficient E-genome cotton species identification.

CN121538348BActive Publication Date: 2026-06-30CHANGCHUN UNIV OF SCI & TECH
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610076367.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2026-01-21
Publication Date
2026-06-30
Estimated Expiration
2046-01-21

Smart Images

  • Figure CN121538348B_ABST
    Figure CN121538348B_ABST
Patent Text Reader

Abstract

This invention discloses primers for the rapid identification of E-genome cotton species in diploid and tetraploid Gossypium and their applications, belonging to the field of molecular biology. Using the primers provided by this invention for the rapid identification of E-genome cotton species in diploid and tetraploid Gossypium, a nucleotide fragment of approximately 350 bp can be specifically amplified in PCR reactions using E-genome cotton species DNA as a template; however, no amplification products are obtained in PCR reactions using genomic DNA from other diploid or tetraploid cotton species as templates, demonstrating high specificity. This method enables rapid and accurate identification of E-genome cotton species, effectively solving the problem of accidental confusion between E-genome cotton species DNA and other cotton species DNA in experimental work, filling the gap in rapid identification technology for E-genome cotton species, and has significant practical value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of plant molecular technology and crop germplasm resource identification, and in particular to a specific molecular marker primer based on polymerase chain reaction (PCR) technology, and a method for accurately detecting and identifying E-genome cotton species using the primer in the context of diploid and tetraploid Gossypium species. Background Technology

[0002] Polymerase chain reaction (PCR), a core technology in modern molecular biology, is essentially an enzymatic synthesis reaction that mimics the natural replication process of DNA in vitro. This technology utilizes thermostable DNA polymerases, guided by specific primers, to achieve the specific recognition and rapid in vitro amplification of trace target DNA fragments through temperature cycling. Its core advantage lies in its extremely high sensitivity and specificity, enabling the exponential amplification of minute amounts of genetic material to the millions or even hundreds of millions within a short time.

[0003] A standard PCR reaction cycle typically includes the following three thermodynamic phases: (1) Denaturation: The reaction system is heated to 94 ℃~98 ℃ (usually 95 ℃) to break the hydrogen bonds in the DNA double helix structure, causing the template DNA to dissociate into a single strand, providing reaction sites for subsequent primer binding; (2) Annealing: The temperature is lowered to the optimal temperature for primer specific binding (usually 50 ℃~65 ℃), allowing two artificially synthesized oligonucleotide primers to specifically pair and bind to the complementary sequences at both ends of the positive and negative strands of the template DNA; (3) Extension: The temperature is adjusted back to the optimal activity temperature of DNA polymerase (such as Taq polymerase) (usually 72 ℃). With dNTPs as raw materials, the polymerase synthesizes a new DNA strand from the 5' end to the 3' end along the "template-primer" complex according to the base complementary pairing principle. The above three steps constitute a complete physical cycle. After each cycle, the number of target DNA fragments doubles (2 n Through 25 to 35 cycles of reaction, a high concentration of specific DNA fragments sufficient for subsequent electrophoretic detection and analysis can be obtained within a few hours.

[0004] Cotton, as a source of renewable textile fibers, has significant value in global cotton production and scientific research, with Asian cotton, upland cotton, herbaceous cotton, and island cotton being the main cultivated varieties. Through long-term adaptation to various harsh conditions and environments, cotton has developed extremely rich biological genetic diversity. Cotton species with the E genome possess excellent traits such as strong fibers, resistance to cotton leaf curl virus, resistance to kidney nematodes, and drought tolerance. However, in actual experiments, we sometimes encounter tissue or DNA confusion among cotton species with multiple genomes, and currently there is no rapid identification method for cotton species with the E genome. Summary of the Invention

[0005] The purpose of this invention is to provide primers for the rapid identification of E-genome cotton species in diploid and tetraploid Gossypium and their application in the accurate detection and identification of E-genome cotton species.

[0006] To achieve the above objectives, the technical solution of the present invention is as follows:

[0007] In a first aspect, the present invention provides a primer (T8-E) for rapid identification of E-genome cotton species in diploid and tetraploid Gossypium, wherein the forward primer nucleotide sequence of the primer (T8-E) is shown in SEQ ID No. 1 and the reverse primer nucleotide sequence of the primer is shown in SEQ ID No. 2.

[0008] Secondly, the present invention also provides the application of the primers described above for rapidly identifying E-genome cotton species in diploid and tetraploid Gossypium in the preparation of E-genome cotton species identification products.

[0009] Thirdly, the present invention also provides a reagent for rapidly identifying E-gene cotton species in diploid and tetraploid cotton, comprising the primers described above for rapidly identifying E-gene cotton species in diploid and tetraploid cotton.

[0010] Fourthly, the present invention also provides a method for rapid identification of E-genome cotton species in diploid and tetraploid cotton, using the above-mentioned primer T8-E, and performing PCR amplification with the complete nuclear genomic DNA of the cotton species to be tested as a template.

[0011] Compared with the prior art, the technical effects of the present invention are as follows:

[0012] This invention provides primers for the rapid identification of *Gossypium elongatum* species in diploid and tetraploid *Gossypium*. Using these primers, a nucleotide fragment of approximately 350 bp can be specifically amplified in PCR reactions using *Gossypium elongatum* genomic DNA as a template; however, no amplification products are obtained in PCR reactions using genomic DNA from other diploid or tetraploid *Gossypium* species as templates, demonstrating high specificity. This method enables rapid and accurate identification of *Gossypium elongatum* species, effectively solving the problem of accidental confusion between *Gossypium elongatum* genomic DNA and other *Gossypium* species DNA in experimental work. It fills the gap in rapid identification technology for *Gossypium elongatum* species and has significant practical value. Attached Figure Description

[0013] To more clearly illustrate the technical solutions in the embodiments of this application or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments recorded in this invention. For those skilled in the art, other drawings can be obtained based on these drawings.

[0014] Figure 1 The results of this invention are as follows: using SL24 as a positive control for PCR and T8-E as a specific primer, the results are obtained by PCR testing of DNA from various cotton species. Detailed Implementation

[0015] To enable those skilled in the art to better understand the technical solutions of the present invention, the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods in the following embodiments are conventional methods. Unless otherwise specified, the experimental materials used in the following embodiments are all purchased from conventional biochemical reagent companies.

[0016] Example 1

[0017] The following uses the specific primers (T8-E) constructed in this invention for rapid identification of E-genome cotton species in diploid and tetraploid cotton species, and performs PCR verification using DNA from 34 cotton species as templates.

[0018] 1. Materials and Methods

[0019] 1.1 Experimental Materials

[0020] The experimental materials were nuclear genomic DNA from each cotton species shown in Table 1, at a concentration of 50 ng / μL. Specific primer T8-E was used as the primer for PCR testing of the DNA from each cotton species. Primer SL24, designed using the intergenic region of the housekeeping gene nad7-ccmb located in the wild cotton mitochondrial genome, was used as a positive control for PCR to detect the usability of the DNA from each cotton species.

[0021] The forward primer sequence of the specific primer T8-E is: CAACCCCTGGCACATTTAGGTTTTTC (as shown in SEQ ID No. 1); the reverse primer sequence of T8-E is: CAAGCTGAGGCTGCCAGCTAC (as shown in SEQ ID No. 2).

[0022] The sequence of the forward primer of universal primer SL24 is: AGTCTCGGGAATCACGATGCA (as shown in SEQ ID No. 3); the sequence of the reverse primer of SL24 is: CGACCATGCTCGGAAACCACA (as shown in SEQ ID No. 4).

[0023] Primers were synthesized by Changchun Kumei Pharmaceutical Co., Ltd., and purified by PAGE. Taq Mix was Vazyme's 2×TaqMaster Mix for PAGE.

[0024] 50 μL of 96-well plates; PCR instrument from BIOER; agarose gel made of TAE containing 1.5% agarose, electrophoresis buffer was TAE; electrophoresis instrument manufactured by Beijing Junyi Company; gel imaging instrument manufactured by Beijing Junyi Company.

[0025] 1.2 Experimental Methods

[0026] 1) Add DNA, primers, and Taq Mix to 50 μL of sterile 96-well plate according to the above system ratio;

[0027] 2) Centrifuge the 96-well plate, vortex, and then place it in a PCR instrument to run the PCR procedure described above:

[0028] The PCR reaction system is as follows:

[0029]

[0030] The PCR reaction process is as follows:

[0031] ① Preheat denaturation at 94 ℃ for 10 min,

[0032] ② Denaturation at 94 ℃ for 30 seconds,

[0033] ③ Anneal at 62 ℃ for 45 seconds,

[0034] ④ Extend at 72 ℃ for 1 min;

[0035] ⑤ Repeat step ②, 30 cycles;

[0036] ⑥Save at 4℃.

[0037] 30 cycles, 95 minutes.

[0038] 3) Remove the product and load it onto the sample;

[0039] 4) Voltage 1120V, current 250mA, electrophoresis time 40min;

[0040] 5) Take the glue and read the tape.

[0041] 2 Experimental Results

[0042] Gel readings showed that the housekeeping gene primer SL24 produced upper bands in all 34 wild cotton species (1-34), proving that the DNA from all 34 cotton species was usable. The specific primer T8-E produced the target band in E-genome cotton species (Gossypium stokesii, Gossypium somaliense, Gossypium yaresi, and Gossypium gravidii), but no product was detected in the other 30 cotton species (e.g., ...). Figure 1 (As shown). Figure 1 The names of cotton species corresponding to each genome are shown in Table 1 below. Figure 1 The DNA of each cotton species is arranged from left to right according to the sequence number in Table 1.

[0043] Table 1 Information on 34 types of cotton

[0044]

[0045] In summary, this invention provides primers for the rapid identification of *Gossypium elongatum* species in diploid and tetraploid *Gossypium*. Using these primers, a nucleotide fragment of approximately 350 bp can be specifically amplified in PCR reactions using *Gossypium elongatum* genomic DNA as a template; however, no amplification products are observed in PCR reactions using genomic DNA from other diploid or tetraploid *Gossypium* species as templates, demonstrating high specificity. This method enables rapid and accurate identification of *Gossypium elongatum* species, effectively solving the problem of accidental confusion between *Gossypium elongatum* genomic DNA and other *Gossypium* species DNA in experimental work, filling the gap in rapid identification technology for *Gossypium elongatum* species, and has significant practical value.

[0046] The above description of the disclosed embodiments is intended to enable those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the above drawings and descriptions are illustrative in nature and should not be construed as limiting the scope of the claims of this invention.

Claims

1. The application of primers in the preparation of identification products for rapid identification of E-genome cotton species in diploid and tetraploid cotton, characterized in that, The forward primer nucleotide sequence is shown in SEQ ID No. 1, and the reverse primer nucleotide sequence is shown in SEQ ID No.

2. The E-genome cotton species is Gossypium stokesii, Gossypium somaliense, Gossypium yaresiense, or Gossypium gravidii.

2. A method for rapid identification of E-genome cotton species in diploid and tetraploid cotton, characterized in that, Primers for rapid identification of E-genome cotton species in diploid and tetraploid cotton were used. PCR amplification was performed using the complete nuclear genomic DNA of the cotton species to be tested as a template. If the target band was produced, the cotton species to be tested was an E-genome cotton species. The nucleotide sequence of the forward primer is shown in SEQ ID No. 1, and the nucleotide sequence of the reverse primer is shown in SEQ ID No.

2. The E-genome cotton species were Gossypium stokesii, Gossypium somaliense, Gossypium yaresiense, or Gossypium gravidii.