Method for determining proliferative capacity

By measuring the expression levels and ratios of GAS6 and GAS6-AS1 genes in mesenchymal stem cells, the problem of the inability to predict high cell proliferation capacity in existing technologies has been solved, enabling early identification of cells with high proliferation capacity and improving the production efficiency of therapeutic products.

CN121548635APending Publication Date: 2026-02-17UNIV OF LIVERPOOL
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202480038063.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2023-04-05
Filing Date
2024-04-04
Publication Date
2026-02-17

AI Technical Summary

Technical Problem

Current technology cannot predict the high proliferative capacity of mesenchymal stem cells at the start of cell culture, which makes it impossible to effectively select cells with rapid and long-term growth potential, thus limiting the production efficiency of therapeutic products.

Method used

Cells with high proliferative capacity can be identified or selected by measuring the expression levels and ratios of GAS6 and GAS6-AS1 genes in mesenchymal stem cells, including comparing the expression levels of these genes with reference values ​​to identify or select cells with high proliferative capacity.

Benefits of technology

This technology enables rapid and accurate identification of mesenchymal stem cells with high proliferative capacity in the early stages of cell culture, improving the production efficiency and quality of therapeutic products.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121548635A_ABST
    Figure CN121548635A_ABST
Patent Text Reader

Abstract

The invention relates to a method for determining or identifying whether mesenchymal stem cells have high multiplication capacity or not, a method for selecting the mesenchymal stem cells, the mesenchymal stem cells with the high multiplication capacity, a pharmaceutical composition of the mesenchymal stem cells, a preparation method of the mesenchymal stem cells and application of the mesenchymal stem cells as medicine.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a method for determining or identifying whether mesenchymal stem cells have high proliferative capacity, a method for selecting said mesenchymal stem cells, mesenchymal stem cells with high proliferative capacity, pharmaceutical compositions thereof, methods for their preparation, and their use as pharmaceuticals. Background Technology

[0002] Mesenchymal stem cells (MSCs) have been investigated as a potential injectable therapy for knee osteoarthritis and other diseases, and there is some evidence of success in preliminary human trials. 1 .

[0003] If MSCs are used as donor cells to treat a large number of patients, any single donor sample needs to be expanded through cell culture to create a master cell bank, from which cell batches can be further expanded to create a working cell bank for producing therapeutic products. However, although MSCs (e.g., derived from bone marrow or adipose tissue) have the ability to proliferate for multiple generations, their proliferation rate eventually slows down, and they become senescent and cease growth. Therefore, the effectiveness of any donated bone marrow or adipose tissue sample in producing large quantities of therapeutic products depends on the cell growth rate and the time required for them to reach senescence.

[0004] Crucially, mesenchymal stem cells from different patients begin to grow at different rates after the first few passages, and those cells that begin to proliferate more slowly tend to age earlier. 1 Therefore, the proliferative capacity of MSCs can ultimately determine the amount of drug product that a bone marrow or fat sample can produce, and this capacity can vary greatly between different samples.

[0005] To enable the use of MSCs as a form of therapy, it is desirable to select donor MSCs with the ability to grow faster and more persistently shortly after the start of culture, thereby fully realizing their nutritional activity and resulting therapeutic potential. Currently, it is not possible to predict which donor cells will possess these characteristics and the resulting high proliferative capacity at the start of culture. The inability to select cells with high proliferative capacity, in turn, limits the ability to produce large quantities of therapeutic products, thus limiting the overall efficiency of therapeutic product production.

[0006] One or more aspects or embodiments of the present invention are intended to solve at least this problem, or one or more other problems in the art. Summary of the Invention

[0007] A first aspect of the present invention provides a method for identifying, characterizing, or selecting mesenchymal stem cells (MSCs) with high proliferative capacity, the method comprising:

[0008] a. Obtain data on the expression levels of one or two of the following genes in indicator mesenchymal stem cells: GAS6 and GAS6-AS1;

[0009] b. Optionally calculate the ratio of gene expression levels of GAS6-AS1:GAS6;

[0010] c. Compare the expression levels of one or both genes in step (a) and / or optionally the ratios in step (b) to reference values;

[0011] d. If the expression levels of the GAS6 gene, GAS6-AS1 gene, and / or the ratio of GAS6-AS1 to GAS6 gene expression levels are lower than the reference value, then identify, characterize, or select mesenchymal stem cells with high proliferative capacity.

[0012] A suitable embodiment of the first aspect of the present invention provides a method for determining whether mesenchymal stem cells have high proliferative capacity, the method comprising:

[0013] a. Obtain data on the expression levels of one or two of the following genes in indicator mesenchymal stem cells: GAS6 and GAS6-AS1;

[0014] b. Optionally calculate the ratio of gene expression levels of GAS6-AS1:GAS6;

[0015] c. Compare the expression levels of one or both genes in step (a) and / or optionally the ratios in step (b) to reference values;

[0016] d. If the expression levels of the GAS6 gene, the GAS6-AS1 gene, and / or the ratio of GAS6-AS1:GAS6 gene expression levels are lower than the reference value, then mesenchymal stem cells are determined to have high proliferative capacity.

[0017] A suitable embodiment of the first aspect of the present invention provides a method for identifying / selecting mesenchymal stem cells with high proliferative capacity (optionally for therapeutic use), the method comprising:

[0018] a. Obtain data on the expression levels of one or two of the following genes in indicator mesenchymal stem cells: GAS6 and GAS6-AS1;

[0019] b. Optionally calculate the ratio of gene expression levels of GAS6-AS1:GAS6;

[0020] c. Compare the expression levels of one or both genes in step (a) and / or optionally the ratios in step (b) to reference values;

[0021] d. If the expression levels of the GAS6 gene, GAS6-AS1 gene, and / or the ratio of GAS6-AS1 to GAS6 gene expression levels are lower than the reference value, then the mesenchymal stem cells should be selected.

[0022] A second aspect of the present invention provides a method for distinguishing between mesenchymal stem cells with high proliferative capacity and mesenchymal stem cells with low proliferative capacity, the method comprising:

[0023] a. Obtain data on the expression levels of one or two of the following genes in indicator mesenchymal stem cells: GAS6 and GAS6-AS1;

[0024] b. Optionally calculate the ratio of gene expression levels of GAS6-AS1:GAS6;

[0025] c. Compare the expression levels of one or both genes in step (a) and / or optionally the ratios in step (b) to reference values;

[0026] d. The mesenchymal stem cells are classified as follows: (i) those with high proliferative capacity if the expression levels of the GAS6 gene, GAS6-AS1 gene, and / or the ratio of GAS6-AS1:GAS6 gene expression levels are lower than reference values, or (ii) those with low proliferative capacity if the expression levels of the GAS6 gene, GAS6-AS1 gene, and / or the ratio of GAS6-AS1:GAS6 gene expression levels are higher than reference values.

[0027] In one embodiment, the above method is applied to mesenchymal stem cells in a mesenchymal stem cell population. Suitably, therefore, it refers to a method for identifying, characterizing, or selecting highly proliferating mesenchymal stem cells (MSCs) from a mesenchymal stem cell population, or a method for distinguishing highly proliferating and low-proliferating mesenchymal stem cells within a mesenchymal stem cell population. In one embodiment, the above method is applied to a variety of mesenchymal stem cells, suitable for a mesenchymal stem cell population.

[0028] A third aspect of the invention provides the use of the expression levels of one or both of the genes GAS6 and GAS6-AS1, and / or the ratio of GAS6-AS1:GAS6 gene expression levels as an indicator of mesenchymal stem cell proliferation capacity.

[0029] A fourth aspect of the invention provides mesenchymal stem cells with high proliferative capacity, wherein the expression levels of the GAS6 gene, the GAS6-AS1 gene, and / or the ratio of GAS6-AS1:GAS6 gene expression levels in the mesenchymal stem cells are lower than reference values.

[0030] In one embodiment, the mesenchymal stem cells are obtained from the method according to the first aspect.

[0031] In one embodiment, the mesenchymal stem cells are isolated or selected from a population of mesenchymal stem cells.

[0032] The fifth aspect of the invention provides a population of mesenchymal stem cells according to the fourth aspect of the invention.

[0033] The cells of the fourth and fifth aspects of this invention may be referred to herein as "cells of the present invention", "mesenchymal cells of the present invention" or "MSCs of the present invention".

[0034] A sixth aspect of the invention provides a combination of mesenchymal stem cells according to the fourth aspect of the invention or a population of mesenchymal stem cells according to the fifth aspect of the invention and a therapeutic agent.

[0035] The seventh aspect of the invention provides the use of mesenchymal stem cells according to the fourth aspect of the invention or a population of mesenchymal stem cells according to the fifth aspect of the invention for the delivery of therapeutic agents.

[0036] The eighth aspect of the present invention provides a pharmaceutical composition comprising a population of mesenchymal stem cells according to the fifth aspect of the present invention or a combination according to the sixth aspect.

[0037] The ninth aspect of the invention provides a mesenchymal cell population of the fifth aspect and / or a pharmaceutical composition of the eighth aspect and / or a combination of the sixth aspect, which are used as a medicament.

[0038] The tenth aspect of the invention provides a population of mesenchymal cells of the fifth aspect and / or a pharmaceutical composition of the eighth aspect and / or a combination of the sixth aspect for treating bone or soft tissue diseases or injuries, liver diseases or injuries, intestinal diseases or injuries, lung diseases or injuries, skin diseases or injuries, heart diseases or injuries, kidney diseases or injuries, uterine diseases or injuries, or any combination thereof.

[0039] The eleventh aspect of the present invention provides a method for preparing a population of mesenchymal stem cells for use as a drug, the method comprising:

[0040] a. Cultivating a population of mesenchymal stem cells;

[0041] b. Select mesenchymal stem cells whose expression levels of GAS6 gene, GAS6-AS1 gene and / or the ratio of GAS6-AS1:GAS6 gene expression level are lower than the reference value.

[0042] c. Optionally expand the selected mesenchymal stem cells;

[0043] d. Prepare the mesenchymal stem cells for use as a drug.

[0044] The twelfth aspect of the present invention provides a drug prepared by the method of the eleventh aspect of the present invention.

[0045] The thirteenth aspect of the present invention provides a medicament prepared by the method of the eleventh aspect of the present invention for treating bone or soft tissue diseases or injuries, liver diseases or injuries, intestinal diseases or injuries, lung diseases or injuries, skin diseases or injuries, heart diseases or injuries, kidney diseases or injuries, uterine diseases or injuries, or any combination thereof.

[0046] In another aspect of the invention, a method for identifying or selecting mesenchymal stem cells (MSCs) is provided, the method comprising:

[0047] a. Obtain data on the expression levels of one or two of the following genes in indicator mesenchymal stem cells: GAS6 and GAS6-AS1;

[0048] b. Optionally calculate the ratio of gene expression levels of GAS6-AS1:GAS6;

[0049] c. Identify or select mesenchymal stem cells based on the expression levels of GAS6, GAS6-AS1 and / or the ratio of GAS6-AS1:GAS6 gene expression levels.

[0050] In some embodiments, MSCs are desired MSCs possessing suitable desired characteristics. For example, desired MSCs may have high proliferative capacity. In some embodiments, MSCs are identified or selected based on desired expression levels of GAS6, GAS6-AS1, and / or the ratio of GAS6-AS1:GAS6 gene expression levels. Suitably, the desired expression levels may be a ratio of GAS6, GAS6-AS1, and / or GAS6-AS1:GAS6 gene expression levels reflecting high proliferative capacity.

[0051] Another aspect of the present invention provides a method for distinguishing mesenchymal stem cells, the method comprising:

[0052] a. Obtain data on the expression levels of one or two of the following genes in indicator mesenchymal stem cells: GAS6 and GAS6-AS1;

[0053] b. Optionally calculate the ratio of gene expression levels of GAS6-AS1:GAS6;

[0054] c. Differentiate mesenchymal stem cells by the expression levels of the GAS6 gene, the GAS6-AS1 gene, and / or the ratio of GAS6-AS1 to GAS6 gene expression levels.

[0055] In some embodiments, the method is a way of distinguishing between desired and unwanted mesenchymal stem cells. For example, desired MSCs may have high proliferative capacity, while unwanted MSCs may have low proliferative capacity. In some embodiments, MSCs are distinguished based on the desired expression levels of GAS6, GAS6-AS1, and / or the ratio of GAS6-AS1:GAS6 gene expression levels. Suitably, the desired expression levels may be the ratio of GAS6, GAS6-AS1, and / or GAS6-AS1:GAS6 gene expression levels reflecting high proliferative capacity. In some embodiments, MSCs are distinguished based on the unwanted expression levels of GAS6, GAS6-AS1, and / or the ratio of unwanted GAS6-AS1:GAS6 gene expression levels. Suitably, the unwanted expression levels may be the ratio of GAS6, GAS6-AS1, and / or GAS6-AS1:GAS6 gene expression levels reflecting low proliferative capacity. Optionally, the method may further include the step of separating MSCs based on the expression levels of the GAS6 gene, the GAS6-AS1 gene, and / or the ratio of GAS6-AS1:GAS6 gene expression levels. In one embodiment, the method includes obtaining data from a plurality of MSCs, optionally calculating the ratios among the plurality of MSCs, and then distinguishing MSCs by the expression levels of the GAS6 gene, the GAS6-AS1 gene, and / or the ratio of GAS6-AS1:GAS6 gene expression levels. Detailed Implementation Plan

[0056] The features and implementation schemes of the above aspects will now be further described in the heading sections below; however, any features, implementation schemes or definitions described herein are not limited to any particular aspect and may be combined with any aspect in any feasible combination.

[0057] Those skilled in the art will recognize that many methods and materials similar or equivalent to those described herein can be used in the practice of this invention. In fact, this invention is by no means limited to the methods and materials described. For the purposes of this invention, the following terms are defined as follows.

[0058] As used herein and throughout the appended claims, the words “a,” “an,” and “the” have the meaning of plural pronouns unless the context clearly specifies otherwise. Furthermore, as used herein, “in” has the meaning of both “in which” and “on which” unless the context clearly specifies otherwise.

[0059] The terms “proliferation capacity” and “proliferative capacity” are used interchangeably in this document unless the context clearly indicates otherwise.

[0060] Unexpectedly, the inventors of this application have discovered an unusual gene and its antisense counterpart that can be used to predict the likelihood that mesenchymal stem cells (MSCs) or populations of them possess high proliferative capacity (i.e., grow faster and for a longer duration than another type of MSC or a population of MSCs). This discovery builds on previous observations that MSCs isolated from different patients grow at different rates; however, it has been impossible to predict this behavior until now. Since MSCs can only be cultured for a limited time after isolation from a patient, and furthermore, because the time required to produce large quantities of MSCs (for subsequent uses, such as therapeutic uses) should be as short as possible, it is important to be able to predict their high proliferative capacity as quickly as possible after isolation. The advantage of this discovery is that high proliferative capacity can be predicted with only one gene marker or its antisense counterpart after MSCs are isolated from a patient, using only a few, or even a single, cell passages. A significant advantage of this discovery is that the proliferative capacity of MSCs can be determined shortly after isolation. Another significant advantage is that proliferative capacity can be determined by methods other than directly measuring proliferative capacity itself. Previously, it was not known in the art that a specific GAS6 gene and its antisense counterpart GAS6-AS1 could be used to predict or determine the proliferation capacity of MSCs, and the inventors of this application did not anticipate that such a prediction could be made using only these genes.

[0061] Mesenchymal stem cells (MSCs)

[0062] This invention relates to mesenchymal stem cells (MSCs) and populations thereof. MSCs can generally be defined as stromal cells that are pluripotent and possess the ability to self-renew (i.e., self-replicate). "Pluripotency" refers to the ability of a cell to differentiate into multiple or more different cell types. MSCs can differentiate into various cell types, such as chondrocytes, adipocytes, and hematopoietic cells.

[0063] Those skilled in the art will know methods for identifying cells as MSCs, including but not limited to the techniques discussed in the examples below.

[0064] Suitablely, cells can be identified as MSCs by the presence and / or absence of expression of one or more characteristic markers. Suitablely, the markers may include differentiation cluster (CD) antigens, which are suitablely expressed by MSCs. Suitablely, MSCs may express one or more of the following markers: CD90 and CD105. Suitablely, MSCs may express CD90. Suitablely, MSCs may express CD105. In some embodiments, MSCs may express both CD90 and CD105, also referred to as CD90+ and CD105+.

[0065] Suitablely, MSCs may lack expression of one or more of the following biomarkers: CD34 and CD45. Suitablely, MSCs may lack expression of CD34. Suitablely, MSCs may lack expression of CD45. In some embodiments, MSCs may lack expression of both CD34 and CD45, also referred to as CD34- and CD45-. In some embodiments, MSCs may express CD90 and CD105, also referred to as CD90+ and CD105+, and may lack expression of both CD34 and CD45, also referred to as CD34- and CD45- (i.e., MSCs may be CD90+, CD105+, CD34-, CD45-).

[0066] Suitably, a population of cells can be identified as a population of MSC cells by a characteristic group of cells expressing one or more markers in high and / or low proportions. Suitably, the markers may include differentiation cluster (CD) antigens, which are preferably expressed by MSCs. Suitably, a population of MSCs may be a population in which a high proportion of cells express one or more of the following markers: CD90 and CD105. Suitably, a population of MSCs may be a population in which a high proportion of cells express CD90. Suitably, more than 90% of the cells may express CD90. Suitably, a population of MSCs may be a population in which a high proportion of cells express CD105. Suitably, more than 90% of the cells may express CD105. Suitably, a population of MSCs may be a population in which a high proportion of cells express both CD90 and CD105. In some embodiments, a population of MSCs may be a population in which more than 90% of the cells express both CD90 and CD105.

[0067] Suitably, a population of MSCs may be a population in which a low percentage of cells express one or more of the following markers: CD34 and CD45. Suitably, a population of MSCs may be a population in which a low percentage of cells express CD34. Suitably, less than 30% of the cells may express CD34. Suitably, a population of MSCs may be a population in which a low percentage of cells express CD45. Suitably, less than 30% of the cells may express CD45. Suitably, a population of MSCs may be a population in which a low percentage of cells express both CD34 and CD45. In some embodiments, a population of MSCs may be a population in which less than 30% of the cells express both CD34 and CD45.

[0068] In some implementations, the MSC population may be a population in which more than 90% of the cells express CD90 and CD105 and less than 30% of the cells express CD34 and CD45.

[0069] The expression levels of one or more biomarkers can be determined using any suitable technique known to those skilled in the art. For example only, biomarker expression levels can be determined by measuring the levels of the corresponding gene transcript or the corresponding protein product. Suitable means of achieving this may include, for example, staining cells with an antibody that specifically binds to the target biomarker and identifying the stained cells using cell sorting techniques or nucleotide amplification methods such as quantitative PCR (qPCR, also known as real-time PCR).

[0070] Suitably, the MSCs used in this invention can be derived from various tissue types, including, for example, adipose tissue, bone marrow, umbilical cord tissue, blood, liver, dental pulp, and skin. Suitably, the MSCs can be selected from adipose tissue-derived MSCs (ADSCs), bone marrow-derived MSCs (MB-MSCs), and umbilical cord-derived mesenchymal stem cells (UC-MSCs), or any combination thereof. In one embodiment, the MSCs can be adipose-derived MSCs. In another embodiment, the MSCs can be bone marrow-derived MSCs. Suitably, the MSCs can be derived from humans or other mammals. Alternatively, the MSCs can be derived from existing in vitro maintained MSC cell lines or populations, for example, from existing MSC cell lines maintained in a cell line bank.

[0071] Appropriately, the term "cluster" of MSCs used in this article refers to a collection of more than one type of MSC, and more specifically, a collection of multiple types of MSCs. Appropriately, a cluster of MSCs may originate from the same organization or from different organizations listed above.

[0072] In the context of various aspects of the present invention that use MSCs, pharmaceutical compositions comprising populations of MSCs, combinations of MSCs, or formulations of MSCs as medicines, it is suitable that MSCs can be autologous cells or allogeneic cells. "Autologous cells" refers to cells used for subsequent therapeutic purposes in the same subject from whom the MSCs were originally derived. "Allogeneic cells" refers to cells used for subsequent therapeutic purposes in different subjects from whom the MSCs were originally derived. Suitablely, allogeneic cells can be cells derived from one human subject and used for subsequent therapeutic purposes in another human subject.

[0073] Suitablely, the MSCs used in this invention can be wild-type cells or modified cells, such as genetically engineered cells. Suitablely, the use of the GAS6 marker described herein is equally applicable to wild-type or modified MSCs.

[0074] Proliferation capacity

[0075] The present invention relates to identifying, characterizing or selecting MSCs with high proliferative capacity, MSCs with high proliferative capacity, populations thereof and their subsequent uses.

[0076] As used herein, MSCs with high proliferative capacity are, suitably, MSCs that proliferate or are capable of proliferating at a faster rate than the average proliferation rate and / or average proliferation duration in a population of MSCs, and / or MSCs that proliferate or are capable of proliferating for a longer period before senescence. Suitably in a typical population of MSCs. Suitably in a heterologous population of MSCs. Suitably, a typical population of MSCs can be a heterologous population of MSCs. “Hyperlogous population of MSCs” or “heterologous population of cells” refers to a population of MSCs in which the MSCs are derived from sufficiently diverse source samples to achieve a considerable degree of diversity in terms of proliferative capacity. Suitable heterologous populations of MSCs can be ordered or prepared by mixing samples from multiple different sources together to form a heterologous population of cells. Suitably, MSCs with high proliferative capacity can be MSCs that proliferate or are capable of proliferating at a faster rate than the average proliferation rate and / or average proliferation duration in a population of MSCs from which cells are identified or selected, and / or MSCs that proliferate or are capable of proliferating for a longer period before senescence.

[0077] Suitablely, when compared with the average growth rate and / or average growth period in a population of MSCs (suitably, which may be a heterologous population of MSCs), MSCs with high proliferative capacity are MSCs that have or are capable of having a high growth rate and / or a long growth period. Suitablely, when compared with the average growth rate and / or average growth period of a population of MSCs from which cells are identified or selected, MSCs with high proliferative capacity are MSCs that have or are capable of having a high growth rate and / or a long growth period.

[0078] Appropriately, therefore, "high proliferative capacity" can also refer to the future capacity of MSCs, or it can refer to their current state. Appropriately, therefore, MSCs are capable of having a high growth rate and / or a long growth phase in the future, or they may already have a high growth rate and / or a long growth phase.

[0079] "Aging" refers to the cessation of cell growth, which may be accompanied by cell degeneration or apoptosis. "Apoptosis" refers to programmed cell death.

[0080] In one implementation, a highly proliferative MSC is a MSC capable of growing faster, or a MSC that grows faster than another type of MSC, or a MSC that grows faster than the average of a population of MSCs (suitably, which may be a heterologous population of MSCs). "Faster growth" herein refers to the growth rate or average growth rate of a highly proliferative MSC. Suitably, therefore, MSCs may have a high growth rate, or be capable of having a high growth rate. Suitably, therefore, MSCs may have a higher growth rate than another MSC or the average growth rate of a population of MSCs (suitably, which may be a heterologous population of MSCs), or be capable of having a higher growth rate. Suitably, a faster or higher growth rate can be established compared to the average growth rate in a population of the same cells that establishes MSCs as having a faster or higher growth rate, or compared to the average growth rate of a population of different cells (suitably, which may be a heterologous population of MSCs).

[0081] The MSC growth rate can be determined by any suitable means known to those skilled in the art, including the techniques described in the examples.

[0082] Suitablely, the growth rate can be measured by determining the cell doubling time (i.e., the population doubling time when cells grow into a population). "Cell doubling time" refers to the average time required for one cell to divide into two cells. Suitablely, the population doubling time (PDT) can be calculated using the following formula: PDT = t × log(2) / log(harvested cells / inoculated cells), where t = the time between cell inoculation and cell harvesting.

[0083] Suitably, the cell doubling time (or PDT when grown into a population) of highly proliferating MSCs may be less than 20 days. Suitably, less than 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, or 5 days. In one embodiment, less than 15 days. In one embodiment, less than 10 days. In one embodiment, less than 5 days.

[0084] Suitably, MSCs with high growth rates can be defined as having a cell doubling time (or PDT when grown into a population) of less than 20 days. Suitably, less than 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, or 5 days. In one embodiment, less than 15 days. In one embodiment, less than 10 days. In one embodiment, less than 5 days. Suitably, the cell doubling time can be the average cell doubling time or PDT measured over a certain number of passages.

[0085] Optionally or additionally, the growth rate can be determined by measuring appropriate cellular markers that indicate cell growth, such as the expression levels of certain genes, the levels of certain RNA transcripts, and / or the levels of certain proteins.

[0086] Alternatively or additionally, the growth rate can be determined by quantifying cellular DNA synthesis, for example by staining techniques involving BrdU or other chemical reagents commonly used for this purpose.

[0087] Proliferation at a faster or higher rate of growth can occur at any stage of the MSC cell life cycle. "Life cycle" refers to the span of time during which an MSC cell line actively grows, ideally before senescence.

[0088] Suitablely, at passage numbers of 1 (P1), P2, P3, P4, P5, P8, P10, P15, P20, P25, P30 and / or higher, proliferation at a faster or higher growth rate can occur or be determined. "Passage number" or "number of passages" refers to the number of times the cell line has been reseeded to begin a new cell culture. Suitablely, at higher passage numbers, such as P10, P11, P12, P13, P14, P15, P20, P25, P30 and / or higher, proliferation at a faster or higher growth rate can occur or be determined. Suitablely, during P1–P15, proliferation at a faster or higher growth rate can occur or be determined. The "-" used herein refers to a range. Suitablely, during P1–P5, P6–P10 and / or P11–P15, proliferation at a faster or higher growth rate can occur. In one embodiment, proliferation at a faster or higher growth rate occurs at or before P10. In another embodiment, proliferation at a faster or higher growth rate occurs at or before P15.

[0089] Suitablely, therefore, at cell passage 1 (P1), P2, P3, P4, P5, P8, P10, P15, P20, P25, P30 and / or higher passage numbers; at higher passage numbers, such as P10, P11, P12, P13, P14, P15, P20, P25, P30 and / or higher; during P1-P15; during P1-P5, P6-P10 and / or P11-P15; at P10; or at P15, MSCs with high proliferative capacity may contain low cell doubling time (or PDT when growing into a population) of less than 20 days, less than 15 days, less than 10 days or less than 5 days.

[0090] Suitablely, therefore, at 1 passage (P1), P2, P3, P4, P5, P8, P10, P15, P20, P25, P30 and / or higher passage numbers; at higher passage numbers, such as P10, P11, P12, P13, P14, P15, P20, P25, P30 and / or higher; from P1 to P15; from P1 to P5, P6 to P10 and / or P11 to P15; at P10; or at P15, MSCs with high growth rates may contain low cell doubling time (or PDT when grown into a population) of less than 20 days, less than 15 days, less than 10 days or less than 5 days.

[0091] For highly proliferating MSCs, suitably, the cell or population doubling time at high passage numbers is maintained at less than 20 days, less than 15 days, less than 10 days, or less than 5 days. For highly proliferating MSCs, suitably, the cell or population doubling time from at least P1 to P10, and suitably from P1 to P15, is maintained at less than 20 days, less than 15 days, less than 10 days, or less than 5 days. In one embodiment, MSCs with high proliferating capacity or high growth rate maintain a cell doubling time (or PDT when growing into a population) of less than 10 days from passage number P1 to P15.

[0092] Suitablely, therefore, for completeness, MSCs with low proliferative capacity are essentially the opposite of the definition provided above. Suitablely, when compared to the average proliferation rate and / or average proliferation duration in a population of MSCs (suitably, which may be a heterologous population of MSCs), suitablely, MSCs with low proliferative capacity are MSCs that proliferate at a slower rate or are capable of proliferating. Suitablely, when compared to the average proliferation rate and / or average proliferation duration in a population of MSCs from which cells are identified or selected. Suitablely, when compared to the average growth rate and / or average growth period in a population of MSCs (suitably, which may be a heterologous population of MSCs), suitablely, MSCs with low proliferative capacity are MSCs that have or are capable of having a low growth rate. Suitablely, when compared to the average growth rate and / or average growth period in a population of MSCs from which cells are identified or selected.

[0093] Suitablely, at 1 passage (P1), P2, P3, P4, P5, P8, P10, P15, P20, P25, P30 and / or higher passage numbers; at higher passage numbers, such as P10, P11, P12, P13, P14, P15, P20, P25, P30 and / or higher; during P1-P15; during P1-P5, P6-P10 and / or P11-P15; at P10; or at P15, MSCs with low proliferative capacity or low growth rate may contain high cell doubling time (or PDT when growing into a population) of more than 10 days, more than 15 days, or more than 20 days.

[0094] Suitablely, the doubling time increases with the passage number of MSCs with low proliferative capacity or low growth rate. Suitablely, therefore, at higher passage numbers, such as P10, P11, P12, P13, P14, P15, P20, P25, P30 and / or higher, MSCs with low proliferative capacity or low growth rate may contain high cell doubling times (or PDTs when grown into populations) of more than 10 days, more than 15 days, or more than 20 days. Suitablely, at P10 or higher, there is a high cell doubling time (or PDTs when grown into populations) of more than 10 days. Suitablely, at P15 and higher, there is a high cell doubling time (or PDTs when grown into populations) of more than 15 days.

[0095] In one implementation, a highly proliferative MSC is one that can grow for a longer period of time before reaching senescence than another type of MSC, or for a longer period of time before reaching senescence than the average time of a population of MSCs (suitably, which may be a heterologous population of MSCs). Suitablely, a highly proliferative MSC can therefore be one that grows for a longer period of time before reaching senescence than another type of MSC, or for a longer period of time before reaching senescence than the average time of a population of MSCs (suitably, which may be a heterologous population of MSCs).

[0096] "Longer growth duration" in this context refers to the duration of growth, i.e., the growth phase, in other words, the time a cell is able to grow before senescence. For MSCs with high proliferative capacity, appropriately, longer growth duration may refer to a longer growth phase. Appropriately, therefore, MSCs may have a long growth phase, or are capable of having a long growth phase. Appropriately, therefore, MSCs may have a longer growth phase, or are capable of having a growth phase longer than the average growth phase of a population of MSCs (appropriately, which may be a heterologous population of MSCs).

[0097] "Growth duration" or "growth phase" also excludes the time of cell growth arrest (e.g., by freezing at -20°C or -80°C). Suitablely, a longer growth duration or a longer growth phase can be established compared to the average duration of the growth or growth phase of the same cell population as MSCs, or compared to the average duration of the growth or growth phase of another different cell population (suitably, which may be a heterologous population of MSCs).

[0098] The growth duration or growth period of MSCs can be determined by any suitable means known to those skilled in the art, including the techniques described in the examples.

[0099] Suitably, the growth duration or growth period of the MSCs can be measured by the number of passages the cell line can grow before senescence. Suitably, highly proliferative MSCs can grow, or can grow for a duration greater than eighteen passages (P18), P19, P21, P22, P23, P24, P25, P26, P27, P28, P29, P30 and / or more. In one embodiment, highly proliferative MSCs can grow, or can grow for P18 or more passages. In another embodiment, highly proliferative MSCs can grow, or can grow for P20 or more passages. In another embodiment, highly proliferative MSCs can grow, or can grow for P22 or more passages. In yet another embodiment, highly proliferative MSCs can grow, or can grow for 24 or more passages.

[0100] Suitablely, therefore, MSCs with a long growth period can be defined as having a growth period of more than eighteen passages (P18), P19, P21, P22, P23, P24, P25, P26, P27, P28, P29, P30 and / or more passages. In one embodiment, MSCs with a long growth period can be defined as having a growth period of P18 or more passages. In one embodiment, MSCs with a long growth period can be defined as having a growth period of P20 or more passages. In one embodiment, MSCs with a long growth period can be defined as having a growth period of P22 or more passages. In one embodiment, MSCs with a long growth period can be defined as having a growth period of P22 or more passages. In one embodiment, MSCs with a long growth period can be defined as having a growth period of P24 or more passages.

[0101] Optionally or additionally, the growth duration or growth phase of MSCs can be measured by the number of generations of cell divisions that the cells have undergone since the cell line was initialized from the tissue sample, or by the average number of generations of cell divisions. The number of generations of cell divisions is also known as the population multiplication number, or, in the case of a cell population, the cumulative population multiplication number. The determination of the population multiplication number is described in the examples. Suitablely, the population multiplication (PD) can be calculated using the following formula: PD = [log(number of harvested MSCs) - log(number of inoculated MSCs)] / log(2)].

[0102] Suitablely, highly proliferative MSCs are capable of growing or can grow for 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60 or more generations of cell division or population doubling. In one embodiment, highly proliferative MSCs are capable of growing or can grow for 44 or more generations of cell division or population doubling. In another embodiment, highly proliferative MSCs are capable of growing or can grow for 50 or more generations of cell division or population doubling. In another embodiment, highly proliferative MSCs are capable of growing or can grow for 55 or more generations of cell division or population doubling. In yet another embodiment, highly proliferative MSCs are capable of growing or can grow for 60 or more generations of cell division or population doubling.

[0103] Suitablely, therefore, MSCs with a long growth phase can be defined as having a growth phase with 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60 or more generations of cell division or population doubling. In one embodiment, MSCs with a long growth phase can be defined as having a growth phase with 44 or more generations or population doubling. In one embodiment, MSCs with a long growth phase can be defined as having a growth phase with 50 or more generations or population doubling. In one embodiment, MSCs with a long growth phase can be defined as having a growth phase with 55 or more generations or population doubling. In one embodiment, MSCs with a long growth phase can be defined as having a growth phase with 60 or more generations or population doubling.

[0104] Suitablely, therefore, for completeness, MSCs with low proliferative capacity are essentially the opposite of the definition provided above. Suitablely, when compared to the average proliferation rate and / or average proliferation duration in a population of MSCs (suitably, which may be a heterologous population of MSCs), suitablely, MSCs with low proliferative capacity are MSCs that proliferate or are capable of proliferating for a shorter duration before senescence. Suitablely, when compared to the average proliferation rate and / or average proliferation duration in a population of MSCs from which cells are identified or selected. Suitablely, when compared to the average growth rate and / or average growth phase in a population of MSCs (suitably, which may be a heterologous population of MSCs), suitablely, MSCs with low proliferative capacity are MSCs that have or are capable of having a short growth phase. Suitablely, when compared to the average growth rate and / or average growth phase in a population of MSCs from which cells are identified or selected.

[0105] Suitablely, MSCs with a short growth period can be defined as having a growth period of less than eighteen passages (P18), suitablely less than P17, P16, P15, P14, P13, P12, P11, P10, P9, P8, P7, P6, P5, P4, P3, P2, or P1 passages. In one embodiment, MSCs with a short growth period can be defined as having a growth period of P18 or fewer passages.

[0106] Suitablely, therefore, MSCs with a short growth phase can be defined as having a growth phase of less than 60 cell divisions, suitablely less than 59, 58, 57, 56, 55, 54, 53, 52, 51, 50, 49, 48, 47, 46, 45, or 44 cell divisions. In one embodiment, MSCs with a long growth phase can be defined as having a growth phase of 44 or fewer.

[0107] Suitablely, when culturing MSCs, any growth measurement of proliferative capacity as defined above can be measured. Suitablely, this is suitable when MSCs are cultured in typical media and under typical culture conditions. Exemplary conditions for culturing MSCs are provided in the embodiments herein, but are also known in the art, such as from Salerno et al Stem Cells 2020, 38:1438-53 and Kafienah et al Stem Cells 2006, 24:1113-20. For example, any growth measurement described herein can be measured when MSCs are cultured under the following conditions: in a medium containing low glucose, Dulbecco's modified Eagles medium (Sigma) supplemented with 10% (v / v) fetal bovine serum (FBS, Thermo Scientific Hyclone, Loughborough, UK), 1% (v / v) Glutamax (Sigma), and 1% (v / v) penicillin / streptomycin (Sigma). Optionally, the medium may be supplemented with 10 ng / ml FGF-2 (Peprotech). Suitablely, the cell suspension can then be separated, for example by repeated washing with culture medium. Suitablely, the cells can then be precipitated and resuspended, for example by centrifugation at 500 g for 5 minutes and removal of the supernatant / fat. The resulting cell pellet can then be resuspended in culture medium and, for example, at 1.5–2.0 x 10⁻⁶. 5 Nucleated cells / cm 2 The cells are seeded at the appropriate density in plates. Suitablely, the cells can then be incubated in the same medium, for example, at 37°C in a humidified atmosphere of 5% CO2 and 95% air. Suitablely, the medium is changed periodically, for example every four days to every other day, suitablely until the adherent cells reach 90% confluence. Suitablely, the cells can then be passaged.

[0108] Gene expression of GAS6 and GAS6-AS1

[0109] Aspects of the present invention relate to obtaining and using data indicating gene expression levels of GAS6, GAS6-AS1 and / or the ratio of GAS6-AS1:GAS6 gene expression levels.

[0110] "Gene expression" refers to the transcription of genes into RNA products. Therefore, "gene expression level" refers to the abundance of RNA transcripts produced by genes and is unrelated to the lifespan of the transcribed RNA, which may be rapidly degraded and thus have a short lifespan.

[0111] Data indicating gene expression and / or gene expression levels may refer to data containing information about the presence, relative or absolute abundance of RNA transcripts, and / or the gene's ability to produce RNA transcripts, such as DNA chromatin markers. Suitablely, data indicating gene expression and / or gene expression levels may be, for example, DNA or RNA sequencing data, or fluorescence imaging data.

[0112] Suitablely, gene expression data (i.e., data indicating gene expression, i.e., data indicating gene expression levels) can be obtained by, for example, quantitative polymerase chain reaction (qPCR, also known as real-time PCR), high-throughput transcriptome sequencing (also known as RNA sequencing or RNA-seq), in vivo fluorescent nucleotide imaging, DNA / RNA microarray analysis, expressed sequence tag (EST) sequencing, Sanger sequencing of complementary DNA (cDNA), digital PCR (also known as droplet digital PCR), and Northern blotting, as well as any other method known in the art.

[0113] Suitablely, gene expression or gene expression levels can be measured in appropriate units known in the art, such as gene counts, transcription counts, read counts, truncated mean of m values ​​(TMM), or delta Ct (i.e., Ct) value. As those skilled in the art will understand, the specific value and unit of measurement are typically determined by the technique chosen for measuring gene expression, which can be any technique described herein.

[0114] Optionally or additionally, data indicating gene expression levels may refer to data containing information about protein expression, preferably protein expression from the gene being indicated. Suitablely, this could be the expression of the GAS6 protein. Suitable protein expression may refer to information about the presence, relative or absolute abundance, or activity of the protein. Suitablely, data indicating protein expression may be, for example, Western blot data or fluorescence imaging data.

[0115] Appropriately, protein expression data can be obtained through methods such as Western blotting, fluorescence imaging, semi-quantitative SDS-PAGE software tools like ImageJ, mass spectrometry, and ELISA.

[0116] In one embodiment, obtaining data indicating the expression levels of one or more genes, GAS6 and GAS-AS1, involves measuring the gene expression levels of GAS6 and GAS-AS1. Suitablely, this is done using any of the techniques listed above. In one embodiment, it is done via RNA-seq or qPCR.

[0117] Examples of methods for obtaining gene expression data can be found in the embodiments.

[0118] GAS6 (Growth Arrest-Specific Gene 6) is a gene expressed in humans that is involved in stimulating cell proliferation. GAS6-AS1 (GAS6 Antisense RNA 1) is a non-protein-coding RNA that is the antisense sequence of GAS6 involved in the regulation of GAS6.

[0119] Suitably, the GAS6 gene may comprise the nucleic acid sequence according to SEQ ID NO: 1 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 1. Suitably, the GAS6 gene may comprise the GAS6 coding sequence (CDS) according to SEQ ID NO: 2 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 2. A translation of SEQ ID NO: 2 is provided in SEQ ID NO: 3. Suitably, GAS6 may be any gene annotated as GAS6 in a public database and is considered to perform the same function as GAS6 found in humans.

[0120] Suitably, the GAS6-AS1 gene may comprise the nucleic acid sequence according to SEQ ID NO: 4 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 4. Suitably, GAS6-AS1 may be any gene annotated as GAS6-AS1 in a public database and is considered to perform the same function as GAS6-AS1 found in humans.

[0121] The ratio of GAS6-AS1:GAS6 gene expression levels can be calculated by dividing the GAS6-AS1 gene expression level by the GAS6 gene expression level. Suitablely, the expression level includes a numerical data value indicating the expression level. The numerical data values ​​indicating the gene expression of GAS6 and / or GAS6-AS1 can be obtained as described above by, for example, quantitative polymerase chain reaction (qPCR, also known as real-time PCR), high-throughput transcriptome sequencing (also known as RNA sequencing or RNA-seq), in vivo fluorescent nucleotide imaging, DNA / RNA microarray analysis, expressed sequence tag (EST) sequencing, Sanger sequencing of complementary DNA (cDNA), digital PCR (also known as droplet digital PCR), and Northern blotting, as well as any other method known in the art. Suitablely, this ratio is a relative measurement of the GAS6-AS1 gene expression level compared to the GAS6 gene expression level. Suitablely, therefore, any numerical data value indicating the gene expression levels of GAS6 and GAS6-AS1 can be used to calculate their ratio, provided that the same type of numerical data is used for each gene.

[0122] Suitably, in any aspect of the invention, any combination of the expression level of the GAS6 gene, the expression level of the GAS6-AS1 gene, and / or the gene expression ratio of GAS6-AS1:GAS6 can be used to indicate mesenchymal stem cells with high proliferative capacity. Suitably, the expression level of one or more of these genes, or the ratio thereof, can be used as a marker of high proliferative capacity.

[0123] In any embodiment of this invention, the marker indicating high proliferative capacity of MSCs is the expression level of the GAS6 gene. Suitably, in such an embodiment, the method of this invention may include the following steps:

[0124] a. Obtain data on the expression level of the GAS6 gene in indicator mesenchymal stem cells;

[0125] b. Compare the expression level of step (a) with the reference value;

[0126] c. If the expression level of the GAS6 gene is lower than the reference value, identify, characterize, or select mesenchymal stem cells with high proliferative capacity.

[0127] In a preferred embodiment of any aspect of the invention, the marker for indicating high proliferative capacity of MSCs is the expression level of the GAS6-AS1 gene. Suitably, in such an embodiment, the method of the invention may include the following steps:

[0128] a. Obtain data on the expression level of the GAS6-AS1 gene in indicator mesenchymal stem cells;

[0129] b. Compare the expression level of step (a) with the reference value;

[0130] c. If the expression level of the GAS6-AS1 gene is lower than the reference value, identify, characterize, or select mesenchymal stem cells with high proliferative capacity.

[0131] In a more preferred embodiment of any aspect of the invention, the marker indicating high MSC proliferative capacity is the gene expression ratio of GAS6-AS1:GAS6. Suitably, in such an embodiment, the method of the invention may include the following steps:

[0132] a. Obtain data on the expression levels of one or two of the following genes in indicator mesenchymal stem cells: GAS6 and GAS6-AS1;

[0133] b. Calculate the ratio of gene expression levels of GAS6-AS1:GAS6;

[0134] c. Compare the ratio from step (b) with the reference value;

[0135] d. If the GAS6-AS1:GAS6 gene expression ratio is lower than the reference value, identify, characterize, or select mesenchymal stem cells with high proliferative capacity.

[0136] Reference value

[0137] An aspect of the present invention relates to comparing the gene expression levels of GAS6, GAS6-AS1 and / or the ratio of GAS6-AS1:GAS6 gene expression levels with reference values ​​in order to identify, characterize or select MSCs with high proliferative capacity.

[0138] Suitablely, as those skilled in the art will understand, reference values ​​may be considered typical values ​​within a population of MSCs, suitablely representing typical gene expression levels of GAS6 and GAS6-AS1, and / or the typical ratio of GAS6-AS1:GAS6 gene expression within a population of MSCs. Suitablely, reference values ​​may be considered their average values ​​within a population of MSCs, suitablely representing average gene expression levels of GAS6 and GAS6-AS1, and / or the average ratio of GAS6-AS1:GAS6 gene expression within a population of MSCs. Suitablely, such a population of MSCs may be considered a reference population.

[0139] Appropriately, it should be understood that reference values ​​will depend on the measurement technique used and on the desired proliferative capacity chosen. This document describes suitable measurement techniques for measuring gene expression levels. In some embodiments, the measurement technique is RNA-seq.

[0140] Appropriately, therefore, the reference values ​​may be the median levels of GAS6 gene and GAS6-AS1 gene expression, and / or the median ratio of GAS6-AS1:GAS6 gene expression in the reference population of MSCs.

[0141] Appropriately, therefore, the reference values ​​may be the average level of GAS6 gene and GAS6-AS1 gene expression in the reference population of MSCs, and / or the median ratio of GAS6-AS1:GAS6 gene expression.

[0142] Suitablely, the reference population can be a typical MSC population. Suitablely, the reference population can be a heterologous population of MSCs as defined above. Suitable heterologous populations are available in the art or can be readily prepared and measured. In some embodiments, the reference population can be a population of MSCs having similar numbers of low-proliferating MSCs and high-proliferating MSCs, suitablely having approximately equal numbers of low-proliferating MSCs and high-proliferating MSCs, wherein low- and high-proliferating MSCs are as defined elsewhere herein. Suitablely, such a reference population can be prepared from a population or sample of available MSCs known to have high or low proliferating capacity, such a population is known in the art and can be ordered. Optionally, various MSC samples from different sources or samples can be collected and cultured for a suitable length of time to determine their proliferative capacity by conventionally measuring growth rate or other parameters defined above to find suitable high- and low-proliferating cells, which can then be combined to form a reference population.

[0143] Suitablely, in some cases, the reference values ​​may be the mean expression levels of the GAS6 gene, the GAS6-AS1 gene, and / or the median ratio of GAS6-AS1:GAS6 gene expression in the population of MSCs from which the target MSCs are derived.

[0144] Suitablely, in some cases, the reference values ​​may be the median expression levels of the GAS6 gene, the GAS6-AS1 gene, and / or the median ratio of GAS6-AS1:GAS6 gene expression in the population of MSCs from which the target MSCs are derived.

[0145] Suitablely, the median level of gene expression is determined by obtaining data on the expression levels of one or more genes in each MSC of the population indicating MSCs (suitably obtained using the standard expression measurement techniques described herein), then ranking the data points of expression levels in each MSC from minimum to maximum, and selecting the expression level as the median data point in the list. Suitablely, for the target MSCs, the median level of gene expression is determined in the same manner, using the same techniques / methods.

[0146] Suitablely, the reference values ​​may be the mean or median relative expression levels of the GAS6 gene and the GAS6-AS1 gene in a reference population of MSCs, and / or the median ratio of GAS6-AS1:GAS6 relative gene expression. Suitablely, the reference population is a population of MSCs having a similar number of low-proliferating MSCs and high-proliferating MSCs, suitablely having approximately equal numbers of low-proliferating MSCs and high-proliferating MSCs, wherein the low- and high-proliferating MSCs are as described elsewhere herein.

[0147] Suitablely, the reference values ​​may be the mean relative expression levels of the GAS6 gene and the GAS6-AS1 gene and / or the median ratio of the relative gene expression of GAS6-AS1:GAS6 in the population of MSCs from which the target MSCs are derived.

[0148] Suitablely, the reference values ​​may be the median relative expression levels of the GAS6 gene, the GAS6-AS1 gene, and / or the median ratio of GAS6-AS1:GAS6 relative gene expression in the population of MSCs from which the target MSCs are derived.

[0149] The term "relative expression" used in this article refers to the expression level of the target gene relative to the normalization factor.

[0150] Suitablely, the normalization factor can be the size of the gene expression data source, suitablely the size of the library, suitable for example when using high-throughput transcription sequencing (also known as RNA sequencing or RNA-seq). Suitablely, the normalization factor can be the number of mapped reads. “Mapped reads” are defined herein as the number of reads or fragments from a library mapped to a suitable reference genome, suitablely from a high-throughput transcription sequencing (also known as RNA sequencing or RNA-seq) library, for example, suitablely can be measured in counts per million (CPM) or reads per million mapped reads (RPM). Suitablely, the normalization factor can be the size of the gene expression data source, suitablely the size of the library as described above, and optionally also the length of the target transcript corresponding to the gene being measured, suitablely can be measured in reads per kilo base of transcript per million mapped reads (RPKM). Suitablely, the normalization factor can be the expression level of a control gene used to normalize the results for all samples, and suitablely, it can be measured in any unit. A “control gene” can be any gene commonly used in the art for normalization purposes, and suitablely, any gene widely expressed at stable levels in different biological contexts, such as a housekeeping gene. Suitable control genes could be: GAPD, ACTB, B2M, TUBA, G6PD, LDHA, and HPRT.

[0151] The reference value for GAS6 gene expression level is appropriately higher than the GAS6 gene expression value found in MSCs that have been identified as having high proliferative capacity, as established elsewhere herein. Suitablely, determining whether a population has high proliferative capacity can be done by culturing the population and measuring one or more of the aforementioned growth characteristics.

[0152] Similarly, reference values ​​for GAS6 gene expression levels are suitably equal to or lower than those found in MSCs identified as having low proliferative capacity (wherein low proliferative capacity has been established elsewhere herein). Suitably, determining whether a population has low proliferative capacity can be done by culturing the population and measuring one or more of the aforementioned growth characteristics.

[0153] Appropriately, therefore, the reference value for GAS6 gene expression level is appropriately higher than that for those MSCs that have been identified as having high proliferative capacity (where high proliferative capacity has been established as elsewhere herein). Appropriately, determining whether a population has high proliferative capacity can be done by culturing the population and measuring one or more of the above-described growth characteristics.

[0154] Suitablely, the reference value for GAS6 gene expression level may be higher than the relative expression value of GAS6 found in MSCs that have been identified as having high proliferative capacity (wherein high proliferative capacity has been established as elsewhere herein), and wherein the relative expression of GAS6 is the expression level of GAS6 relative to the expression level of the control gene. Suitablely, determining whether a population has high proliferative capacity can be done by culturing the population and measuring one or more of the above-described growth characteristics.

[0155] Accordingly, the reference value for GAS6 gene expression level is appropriately higher than the relative expression of GAS6 in those MSCs that have been identified as having high proliferative capacity (wherein high proliferative capacity has been established as elsewhere herein), and wherein the relative expression of GAS6 is the expression level of GAS6 relative to the expression level of the control gene. Suitablely, determining whether a population has high proliferative capacity can be done by culturing the population and measuring one or more of the aforementioned growth characteristics.

[0156] In one implementation, MSCs are considered to have high proliferative capacity if their GAS6 gene expression levels are the same as or lower than those found in MSCs already identified as having low proliferative capacity (wherein low proliferative capacity has been established elsewhere herein). Suitably, determining whether a population has low proliferative capacity can be done by culturing the population and measuring one or more of the aforementioned growth characteristics.

[0157] Reference values ​​for GAS6 gene expression can be determined at cell passage numbers of 1 (P1), P2, P3, P4, P5, P8, P10, P15, P20, P25, P30 and / or higher. Suitably, the reference value for GAS6 gene expression can be determined at P1. Suitably, the reference value for GAS6 gene expression can be determined during P1–P10. In one embodiment, the reference value for GAS6 gene expression can be determined at P1. In one embodiment, the reference value for GAS6 gene expression can be determined at P2. In one embodiment, the reference value for GAS6 gene expression can be determined at P3. In one embodiment, the reference value for GAS6 gene expression can be determined at P4. In one embodiment, the reference value for GAS6 gene expression can be determined at P5. In one embodiment, the reference value for GAS6 gene expression can be determined at P6. In one embodiment, the reference value for GAS6 gene expression can be determined at P7. In one embodiment, the reference value for GAS6 gene expression can be determined at P8. In one embodiment, the reference value for GAS6 gene expression can be determined at P9. In one implementation, a reference value for GAS6 gene expression can be determined at P10.

[0158] Reference values ​​for GAS6 gene expression can be determined using the same techniques / methods used to determine GAS6 gene expression levels. Techniques for determining gene expression levels are described elsewhere in this specification. In one embodiment, GAS6 gene expression levels can be determined by high-throughput transcriptome sequencing (also known as RNA sequencing or RNA-seq), optionally followed by processing with the various software packages described in the examples. In one embodiment, GAS6 gene expression levels can be determined by quantitative polymerase chain reaction (qPCR, also known as real-time PCR). In one embodiment, GAS6 gene expression levels can be determined by digital PCR (also known as droplet digital PCR).

[0159] Appropriately, reference values ​​for GAS6 gene expression can be measured in terms of gene counts, preferably relative gene counts. Appropriately, the gene counts are correlated with library size (i.e., normalized), preferably with the size of a high-throughput transcriptome sequencing (also known as RNA sequencing or RNA-seq) library. Appropriately, reference values ​​for GAS6 gene expression can be measured in terms of counts per million mapped reads (CPM) or reads per million mapped reads (RPM). Appropriately, gene counts are typically measured in terms of counts per million mapped reads (CPM) or reads per million mapped reads (RPM).

[0160] Suitablely, the reference value for GAS6 gene expression can therefore be 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 relative gene counts (suitably CPM). Suitablely, in one embodiment, at any number of passages, such as (P1), P2, P3, P4, P5, P8, P10, P15, P20, P25, P30, and / or higher, it is passaged once (P1). Suitablely, reference values ​​for GAS6 gene expression may be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, or 58 relative gene counts (suitably CPM). Suitablely, at any passage number, such as (P1), P2, P3, P4, P5, P8, P10, P15, P20, P25, P30, and / or higher passage numbers, in one embodiment, at passage P10. Suitablely, reference values ​​for GAS6 gene expression may be 42, 43, or 44 relative gene counts (suitably CPM). Suitablely, in one embodiment, at any number of generations, such as (P1), P2, P3, P4, P5, P8, P10, P15, P20, P25, P30 and / or higher, generation P15 is used.

[0161] Suitablely, therefore, if the GAS6 gene expression level of MSCs is below 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 relative gene counts (suitably CPM), then MSCs have high proliferative capacity. Suitablely, in one embodiment, at any passage number, such as (P1), P2, P3, P4, P5, P8, P10, P15, P20, P25, P30, and / or higher passage numbers, after one passage (P1). Suitablely, therefore, if the GAS6 gene expression level of MSCs is below 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, or 58 relative gene counts (suitably CPM), then the MSCs have high proliferative capacity. Suitablely, any passage number, such as (P1), P2, P3, P4, P5, P8, P10, P15, P20, P25, P30, and / or higher, in one embodiment at P10. Suitablely, therefore, if the GAS6 gene expression level of MSCs is below 42, 43, or 44 relative gene counts (suitably CPM), then the MSCs have high proliferative capacity. Suitablely, any number of passages, such as (P1), P2, P3, P4, P5, P8, P10, P15, P20, P25, P30, and / or higher, in one embodiment at P15.

[0162] Suitablely, the above reference values ​​may be applicable when measuring GAS6 gene expression levels using RNA-seq. Suitablely, therefore, the above reference values ​​are measured using RNA-seq. Optionally, one or more further processing steps may be applied to the gene expression data obtained from RNA-seq, such as genome alignment using Bowtie2 and a suitable reference genome, sequence counting using htseq-count, and R-library DESeq2 rlog transformation. Exemplary methods for measuring GAS6 gene expression are shown in the embodiments herein.

[0163] The reference value for GAS6-AS1 gene expression level is appropriately higher than the GAS6-AS1 gene expression value found in those MSCs that have been identified as having high proliferative capacity (where high proliferative capacity has been established as elsewhere herein). Appropriately, determining whether a population has high proliferative capacity can be done by culturing the population and measuring one or more of the aforementioned growth characteristics.

[0164] Similarly, reference values ​​for GAS6-AS1 gene expression levels are suitably equal to or lower than those found in MSCs identified as having low proliferative capacity (wherein low proliferative capacity has been established elsewhere herein). Suitably, determining whether a population has low proliferative capacity can be done by culturing the population and measuring one or more of the aforementioned growth characteristics.

[0165] Accordingly, the reference value for GAS6-AS1 gene expression level is appropriately higher than that for those MSCs that have been identified as having high proliferative capacity (where high proliferative capacity has been established as elsewhere herein). Appropriately, determining whether a population has high proliferative capacity can be done by culturing the population and measuring one or more of the aforementioned growth characteristics.

[0166] Suitablely, the reference value for the GAS6-AS1 gene expression level may be higher than the relative expression value of GAS6-AS1 found in MSCs that have been identified as having high proliferative capacity (wherein high proliferative capacity has been established as elsewhere herein), and wherein the relative expression of GAS6-AS1 is the expression level of GAS6-AS1 relative to the expression level of the control gene. Suitablely, determining whether a population has high proliferative capacity can be done by culturing the population and measuring one or more of the above-described growth characteristics.

[0167] Accordingly, the reference value for the GAS6-AS1 gene expression level is appropriately higher than the relative expression of GAS6-AS1 in those MSCs that have been identified as having high proliferative capacity (wherein high proliferative capacity has been established as elsewhere herein), and wherein the relative expression of GAS6-AS1 is the expression level of GAS6-AS1 relative to the expression level of the control gene. Suitablely, determining whether a population has high proliferative capacity can be done by culturing the population and measuring one or more of the aforementioned growth characteristics.

[0168] In one implementation, MSCs are considered to have high proliferative capacity if their GAS6-AS1 gene expression levels are the same as or lower than those found in MSCs already identified as having low proliferative capacity (wherein low proliferative capacity has been established elsewhere herein). Suitably, determining whether a population has low proliferative capacity can be done by culturing the population and measuring one or more of the aforementioned growth characteristics.

[0169] Reference values ​​for GAS6-AS1 gene expression can be determined at cell passage numbers of 1 (P1), P2, P3, P4, P5, P8, P10, P15, P20, P25, P30 and / or higher. Suitably, the reference value for GAS6-AS1 gene expression can be determined at P1. Suitably, the reference value for GAS6-AS1 gene expression can be determined during P1–P10. In one embodiment, the reference value for GAS6-AS1 gene expression can be determined at P1. In one embodiment, the reference value for GAS6-AS1 gene expression can be determined at P2. In one embodiment, the reference value for GAS6-AS1 gene expression can be determined at P3. In one embodiment, the reference value for GAS6-AS1 gene expression can be determined at P4. In one embodiment, the reference value for GAS6-AS1 gene expression can be determined at P5. In one embodiment, the reference value for GAS6-AS1 gene expression can be determined at P6. In one embodiment, the reference value for GAS6-AS1 gene expression can be determined at P7. In one embodiment, the reference value for GAS6-AS1 gene expression can be determined at P8. In one embodiment, the reference value for GAS6-AS1 gene expression can be determined at P9. In one embodiment, the reference value for GAS6-AS1 gene expression can be determined at P10.

[0170] Reference values ​​for GAS6-AS1 gene expression can be obtained using the same techniques / methods used to determine GAS6-AS1 gene expression levels. Techniques for determining gene expression levels are described elsewhere in this specification. In one embodiment, GAS6-AS1 gene expression levels can be determined by high-throughput transcriptome sequencing (also known as RNA sequencing or RNA-seq), and optionally processed using the various software packages described in the examples. In one embodiment, GAS6-AS1 gene expression levels can be determined by quantitative polymerase chain reaction (qPCR, also known as real-time PCR). In one embodiment, GAS6-AS1 gene expression levels can be determined by digital PCR (also known as droplet digital PCR).

[0171] Suitablely, reference values ​​for GAS6-AS1 gene expression levels can be measured in gene counts, preferably in relative gene counts. Suitablely, said gene counts are related to library size (i.e., normalized), preferably to high-throughput transcriptome sequencing (also known as RNA sequencing or RNA-seq) library size. Suitablely, reference values ​​for GAS6 gene expression can be measured in counts per million mapped reads (CPM) or reads per million mapped reads (RPM). Suitablely, gene counts are typically measured in counts per million mapped reads (CPM) or reads per million mapped reads (RPM).

[0172] Suitablely, reference values ​​for GAS6-AS1 gene expression levels may be 10k (where 'k' represents 1000, i.e., 10,000), 15k (15,000), 20k (20,000), 25k (25,000), 30k (30,000), 35k (35,000), or 40k (40,000) relative gene counts (suitably CPM). Suitablely, in one embodiment, at any number of passages, such as (P1), P2, P3, P4, P5, P8, P10, P15, P20, P25, P30, and / or higher, it is at 1 passage (P1). Suitablely, reference values ​​for GAS6-AS1 gene expression levels may be 16k, 17k, 18k, 19k, or 20k relative gene counts (suitably CPM). Suitably, at any number of passages, such as (P1), P2, P3, P4, P5, P8, P10, P15, P20, P25, P30 and / or higher, in one embodiment at P5. Suitably, the reference value for the GAS6-AS1 gene expression level may be 11k, 15k, 20k, 25k, 30k, 35k, 40k or 44k relative gene counts (suitably CPM). Suitably, at any number of passages, such as (P1), P2, P3, P4, P5, P8, P10, P15, P20, P25, P30 and / or higher, in one embodiment at 10 passages. Suitably, the reference value for the GAS6-AS1 gene expression level may be 20k, 25k, or 30k relative gene counts (suitably CPM). Suitably, at any passage number, such as (P1), P2, P3, P4, P5, P8, P10, P15, P20, P25, P30 and / or higher, in one embodiment at P15. Suitably, a reference value for the GAS6-AS1 gene expression level may be 20k relative gene counts (suitably CPM). Suitably, at any passage number between and including P1 and P15. Suitably, at any passage number, a reference value for the GAS6-AS1 gene expression level may be 20k relative gene counts (suitably CPM).

[0173] Suitablely, therefore, if the GAS6-AS1 gene expression level of MSCs is below 10k, 15k, 20k, 25k, 30k, 35k, or 40k relative gene counts (suitably CPM), then MSCs have high proliferative capacity. Suitablely, in one embodiment, at any passage number, such as (P1), P2, P3, P4, P5, P8, P10, P15, P20, P25, P30, and / or higher passage numbers, after one passage (P1). Suitablely, therefore, if the GAS6-AS1 gene expression level of MSCs is below 16k, 17k, 18k, 19k, or 20k relative gene counts (suitably CPM), then MSCs have high proliferative capacity. Suitably, at any passage number, such as (P1), P2, P3, P4, P5, P8, P10, P15, P20, P25, P30 and / or higher, in one embodiment at P5. Suitably, therefore, if the GAS6-AS1 gene expression level of MSCs is below 11k, 15k, 20k, 25k, 30k, 35k, 40k or 44k relative gene counts (suitably CPM), then MSCs have high proliferative capacity. Suitably, at any passage number, such as (P1), P2, P3, P4, P5, P8, P10, P15, P20, P25, P30 and / or higher, in one embodiment at P10. Suitably, therefore, if the GAS6-AS1 gene expression level of MSCs is below 20k, 25k or 30k relative gene counts (suitably CPM), then MSCs have high proliferative capacity. Suitably, at any passage number, such as (P1), P2, P3, P4, P5, P8, P10, P15, P20, P25, P30 and / or higher, in one embodiment at P15. Suitably, therefore, at any passage number between and including P1 and P15, if the GAS6-AS1 gene expression level of MSCs is below 20k relative gene counts (suitably CPM), then MSCs have high proliferative capacity. Suitably, therefore, at any passage number, if the GAS6-AS1 gene expression level of MSCs is below 20k relative gene counts (suitably CPM), then MSCs have high proliferative capacity.

[0174] Suitablely, the above reference values ​​may be applicable when measuring GAS6-AS1 gene expression levels using RNA-seq. Suitablely, therefore, the above reference values ​​are measured using RNA-seq. Optionally, one or more further processing steps may be applied to the gene expression data obtained from RNA-seq, such as genome alignment using Bowtie2 and a suitable reference genome, sequence counting using htseq-count, and R-library DESeq2 rlog transformation. Exemplary methods for measuring GAS6-AS1 gene expression are shown in the embodiments herein.

[0175] The reference value for the ratio of GAS6-AS1:GAS6 gene expression levels (i.e., the ratio of GAS6-AS1:GAS6 gene expression levels) is suitably higher than the ratio of GAS6-AS1:GAS6 gene expression found in those MSCs that have been identified as having high proliferative capacity (where high proliferative capacity has been established as elsewhere herein). Suitably, determining whether a population has high proliferative capacity can be done by culturing the population and measuring one or more of the aforementioned growth characteristics.

[0176] Similarly, a reference value for the ratio of GAS6-AS1:GAS6 gene expression levels is suitably equal to or lower than the ratio of GAS6-AS1:GAS6 gene expression found in MSCs that have been identified as having low proliferative capacity (wherein low proliferative capacity has been established elsewhere herein). Suitably, determining whether a population has low proliferative capacity can be done by culturing the population and measuring one or more of the aforementioned growth characteristics.

[0177] Suitablely, the reference value for the ratio of GAS6-AS1:GAS6 gene expression levels is higher than that for those MSCs that have been identified as having high proliferative capacity (where high proliferative capacity has been established as elsewhere herein). Suitablely, determining whether a population has high proliferative capacity can be done by culturing the population and measuring one or more of the above-described growth characteristics.

[0178] Suitablely, the reference value for the ratio of GAS6-AS1:GAS6 gene expression levels may be higher than the relative expression ratio of GAS6-AS1:GAS6 found in MSCs identified as having high proliferative capacity (wherein high proliferative capacity has been established elsewhere herein), and wherein the relative expression ratio of GAS6-AS1:GAS6 is the ratio of GAS6-AS1:GAS6 expression relative to the expression level of the control gene. Suitablely, determining whether a population has high proliferative capacity can be done by culturing the population and measuring one or more of the above-described growth characteristics.

[0179] Suitablely, therefore, the reference value for the ratio of GAS6-AS1:GAS6 gene expression levels is appropriately higher than the relative expression ratio of GAS6-AS1 in those MSCs that have been identified as having high proliferative capacity (wherein high proliferative capacity has been established as elsewhere herein), and wherein the relative expression of GAS6-AS1:GAS6 is the ratio of GAS6-AS1:GAS6 expression relative to the expression level of the control gene. Suitablely, determining whether a population has high proliferative capacity can be done by culturing said population and measuring one or more of the above-described growth characteristics.

[0180] In one implementation, MSCs are considered to have high proliferative capacity if the ratio of GAS6-AS1:GAS6 gene expression levels in MSCs is lower than the ratio of GAS6-AS1:GAS6 gene expression levels found in MSCs that have been identified as having low proliferative capacity (wherein low proliferative capacity has been established elsewhere herein). Suitably, determining whether a population has high proliferative capacity can be done by culturing the population and measuring one or more of the above-described growth characteristics.

[0181] Reference values ​​for the GAS6-AS1:GAS6 gene expression ratio can be determined at cell passage numbers of 1 (P1), P2, P3, P4, P5, P8, P10, P15, P20, P25, P30 and / or higher. Suitably, the reference value for the GAS6-AS1:GAS6 gene expression ratio can be determined at P1. Suitably, the reference value for the GAS6-AS1:GAS6 gene expression ratio can be determined during P1-P10. In one embodiment, the reference value for the GAS6-AS1:GAS6 gene expression ratio can be determined at P1. In one embodiment, the reference value for the GAS6-AS1:GAS6 gene expression ratio can be determined at P2. In one embodiment, the reference value for the GAS6-AS1:GAS6 gene expression ratio can be determined at P3. In one embodiment, the reference value for the GAS6-AS1:GAS6 gene expression ratio can be determined at P4. In one embodiment, a reference value for the GAS6-AS1:GAS6 gene expression ratio can be determined at P5. In one embodiment, a reference value for the GAS6-AS1:GAS6 gene expression ratio can be determined at P6. In one embodiment, a reference value for the GAS6-AS1:GAS6 gene expression ratio can be determined at P7. In one embodiment, a reference value for the GAS6-AS1:GAS6 gene expression ratio can be determined at P8. In one embodiment, a reference value for the GAS6-AS1:GAS6 gene expression ratio can be determined at P9. In one embodiment, a reference value for the GAS6-AS1:GAS6 gene expression ratio can be determined at P10.

[0182] A reference value for the GAS6-AS1:GAS6 gene expression ratio can be obtained using the same techniques / methods as those used to determine the GAS6 and / or GAS6-AS1 gene expression levels, and then the ratio can be calculated as described above. Techniques for determining gene expression levels are described elsewhere in this specification. In one embodiment, the GAS6 and GAS6-AS1 gene expression levels can be determined by high-throughput transcriptome sequencing (also known as RNA sequencing or RNA-seq), and optionally processed using the various software packages described in the examples. In one embodiment, the GAS6-AS1:GAS6 gene expression ratio can be determined by quantitative polymerase chain reaction (qPCR, also known as real-time PCR). In one embodiment, the GAS6-AS1:GAS6 gene expression ratio can be determined by digital PCR (also known as droplet digital PCR). A reference value for the GAS6-AS1:GAS6 gene expression ratio can be obtained by directly dividing the GAS6-AS1 gene expression level by the GAS6 gene expression level. Suitablely, this ratio can be calculated without first normalizing the expression levels of GAS6-AS1 and GAS6 to a normalization factor, such as a control gene commonly used for normalization purposes in the art. Suitablely, this ratio is already a “relative” measure of GAS6-AS1 gene expression relative to GAS6 gene expression, and therefore does not require normalization.

[0183] Suitablely, a reference value for the gene expression ratio of GAS6-AS1:GAS6 can be measured as the ratio of the relative gene counts of GAS6-AS1 to GAS6 (suitably CPM). Suitablely, the relative gene counts of GAS6-AS1 and GAS6 are measured and expressed as described above. Suitablely, the gene count is measured and expressed as a percentage of the library size, suitably related to the size of the high-throughput transcriptome sequencing (also known as RNA sequencing or RNA-seq) library. Suitablely, a reference value for the gene expression ratio of GAS6-AS1:GAS6 can be measured as the ratio of the relative gene counts of GAS6-AS1 to GAS6 in units of counts per million mapped reads (CPM) or reads per million mapped reads (RPM). Suitablely, gene counts are typically measured in units of counts per million mapped reads (CPM) or reads per million mapped reads (RPM).

[0184] Suitably, at any passage number such as (P1), P2, P3, P4, P5, P8, P10, P15, P20, P25, P30 and / or higher, in one embodiment at passage 1 (P1), the reference value for the GAS6-AS1:GAS6 gene expression ratio may be 1:300, 1:350, 1:400, 1:450, 500, 1:550 or 1:600. Suitably, at any passage number such as (P1), P2, P3, P4, P5, P8, P10, P15, P20, P25, P30 and / or higher, in one embodiment at P5, the reference value for the GAS6-AS1:GAS6 gene expression ratio may be 1:450, 1:500, 1:550 or 1:600. Suitably, at any passage number such as (P1), P2, P3, P4, P5, P8, P10, P15, P20, P25, P30 and / or higher, in one embodiment, the reference value for the gene expression ratio of GAS6-AS1:GAS6 at P10 may be 1:500, 1:600, 1:650 or 1:700. Suitably, at any passage number such as (P1), P2, P3, P4, P5, P8, P10, P15, P20, P25, P30 and / or higher, in one embodiment, the reference value for the gene expression ratio of GAS6-AS1:GAS6 at P15 may be 1:550, 1:600 ​​or 1:650 units. Suitablely, at any number of passages between and including P1 and P15, a reference value for the gene expression ratio of GAS6-AS1:GAS6 may be 1:600. Suitablely, at any number of passages, a reference value for the gene expression ratio of GAS6-AS1:GAS6 may be 1:600.

[0185] Suitablely, therefore, if the GAS6-AS1:GAS6 gene expression ratio of MSCs is below 1:300, 1:350, 1:400, 1:450, 1:500, 1:550, or 1:600, then the MSCs have high proliferative capacity. Suitablely, in one embodiment, at any passage number, such as (P1), P2, P3, P4, P5, P8, P10, P15, P20, P25, P30, and / or higher passage numbers, after one passage (P1). Suitablely, therefore, if the GAS6-AS1:GAS6 gene expression ratio of MSCs is below 1:450, 1:500, 1:550, or 1:600, then the MSCs have high proliferative capacity. Suitably, at any passage number, such as (P1), P2, P3, P4, P5, P8, P10, P15, P20, P25, P30 and / or higher, in one embodiment at P5. Suitably, therefore, if the GAS6-AS1:GAS6 gene expression ratio of MSCs is less than 1:550, 1:600, 1:650 or 1:700, then the MSCs have high proliferative capacity. Suitably, at any passage number, such as (P1), P2, P3, P4, P5, P8, P10, P15, P20, P25, P30 and / or higher, in one embodiment at P10. Suitably, therefore, if the GAS6-AS1:GAS6 gene expression ratio of MSCs is less than 1:550, 1:600 ​​or 1:650, then the MSCs have high proliferative capacity. Suitably, at any passage number, such as (P1), P2, P3, P4, P5, P8, P10, P15, P20, P25, P30 and / or higher, in one embodiment at P15. Suitably, therefore, at any passage number between and including P1 and P15, if the GAS6-AS1:GAS6 gene expression ratio of MSCs is less than 1:600, then the MSCs have high proliferative capacity. Suitably, therefore, at any passage number, if the GAS6-AS1:GAS6 gene expression ratio of MSCs is less than 1:600, then the MSCs have high proliferative capacity.

[0186] To avoid confusion, a low GAS6-AS1:GAS6 gene expression ratio means that GAS6-AS1 expression is lower than the relative expression of GAS6. For example, a GAS6-AS1:GAS6 gene expression ratio of 1:600 ​​is lower than that of 1:300, and a GAS6-AS1:GAS6 gene expression ratio of 1:100 is lower than that of 1:10.

[0187] Suitablely, the above reference values ​​may be applicable when measuring GAS6 and GAS6-AS1 gene expression levels using RNA-seq. Suitablely, therefore, the above reference values ​​are measured using RNA-seq. Optionally, one or more further processing steps may be applied to the gene expression data obtained from RNA-seq, such as genome alignment using Bowtie2 and a suitable reference genome, sequence counting using htseq-count, and R-library DESeq2 rlog transformation. Exemplary methods for measuring GAS6 gene expression and GAS6-AS1 gene expression are shown in the embodiments herein.

[0188] Those skilled in the art will understand that reference values ​​for GAS6 gene expression levels, GAS6-AS1 gene expression levels, and the GAS6-AS1:GAS6 gene expression ratio (i.e., the ratio of GAS6-AS1:GAS6 gene expression levels) will depend on the methods or techniques used to measure and obtain gene expression data (i.e., data indicating gene expression, i.e., data indicating gene expression levels). Suitable methods include those described elsewhere herein, including quantitative polymerase chain reaction (qPCR, also known as real-time PCR), high-throughput transcriptome sequencing (also known as RNA sequencing or RNA-seq), in vivo fluorescent nucleotide imaging, DNA / RNA microarray analysis, expressed sequence tag (EST) sequencing, Sanger sequencing of complementary DNA (cDNA), digital PCR (also known as droplet digital PCR), and Northern blotting, and any other methods known in the art. Suitablely, this method includes various ways of normalizing gene counts known in the art, such as normalization with respect to sequencing library size, suitably measured in units of counts per million mapped reads (CPM) or reads per million mapped reads (RPM), or normalization with respect to sequencing library size and with respect to target transcript size, wherein the target transcript corresponds to the gene being measured, suitably measured in units of kilobase reads per transcript per million mapped reads (RPKM), kilobase fragments per transcript per million mapped reads (FPKM), or transcripts per million mapped reads (TPM). Therefore, as described above, the reference level is expressed as a relative gene count, suitably a gene count relative to the size of a high-throughput transcriptome sequencing (also known as RNA sequencing or RNA-seq) library, suitably measured in counts per million mapped reads (CPM) or reads per million mapped reads (RPM), or compared to the expression level of a control gene measured using the same measurement method. Of course, the precise units of measurement and gene expression levels may differ between different measurement methods and data processing. As those skilled in the art will understand, this invention is not limited to any particular method of measuring gene expression, or any particular unit of measurement. When using any such method, the concept of using the expression of the GAS6 gene, the GAS6-AS1 gene, or their expression ratio to determine MSCs with high proliferative capacity is applicable in any situation.

[0189] Cell identification, selection or determination

[0190] Aspects of the present invention relate to identifying, characterizing, or selecting MSCs with high proliferative capacity, or distinguishing MSCs with high proliferative capacity from MSCs with low proliferative capacity.

[0191] Those skilled in the art will understand that cells with self-renewal (i.e., self-replication) capacity divide into cell populations through active growth and subsequent cell division. Appropriately, selecting a single MSC cell based on its characteristics, such as high proliferative capacity, can be interpreted as having the same meaning as selecting a population of MSC cells derived from said parental MSC cells that possess the relevant characteristics, such as high proliferative capacity. Therefore, references to a single MSC herein appropriately include references to a population of MSCs. Appropriately, the methods described herein can be interpreted as identifying, characterizing, or selecting a population of mesenchymal stem cells with high proliferative capacity, or distinguishing a population of mesenchymal stem cells with high proliferative capacity from a population of mesenchymal stem cells with low proliferative capacity.

[0192] Suitably, the step of obtaining data indicating GAS6 and / or GAS6-AS1 expression levels can be performed on one or more representative MSCs from the population. Suitably, the steps taken that result in the identification, characterization, or selection of MSCs can be performed on any cell or cell population within the MSC population, and the subsequently selected cells or cell population can be another cell or cell population within the same population as the cells or cell population that have been measured. Those skilled in the art will understand that the gene expression level determination method taught in this invention, necessary for determining whether MSCs have high or low proliferative capacity, results in the destruction of the individual cell being tested. Suitably, those skilled in the art will understand that once a cell is determined, selected, characterized, or distinguished as having high proliferative capacity by measuring the cell's gene expression level, and thereby the cell is destroyed in the process, this determination, selection, characterization, or distinction can be directed at another MSC from the same population as the MSCs that have been measured and destroyed.

[0193] Pharmaceutical Composition

[0194] The present invention further provides a pharmaceutical composition comprising a population of mesenchymal stem cells of the present invention having high proliferative capacity.

[0195] Pharmaceutical compositions and formulations typically include one or more optional, pharmaceutically acceptable carriers or excipients. A pharmaceutical composition may include at least one additional active pharmaceutical ingredient or therapeutic agent.

[0196] "Pharmaceutical composition" means a formulation in which the biological activity of one or more active ingredients contained therein is effective, and which does not contain any additional components that would have unacceptable toxicity to a subject administering the formulation.

[0197] "Pharmaceutically acceptable carriers" refer to components in a pharmaceutical preparation that are non-toxic to the subjects, excluding the active ingredient. Pharmaceutically acceptable carriers include, but are not limited to, buffers, excipients, stabilizers, or preservatives.

[0198] In some respects, the choice of carrier is partly determined by the specific cells and / or the method of administration. Therefore, there are a variety of suitable formulations. For example, the pharmaceutical composition may contain a preservative. Suitable preservatives may include, for example, methylparaben, propylparaben, sodium benzoate, and benzalkonium chloride. In some respects, a mixture of two or more preservatives is used. The preservative or mixture thereof is typically present in an amount from about 0.0001 to about 2% of the total composition weight. For example, according to Remington's Pharmaceutical Sciences, 16th edition. 2 The carrier is described. Pharmaceutically acceptable carriers are generally non-toxic to recipients at the doses and concentrations used, and include, but are not limited to: buffers such as phosphates, citrates, and other organic acids; antioxidants, including ascorbic acid and methionine; preservatives (such as octadecyl dimethyl benzyl ammonium chloride; hexamethyl ammonium chloride; benzalkonium chloride; benzyl chloride; phenol, butanol, or benzyl alcohol; alkyl parabens such as methylparaben or propylparaben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10). (1 residue) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers, such as polyvinylpyrrolidone; amino acids, such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates, including glucose, mannose, or dextrin; chelating agents, such as EDTA; sugars, such as sucrose, mannitol, trehalose, or sorbitol; salt-forming counterions, such as sodium; metal complexes (e.g., Zn-protein complexes); and / or nonionic surfactants, such as polyethylene glycol (PEG).

[0199] In some aspects, the composition includes a buffer. Suitable buffers include, for example, citric acid, sodium citrate, phosphoric acid, potassium phosphate, and various other acids and salts. In some aspects, a mixture of two or more buffers is used. The buffer or mixture thereof is typically present in an amount of about 0.001 to about 4% by weight of the total composition. Methods for preparing administerable pharmaceutical compositions are known. Exemplary methods are found, for example, in Remington: The Science and Practice of Pharmacology. 3 A more detailed description is available in the text.

[0200] The formulation may include an aqueous solution. The formulation or composition may also contain more than one active ingredient for a specific indication, disease, or condition requiring cell therapy, preferably an active ingredient having activity complementary to that of the cells, wherein the individual activities do not adversely affect each other. These active ingredients are suitably combined in amounts effective for the intended purpose. Therefore, in some embodiments, the pharmaceutical composition also includes other pharmaceutical active agents or drugs, such as chemotherapeutic agents, for example, asparaginase, busulfan, carboplatin, cisplatin, daunorubicin, doxorubicin, fluorouracil, gemcitabine, hydroxyurea, methotrexate, paclitaxel, rituximab, vinblastine, and / or vincristine.

[0201] In some embodiments, the pharmaceutical composition contains an effective amount of cells for treating or preventing the relevant disease or condition, such as a therapeutically effective amount or a preventatively effective amount. In some embodiments, the efficacy of treatment or prevention is monitored through periodic evaluation of the treated subject. The desired dose can be delivered by a single bolus injection of cells, multiple bolus injections of cells, or continuous infusion of cells.

[0202] Cells and compositions can be administered using standard application techniques, formulations, and / or devices. For example, pharmaceutical compositions containing MSCs can be administered by means of local injection (including catheter administration), systemic injection, intravenous injection, or parenteral administration. When administering therapeutic compositions (e.g., pharmaceutical compositions containing the cells of the present invention), they are typically formulated into injectable unit dose forms (solutions, suspensions, emulsions).

[0203] Formulations include those for oral, intravenous, intraperitoneal, subcutaneous, pulmonary, transdermal, intramuscular, intranasal, oral, sublingual, or suppository administration. In some embodiments, the cell population is administered parenterally. The term "parentereal" as used herein includes intravenous, intramuscular, subcutaneous, rectal, vaginal, and intraperitoneal administration. In some embodiments, cells are delivered to the subject using a peripheral system via intravenous, intraperitoneal, or subcutaneous injection.

[0204] In some embodiments, the composition is provided as a sterile liquid formulation, such as an isotonic aqueous solution, suspension, emulsion, dispersion, or viscous composition, which may be buffered to a selected pH in some respects. Liquid formulations are generally easier to prepare than gels, other viscous compositions, and solid compositions. Furthermore, liquid compositions are easier to administer, especially by injection. On the other hand, viscous compositions can be formulated within a suitable viscosity range to provide a longer contact time with a specific tissue. Liquid or viscous compositions may contain a carrier, which may be a solvent or dispersion medium containing, for example, water, saline, phosphate-buffered saline, polyols (e.g., glycerol, propylene glycol, liquid polyethylene glycol), and suitable mixtures thereof.

[0205] Sterile injectable solutions can be prepared by incorporating cells into a solvent, such as by mixing with a suitable carrier, diluent, or excipient such as sterile water, physiological saline, glucose, dextrose, etc. Depending on the route of administration and the desired formulation, the composition may contain excipients such as wetting agents, dispersants or emulsifiers (e.g., methylcellulose), pH buffers, gelling or viscosity-enhancing additives, preservatives, flavoring agents, and / or coloring agents. In some respects, suitable preparations can be prepared with reference to standard texts.

[0206] Various additives can be added to enhance the stability and sterility of the composition, including antimicrobial preservatives, antioxidants, chelating agents, and buffers. Microbial activity can be prevented through various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, and sorbic acid. Absorption of injectable drug forms can be prolonged by using agents that delay absorption, such as aluminum monostearate and gelatin.

[0207] Formulations intended for internal administration are typically sterile. Sterility can be easily achieved, for example, through filtration using a sterile filter membrane.

[0208] combination

[0209] According to another aspect of the invention, the MSCs or groups thereof of the invention may be combined with one or more other therapeutic agents to provide combination therapy.

[0210] Suitably, the combination can be provided as a composition comprising MSCs or a group thereof of the present invention and another therapeutic agent. Suitably, the composition can be a pharmaceutical composition as described above.

[0211] Suitably, the therapeutic agent can be any agent known for the prevention or treatment of disease. Suitably, the therapeutic agent is known for the prevention or treatment of the same disease that MSC aims to prevent or treat. Suitably, therefore, the combination is used as a medicine for the prevention or treatment of disease. Suitable diseases are described below.

[0212] Appropriately, therapeutic agents and MSCs can have synergistic effects in the treatment or prevention of disease. Appropriately, therefore, MSCs can enhance the effects of therapeutic agents, or vice versa.

[0213] Suitably, the therapeutic agent may be, for example, a small chemical molecule or entity, a small molecule drug or prodrug, a protein or peptide such as an enzyme or antibody, an oligonucleotide or nucleic acid such as DNA or RNA (e.g., mRNA, siRNA, miRNA), or a virus. Suitably, the therapeutic agent may be selected from: tumor necrosis factor-associated apoptosis-inducing ligand (TRAIL), chemotherapeutic agents such as gemcitabine (GCB), paclitaxel (PTX), and doxorubicin (DOX), prodrugs such as 5-fluorocytosine (5-FC) and ganciclovir (GCV), immune cell activating cytokines, and oncolytic viruses.

[0214] Suitably, the MSCs of the present invention can be used for the delivery of therapeutic agents. Suitably, the MSCs of the present invention can enhance or promote the therapeutic effect of therapeutic agents. Suitably, therefore, another aspect of the present invention provides the use of the MSCs of the present invention for the delivery of therapeutic agents, which are suitably any of the therapeutic agents described herein. Suitably, therefore, the MSCs of the present invention can be used as vectors to deliver therapeutic agents to target sites, suitably for the treatment or prevention of disease in a subject. Suitably, the target site can be a site of disease, diseased tissue, or the cause of disease. Suitable means of using MSCs as delivery agents are described in Frontiers in Cell and Developmental Biology, Volume 9, July 12, 2021, by Hassanzadeh et al.

[0215] In one embodiment, a composition comprising the MSCs of the present invention or a group thereof and another therapeutic agent for treating or preventing a disease is provided, wherein the MSCs deliver the therapeutic agent to a target site.

[0216] Advantageously, MSCs are particularly well-suited for this purpose due to their inherent homing ability to migrate to sites where treatment may be needed, such as damaged tissue or sites of inflammation. Furthermore, MSCs with high proliferative capacity can be produced more quickly, on a larger scale, and with greater uniformity, making them suitable for the production of therapeutic agents.

[0217] Suitably, in some embodiments, the use of the MSCs of the present invention as a delivery carrier can be achieved by formulating a composition of the MSCs of the present invention and the therapeutic agent as described above, wherein the therapeutic agent can be in free or encapsulated form. Suitably, the therapeutic agent can be encapsulated in, for example, nanochambers, nanoshells, nanoparticles, liposomes, exosomes, etc.

[0218] In some embodiments, the therapeutic agent may be associated with MSCs. Suitably, the therapeutic agent may be present within or attached to MSCs. Suitably, the therapeutic agent may be bound to MSCs, suitably bound to the cell membrane of MSCs. Suitably, the therapeutic agent may be bound to the cell membrane via intracellular or extracellular means. Suitably, the therapeutic agent may be bound to the cell membrane by attachment to a membrane-binding protein, suitably by fusion with a membrane-binding protein. Suitably, therefore, MSCs may contain fusion proteins, wherein the fusion protein contains both the therapeutic agent and cellular proteins, such as membrane-binding proteins.

[0219] Therefore, in one embodiment, MSCs with high proliferative capacity are provided, wherein the expression levels of the GAS6 gene, the GAS6-AS1 gene, and / or the GAS6-AS1:GAS6 gene expression level in the mesenchymal stem cells are lower than reference values, and wherein said MSCs contain a therapeutic agent. In one embodiment, said MSCs are provided for the prevention or treatment of a disease in a subject.

[0220] However, in some embodiments, the therapeutic agent can also be produced by the MSCs of the present invention. Suitably, therefore, the MSCs of the present invention can be modified to enable them to produce therapeutic agents. Suitably, the MSCs can be modified to include one or more nucleic acid sequences encoding a therapeutic agent or a tool for producing a therapeutic agent (such as one or more biosynthetic enzymes).

[0221] Therefore, in one embodiment, highly proliferative MSCs are provided, wherein the expression levels of the GAS6 gene, the GAS6-AS1 gene, and / or the GAS6-AS1:GAS6 gene expression ratio in the mesenchymal stem cells are below reference values, and wherein the MSCs contain one or more nucleic acid sequences encoding a therapeutic agent. In one such embodiment, the MSCs are considered modified MSCs. In one embodiment, a population of the MSCs is provided.

[0222] Suitablely, MSCs can be modified by transforming one or more nucleic acid sequences encoding a therapeutic agent or a tool for producing a therapeutic agent (such as one or more enzymes). Suitablely, the one or more nucleic acids can be contained on an expression construct (optionally contained on a vector) operable to express the said or each nucleic acid in MSCs. Methods well known to those skilled in the art can be used to construct expression vectors containing the coding sequences of a therapeutic agent or a tool for producing a therapeutic agent, as well as appropriate transcription and translation control signals.

[0223] Suitablely, the expression construct or vector can be transformed into MSCs. Suitable means of cell transformation are known in the art. The terms "vector" or "expression vector" are used herein to refer to a medium for introducing a desired gene into a host cell and expressing it therein. As those skilled in the art will appreciate, such vectors can be readily selected from the group consisting of plasmids, bacteriophages, viruses, and retroviruses. Generally, a vector will contain selection markers, appropriate restriction sites to promote the cloning of the desired gene, and the ability to enter and / or replicate within MSCs. For the purposes of this disclosure, many expression vector systems can be used. Of course, any expression vector capable of inducing expression in eukaryotic cells can be used in this invention. Examples of suitable vectors include, but are not limited to, plasmids pcDNA3, pHCMV / Zeo, pCR3.1, pEF1 / His, pIND / GS, pRc / HCMV2, pSV40 / Zeo2, pTRACER-HCMV, pUB6 / V5-His, pVAXl, and pZeoSV2 (available from Invitrogen, San Diego, Calif.) and plasmid pCI (available from Promega, Madison, Wis.).

[0224] Suitablely, once a vector or construct encoding a therapeutic agent or a tool for producing a therapeutic agent has been prepared, the expression vector or construct can be introduced into MSCs. Introduction into MSCs can be achieved using a variety of techniques well known to those skilled in the art. These include, but are not limited to, transfection (including electrophoresis and electroporation), protoplast fusion, calcium phosphate precipitation, cell fusion with envelope DNA, microinjection, and infection with intact viruses. See Ridgway (1988) "Mammalian Expression Vectors" in Vectors, ed. Rodriguez and Denhardt (Butterworths, Boston, Mass.), Chapter 24.2, pp. 470-472. Typically, vectors are introduced into MSCs via electroporation.

[0225] Suitably, the expression construct or vector may include one or more control or regulatory elements operatively linked to the nucleic acid or each nucleic acid. Suitable regulatory elements may include promoters, enhancers, UTRs, introns, etc. Suitably, the expression construct or vector includes at least a promoter suitable for promoting the expression of one or more nucleic acids in MSCs. Suitably, the promoter may be an inducible promoter that can be induced upon contact with an inducer, and suitably, the promoter can be induced after MSCs are administered to a subject, thereby promoting the expression of the nucleic acid or each nucleic acid in the subject.

[0226] Then, MSCs carrying expression vectors or constructs can be suitably grown or cultured under conditions suitable for the production of therapeutic agents, and protein synthesis can be suitably analyzed. Exemplary assay techniques include enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), fluorescence-activated cell classification (FACS), immunohistochemistry, etc. Suitably, this culture and assay step can be performed before the MSCs are used to treat subjects. Suitably, only those MSCs that produce therapeutic agents are then used to treat subjects.

[0227] For long-term, high-yield production of recombinant proteins, stable expression may be preferred. For example, cell lines that stably express therapeutic proteins can be engineered. Instead of using expression vectors containing viral origins of replication, MSCs are transformed with DNA controlled by appropriate expression control elements (e.g., promoters, enhancers, sequences, transcription terminators, polyadenylation sites, etc.) and a selectable marker. After introducing the exogenous DNA, the engineered MSCs can be grown in enrichment media for 1–2 days and then transferred to selective media. The selective marker in the recombinant plasmid confers resistance to selection and allows cells to stably integrate the plasmid into their chromosomes and grow to form colonies (foci), which can then be cloned and amplified into cell lines. This method can be advantageously used to engineer MSC cell lines that stably express therapeutic agents or are tools for producing therapeutic agents.

[0228] Suitably, expression vectors or constructs are transferred to MSCs using conventional techniques, and the transfected MSCs can then be administered to a subject. Suitably, the MSCs can then generate a therapeutic agent in the subject. Therefore, the present invention includes MSCs described herein that also contain polynucleotides encoding a therapeutic agent. Suitably, they can be considered modified MSCs.

[0229] Suitably, the modified MSCs can be used as a drug. Suitably, the modified MSCs can be used to treat or prevent the diseases described herein. Suitably, the modified MSCs can be used to treat or prevent the disease of a subject by producing a therapeutic agent in vivo.

[0230] In one embodiment, a culture medium comprising the MSCs of the present invention is provided. In another embodiment, a fermentation vessel comprising the culture medium is provided.

[0231] Suitably, the MSCs can further secrete therapeutic agents. Therefore, suitably, one or more nucleic acids encoding the therapeutic agent may comprise a nucleic acid sequence encoding one or more targeting peptides. Suitably, the one or more targeting peptides can mediate the transport of the therapeutic agent out of the MSCs. Suitably, the one or more targeting peptides may additionally or optionally mediate the transport of the therapeutic agent into specific cell types, suitable for the treatment or prevention of disease. Suitably, therefore, one or more nucleic acids encoding the therapeutic agent may comprise nucleic acid sequences encoding a targeting peptide that mediates the transport of the therapeutic agent out of the MSCs and a targeting peptide that mediates the transport of the therapeutic agent into specific cell types, suitably target cells, suitable for the treatment or prevention of disease.

[0232] Use of MSCs and their pharmaceutical compositions as medicines

[0233] According to other aspects of the invention, the MSC populations of the invention and / or combinations of the MSCs with other therapeutic agents and / or pharmaceutical compositions thereof can be used as medicines, or can be formulated for use as medicines, and are referred to herein as "the medicines of the invention".

[0234] Suitablely, the medicament of the present invention can be used to prevent or treat a disease in a subject. Suitablely, the medicament of the present invention can prevent or treat any disease through the sustained nutritional repair activity of MSCs and / or through the pluripotent differentiation capacity of MSCs (including, for example, chondrogenesis, osteogenic formation, adipogenesis, and angiogenesis).

[0235] Suitablely, the medicament of the present invention can be used to prevent or treat musculoskeletal diseases, immune system diseases, endocrine system diseases, cardiovascular diseases, skin diseases, nervous system diseases, or respiratory diseases, or any combination thereof, in a subject.

[0236] Suitablely, the medicament of the present invention can be used to prevent or treat bone or soft tissue diseases or injuries, liver diseases or injuries, intestinal diseases or injuries, lung diseases or injuries, skin diseases or injuries, heart diseases or injuries, kidney diseases or injuries, uterine diseases or injuries, or any combination thereof in a subject.

[0237] Suitablely, the medicine of the present invention can be used to prevent or treat autoimmune diseases, fibrotic diseases, inflammatory diseases, and epithelial diseases in subjects.

[0238] Autoimmune diseases suitable for treatment with the drugs of this invention include, but are not limited to, lupus, type 1 diabetes, multiple sclerosis, uveitis, autoimmune thyroid disease, scleroderma, Graves' disease, Crohn's disease, autoimmune lymphoproliferative disorders, inflammatory bowel disease, ulcerative colitis, demyelinating diseases, autoimmune encephalomyelitis, autoimmune gastritis, rheumatoid arthritis, and autoimmune glomerular diseases.

[0239] Suitablely, the medicament of the present invention can be used to prevent or treat one or more of the following in a subject:

[0240] • Diseases or injuries of bone or soft tissue, appropriately selected from: osteoarthritis, meniscus cartilage damage (such as a meniscus tear), ligament injury (such as a ligament tear), trauma, skin injury, bone injury, and cartilage injury.

[0241] • Liver diseases or injuries, appropriately selected from: cirrhosis, decompensated cirrhosis, liver failure caused by hepatitis B or C virus, primary biliary cirrhosis, alcoholic cirrhosis, non-alcoholic fatty liver disease, end-stage liver disease with hepatitis C, liver allogeneic transplant rejection, chronic plus acute liver failure, and autoimmune-induced cirrhosis.

[0242] • Autoimmune diseases, appropriately selected from: rheumatoid arthritis, type 1 diabetes, multiple sclerosis, systemic lupus erythematosus, vasculitis, and inflammatory bowel disease;

[0243] • Fibrotic diseases, appropriately selected from pulmonary fibrosis (such as idiopathic pulmonary fibrosis, radiation-induced fibrosis, allergic pneumonia, liver fibrosis), cardiac fibrosis (such as myocardial infarction, aortic stenosis, coronary heart disease-related cardiomyopathy), renal fibrosis (such as chronic glomerulonephritis, diabetic nephropathy, hypertensive nephropathy, and chronic kidney transplant injury), uterine fibrosis, and skin fibrosis.

[0244] In one embodiment, the medicament of the present invention can be used to prevent or treat bone or soft tissue diseases or injuries of a subject, appropriately osteoarthritis.

[0245] Suitablely, the disease may be acquired or hereditary, and in some cases, the disease may be a hereditary disease.

[0246] Suitablely, the MSCs or populations thereof of the present invention may be genetically manipulated before being used as therapeutic agents, for example to improve their efficiency in targeting inflammatory sites or to increase the potency of their therapeutic effect on a particular indication.

[0247] Medications can take any shape or form that enables them to achieve their therapeutic purposes as medicines. It should be understood that the scope of this invention is not limited to the treatment of the specific diseases described herein.

[0248] Appropriately, the subject as defined herein may also be referred to as a "patient". Appropriately, the subject may be a mammalian subject, including humans; livestock; farm animals; such as dogs, cats, guinea pigs, rabbits, rats, mice, horses, cattle, dairy cows, etc. Appropriately, the subject is a human. Appropriately, the subject may be receiving medical care or requesting medical care. Appropriately, the subject is male or female. Appropriately, the subject is an adult or a child.

[0249] Appropriately, the subject may be a person who is believed to have any of the aforementioned diseases, or a person who has been diagnosed with any of the aforementioned diseases. For example, an appropriate subject may have symptoms consistent with such a disease.

[0250] Alternatively, suitable subjects may be those considered to be at risk of developing the disease. For example, suitable subjects may have been exposed to individuals with the disease, may have the relevant disease, or may meet risk factors associated with the condition, such as smoking, old age, allergies, etc.

[0251] Methods for preparing MSC populations

[0252] Those skilled in the art will recognize the techniques used in culturing MSCs, and MSC culture techniques are also described in the embodiments. Typically, MSC culture, like any other cell, requires exposing the cells to appropriate conditions that the cells can tolerate and that allow them to maintain normal cell physiology, including exposing the cells to the appropriate nutrients necessary for their survival and growth through their normal metabolic processes. Nutrient exposure can be achieved by culturing cells in liquid or solid nutrient media under appropriate temperature, humidity, atmospheric gas concentrations and pressures, and other parameters.

[0253] Suitable nutrients for culturing MSC populations may include: Dulbecco's modified Eagles medium supplemented with 10% (v / v) fetal bovine serum, 1% (v / v) Glutamax (Sigma) and optionally 1% (v / v) penicillin / streptomycin, optionally supplemented with 10 ng / ml FGF-2 (Peprotech) to help maintain cells in an undifferentiated state.

[0254] Suitable conditions for culturing MSC populations, including temperature, humidity, atmospheric gas concentration and pressure, and other parameters, may include: 37°C, a humid atmosphere, 5% atmospheric CO2, and 95% atmospheric air.

[0255] The first and eleventh aspects of the present invention provide a method comprising selecting a cell population of MSCs in which the expression levels of the GAS6 gene, the GAS6-AS1 gene, and / or the ratio of the GAS6-AS1:GAS6 gene expression levels are lower than reference values.

[0256] Technicians will understand the term "selection" as used in the context of cell populations. Selection can be achieved through positive selection of desired cells (i.e., cells with high proliferative capacity) or negative selection, which is the elimination of unwanted cells (i.e., cells with low proliferative capacity).

[0257] Suitable selection may include separating desired cells from unwanted cells. Suitable selection may include separating MSCs in which the expression levels of the GAS6 gene, GAS6-AS1 gene, and / or the ratio of GAS6-AS1:GAS6 gene expression levels are lower than reference values, i.e., MSCs with high proliferative capacity. Suitable separation from the remaining cells in the population, and suitable separation from MSCs in which the expression levels of the GAS6 gene, GAS6-AS1 gene, and / or the ratio of GAS6-AS1:GAS6 gene expression levels are higher than reference values, i.e., MSCs with low proliferative capacity.

[0258] Suitably, the method may include the step of amplifying selected cells. Suitably, amplifying selected cells may include culturing the selected cells under suitable conditions to induce growth or proliferation. Suitably, cell amplification may be performed until the cell population increases to a desired size, such as 5, 10, 15, 20, 25, 30, 35 generations or more.

[0259] The eleventh aspect of the invention may include a final step of formulating highly proliferating MSCs into a medicament suitable for use in the treatments described elsewhere herein. Suitably, formulating MSCs includes forming a pharmaceutical composition comprising MSCs. Suitable formulations of such cell-containing pharmaceutical compositions are as described above. Attached Figure Description

[0260] Figure 1 Relative GAS6 gene expression (i.e., relative gene count in CPM) at one passage in two of the fastest-growing (high proliferative capacity) and two slower-growing (low proliferative capacity) human bone marrow-derived MSCs obtained from four patient samples. Results are shown as mean and standard deviation.

[0261] Figure 2 Relative GAS6-AS1 gene expression (i.e., relative gene count in CPM) of two fastest-growing (high proliferative capacity) and two slower-growing (low proliferative capacity) human bone marrow-derived MSCs obtained from four patient samples at one passage. Results are shown as mean and standard deviation.

[0262] Figure 3The gene expression ratio of GAS-AS1 to GAS6 in one passage of two types of human bone marrow-derived MSCs (two of the fastest-growing (high proliferative capacity) and two of the slowest-growing (low proliferative capacity) MSCs obtained from four patient samples. (i.e., the ratio of the relative gene counts of GAS-AS1 to GAS6 in CPM). Results are shown as mean and standard deviation.

[0263] Figure 4 Relative GAS6 gene expression (i.e., relative gene count in CPM) at different time points measured by passage numbers (P1, P5, P10, and P15) from two types of human bone marrow-derived MSCs obtained from four patient samples, representing two of the fastest-growing (high proliferative capacity) and two of the slowest-growing (low proliferative capacity) MSCs. Dashed lines indicate the reference value of 45. Results are shown as mean and standard deviation.

[0264] Figure 5 Relative GAS6-AS1 gene expression (i.e., relative gene count in CPM) at different time points, measured by passage numbers (P1, P5, P10, and P15), from two of the fastest-growing (high proliferative capacity) and two slower-growing (low proliferative capacity) human bone marrow-derived MSCs obtained from four patient samples. Dashed lines indicate a reference value of 20,000. Results are shown as mean and standard deviation.

[0265] Figure 6 Gene expression ratio of GAS-AS1 to GAS6 at different time points, measured by passage numbers (P1, P5, P10, and P15), from two types of human bone marrow-derived MSCs (two of the fastest-growing (high proliferative capacity) and two of the slowest-growing (low proliferative capacity) MSCs obtained from four patient samples. (i.e., the ratio of the relative gene counts of GAS-AS1 to GAS6 in CPM). Dashed lines indicate the reference value: 600. Results are shown as mean and standard deviation.

[0266] Figure 7 Growth and phenotypic characteristics of mesenchymal stem cells (MSCs) from four patients (PN241, PN242, PN251, and PN264). A) The percentage of cells expressing MSC markers CD90 and CD105, and hematopoietic stem cell markers CD34 and CD45, was determined by fluorescence-activated cell sorting. B) Population doubling time (PD) reached after each passage using MSCs from each patient was recorded until growth ceased (for donor PN242, data were collected up to passage 30, at which point cell growth continued). C) Population doubling time (PDT) up to passage 16 is shown for all four patients.

[0267] Example

[0268] Some embodiments of this disclosure will now be described through the following examples. However, this disclosure may be implemented in many different forms and should not be construed as limited to the embodiments set forth herein; rather, these embodiments are provided to make this disclosure exhaustive and complete, and to fully convey the scope of this disclosure to those skilled in the art.

[0269] Isolation and expansion of human bone marrow-derived MSCs for in vitro research

[0270] The model used as the basis for all experiments reported in this paper was the long-term culture of human bone marrow-derived MSCs. Bone marrow emboli were collected from the femoral heads of patients undergoing total hip replacement. Informed consent was given to all patients, and this study was conducted in accordance with local ethical guidelines (North Bristol NHS Trust Research Ethics Committee). Patient details are shown in Table 1. Cells were suspended in stem cell expansion medium consisting of Dulbecco's modified Eagles medium (Sigma) supplemented with 10% (v / v) fetal bovine serum (FBS, Thermo Scientific Hyclone, Loughborough, UK), 1% (v / v) Glutamax (Sigma), and 1% (v / v) penicillin / streptomycin (Sigma). This serum batch was selected to promote the growth and differentiation of MSCs (Kafienah et al., 2007a). The medium was also supplemented with 10 ng / ml FGF-2 (Peprotech). This growth factor has previously been shown to enhance the in vitro proliferation rate of MSCs. 4, 5 During proliferation, MSCs remain undifferentiated cells. 6, 7 Furthermore, FGF-2-amplified MSCs can enhance chondrogenic differentiation when subsequently exposed to differentiation conditions. 4, 5 The cell suspension was separated from any bone in the sample by repeated washing with culture medium. The cells were centrifuged at 500 g for 5 minutes, and the supernatant / fat was removed. The resulting cell pellet was resuspended in culture medium and centrifuged at 1.5–2.0 x 10⁻⁶. 5 Nucleated cells / cm 2 The cells were seeded at a specific density in plates. These flasks were cultured at 37°C in a humid atmosphere of 5% CO2 and 95% air. A 4-day window was allowed before the first culture medium change, followed by changing the medium every other day until the adherent cells reached 90% confluence and were ready for passage.

[0271] Table 1. Patient (i.e., donor) and MSC culture details. Bone marrow was obtained from four donors who underwent surgery following trauma. Growth arrest was recorded at the last passage where an increase in cell number was observed. Cells from donor PN242 continued to proliferate at P30, after which the experiment was terminated.

[0272]

[0273] Detection of cell surface phenotypic markers

[0274] To confirm the MSC phenotype of the cultured cells, high surface expression of CD90 and CD105 MSCs and low expression of CD34 and CD45 were established. MSCs (100,000 cells from each patient, passaged 1, 5, 10, and 15 times, respectively) were suspended in Zombie (Biolegend), a live / dead cell dye, diluted 1:500, and incubated in the dark for 20 minutes. Non-specific antigens were then blocked by incubating the cells for 1 hour at room temperature in 1% (w / v) BSA (Sigma-Aldrich), 5% (v / v) FCS (Sigma-Aldrich), and 10% (v / v) human serum (Sigma-Aldrich). Cells were washed by centrifugation in three volumes of PBS, and the cell pellet was resuspended in 100 µl of a primary antibody solution containing 20–100 µg / ml of antibody as in the blocking solution. All primary antibodies were fluorescently labeled mouse anti-human IgG: anti-CD105-fluorescein isothiocyanate (FITC), anti-CD90-phycoerythrin (PE), and anti-CD45-PE were from R&D Systems; anti-CD34-FITC was from BD Bioscience; and IgG1-FITC and IgG1-PE isotype controls were from R&D Systems. After incubation at 4°C for 40 minutes, cells were washed and resuspended in 1 ml PBS to remove non-viable cells before analysis on a Canto flow cytometer (BD FACSCanto II). Data were analyzed using FlowJo (Treestar). Positive expression was defined as a fluorescence level greater than 95% of the corresponding isotype-matched control antibody. Results can be viewed... Figure 7 The results showed that the characteristics of the cultured cells were consistent with those of MSCs.

[0275] Calculation of cell passage, population doubling, and doubling time.

[0276] At the end of each passage, MSCs were harvested using 0.25% trypsin-EDTA (Invitrogen), pooled, counted, and then aliquoted into separate centrifuge tubes for reseeding and further growth, and stored in liquid nitrogen for subsequent genomic analysis. Cells from each patient were continuously passaged without freezing until growth arrest, defined as no detectable increase in cell number between passages (see Table 1 and...). Figure 7 B). At each passage, the total number of MSCs harvested was determined. The first batch of cells harvested after inoculation with fresh bone marrow was considered passage 0. The number of cells re-inoculated at the start of passage 1 was used as the baseline for calculating the first population doubling at the end of passage 1. Downstream analyses of MSCs were performed starting from passage 1.

[0277] The population doubling number (PD), which is the length of the growth period, is calculated using the following formula:

[0278] PD = [log(number of harvested MSCs) - log(number of inoculated MSCs)] / log(2)]

[0279] Calculate the PD for each generation and add it to the PD of the previous generation to generate the cumulative PD data for each generation.

[0280] The population doubling time (PDT), i.e., the growth rate, for each generation is calculated using the following formula:

[0281] PDT = tx log(2) / log(harvested cells / inoculated cells)

[0282] (t = time between cell seeding and cell harvesting)

[0283] The changes in cumulative PD and PDT for each patient with passage number are as follows: Figure 7 As shown.

[0284] Acquisition of genomic data

[0285] Transcriptomics

[0286] Transcriptomic studies were performed on mRNA extracted from all four patients at P1, P5, P10, and P15 by the Genome Research Center. 1x10 mRNA samples were isolated at the end of each passage when MSCs were harvested. 6Cells were collected and resuspended in RNAprotect cytoreceptor (Qiagen). Cells were stored at -80°C until a complete sample set was collected from all donors and time points. RNA was then extracted from selected time points using the RNeasy Plus Mini kit (Qiagen) according to the manufacturer's instructions. The concentration of RNA in the extracts was determined using a NanoDrop 2000 spectrophotometer (Thermo). The extracted RNA was stored at -80°C prior to analysis.

[0287] Using Ribo-Zero TM Ribosomal RNA was removed using the H / M / R kit (Illumina), and then RNASeq libraries were prepared using the NEBNext hyperdirectional RNA library preparation kit (Illumina). Paired-end sequencing of the RNASeq libraries was performed using the Illumina HiSeq4000 platform via V4 Chemistry.

[0288] Quantitative and statistical analysis

[0289] Data processing, integration, and analysis were performed by the Centre for Computational Biology, University of Liverpool. RNASeq data were obtained as described above. The original Fastq files were pruned using Cutadapt version 1.2.1 with option –O 3 to remove Illumina adapter sequences. Reads were further pruned using Sickle version 1.200 with a minimum window quality score of 20. Reads shorter than 10 base pairs after pruning were removed. Sequence quality metrics were assessed using FastQC version 0.11.4. No samples were removed. The sequence data were aligned with the NCBI human genome version GRCh38 using Bowtie2 version 1.1.2 and recommended parameters. 8 Gene-level count data were generated from Bowtie2 alignments using htseq-count version 0.9.0. The rlog-transformed count data was generated using the R language DESeq2. This data was filtered to remove genes with a mean count less than 1. Statistical analysis was performed in R version 3.4.4, and the data was plotted using the R package ggplot2.

[0290] Selection of genomic biomarkers related to cell growth

[0291] The datasets were analyzed to identify any genes with significantly different expression levels after one passage when comparing MSCs from patients PN241 and PN242 (high-proliferative samples) with those from patients PN251 and PN264 (low-proliferative samples). Once genes were identified as differentially expressed, the next step was to demonstrate that the differences remained consistent at P5, P10, and P15. This analysis led to the selection of GAS6 and GAS6-A1 as biomarkers for high proliferative capacity in MSCs, such as... Figure 1-6 As shown.

[0292] References

[0293] [1] Salerno A, Brady K, Rikkers M, Li C, Caamano-Gutierrez E, Falciani F, Blom AW, Whitehouse MR, Hollander AP: MMP13 and TIMP1 are functional markers for two different potential modes of action by mesenchymalstem / stromal cells when treating osteoarthritis. Stem Cells 2020, 38:1438-53.

[0294] [2] Remington JP, Osol A: Remington's Pharmaceutical sciences. 16thed. Easton PA: Mach Publishing Co, 1980.

[0295] [3] Remington JP, Pharmaceutical P, Remington JP, Beringer P, University of the Sciences in P: Remington: the science and practice of pharmacy. 21st ed. Philadelphia: Lippincott Williams & Wilkins, 2005.

[0296] [4] Bianchi G, Banfi A, Mastrogiacomo M, Notaro R, Luzzatto L,Cancedda R, Quarto R: Ex vivo enrichment of mesenchymal cell progenitors byfibroblast growth factor 2. Exp Cell Res 2003, 287:98-105.

[0297] [5] Solchaga LA, Penick K, Porter JD, Goldberg VM, Caplan AI, WelterJF: FGF-2 enhances the mitotic and chondrogenic potentials of human adultbone marrow-derived mesenchymal stem cells. J Cell Physiol 2005, 203:398-409.

[0298] [6] Kafienah W, Mistry S, Williams C, Hollander AP: Nucleostemin is amarker of proliferating stromal stem cells in adult human bone marrow. StemCells 2006, 24:1113-20.

[0299] [7] Martin I, Vunjak-Novakovic G, Yang J, Langer R, Freed LE:Mammalian chondrocytes expanded in the presence of fibroblast growth factor 2maintain the ability to differentiate and regenerate three- dimensionalcartilaginous tissue. Exp Cell Res 1999, 253:681-8.

[0300] [8] Langdon WB: Performance of genetic programming optimized Bowtie2on genome comparison and analytic testing (GCAT) benchmarks. BioData Min2015, 8:1.

[0301] sequence

[0302] SEQ ID NO:1 - Complete GAS6 gene

[0303]

[0304] GAS6 gene of SEQ ID NO:2-CDS

[0305]

[0306] SEQ ID NO:3 - GAS6 protein

[0307] MAPSLSPGPAALRRAPQLLLLLLAAECALAALLPAREATQFLRPRQRRAFQVFEEAKQGHLERECVEELCSREEAREVFENDPETDYFYPRYLDCINKYGSPYTKNSGFATCVQNLPDQCTPNPCDRKGTQACQDLMGNFFCLCKAGWGGRLCDKDVNECSQENGGCLQICHNKPGSFHCSCHSGFELSSDGRTCQDIDECADSEACGEARCKNLPGSYSCLCDEGFAYSSQEKACRDVDECLQGRCEQVCVNSPGSYTCHCDGRGGLKLSQDMDTCEDILPCVPFSVAKSVKSLYLGRMFSGTPVIRLRFKRLQPTRLVAEFDFRTFDPEGILLFAGGHQDSTWIVLALRAGRLELQLRYNGVGRVTSSGPVINHGMWQTISVEELARNLVIKVNRDAVMKIAVAGDLFQPERGLYHLNLTVGGIPFHEKDLVQPINPRLDGCMRSWNWLNGEDTTIQETVKVNTRMQCFSVTERGSFYPGSGFAFYSLDYMRTPLDVGTESTWEVEVVAHIRPAADTGVLFALWAPDLRAVPLSVALVDYHSTKKLKKQLVVLAVEHTALALMEIKVCDGQEHVVTVSLRDGEATLEVDGTRGQSEVSAAQLQERLAVLERHLRSPVLTFAGGLPDVPVTSAPVTAFYRGCMTLEVNRRLLDLDEAAYKHSDITAHSCPPVEPAAA

[0308] SEQ ID NO:4 - GAS6 - AS1 gene

[0309] TCATTTTCTCTTGCTCCTGCCGTGTAAGAAGTGCCTTTTGCCTCCCACCGTGATTCTGAGGCCTCCCCAACCATGTGCAATTGCACAGGCCCAGGCTGAAGAGGAAAGACAAGAGCCGCCCTGCCCAGAAACGTCCACATGTGGGTACTGCATTCCTACCGGTGTGACAGAGGGAAGCGGCGGTGAGCCGGGGAGGCCTCTACGCTGTCCCGCCGTGGGATCACACCGCGATTGCTCAAACCACACGCAAGGTCCTGCCATCAGAGGAGAGCTCGAAGCCGCTGTGGCAGGAACAGTGGAAGCTACCCGGCTTGTTGTGGCAGATCTGGAGGCAGCCCCCGTTCTCCTGGCTGCATTCGTTGACATCTGGGAACAAGCACAGGCCTGAAGGGGAGCCCAAGGGTGCACAGCCCCTGGCTACGCACACAGGGGCTGGGGCTGGCCTTCGGAGTTACGAGGAAACGAGGACCAGGACCAGGGATTCTGCATCAGCACAGCCGCCAGGAGCCGGCCGGGGCCCCATCCCTGACACTGCTGTCGCCCGGCTGTACCTGGGTGCTGTGTCCGCGGGGCGTCTGGAGACGTCGATGTGGTCATAGCAGGGCCTGGAACGGGGAGGTCTGGCCTGAACTAGAGAAATGAGGGGCGTATCCGCTTCTCCACCCTGGCCTCAGATGAAGAGGCTCTGGGGGCAGGAGGGAGTCAGACACGTGCAGGGCAGGCGGCCTGTGCAGGGCCCAACCCTCCGGCACCAGAACCTGACCTCCTCAGAGGCCCCCACCATGGAGGGATGTCTGGGGGATGCTGTGCGCTGCCGCTACGATGTTTGGTTAGAGATTAAAGCCATTTCAGAAGTGGACACCTGCCCATGTGATGCAAAGGGCTGGGAACCCGGAAAAAAA。

Claims

1. A method of determining, identifying or selecting mesenchymal stem cells (MSCs) having a high proliferative capacity, the method comprising: (a) obtaining data indicative of the expression level of one or both of the following genes in mesenchymal stem cells: GAS6 and GAS6-AS1 ; (b) optionally calculating the ratio of the gene expression levels of GAS6-AS1 :GAS6; (c) comparing the expression level of one or both genes of step (a) and / or optionally the ratio of step (b) to a reference value; (d) determining, identifying or selecting mesenchymal stem cells having a high proliferative capacity if the expression level of the GAS6 gene, the GAS6-AS1 gene and / or the ratio of the gene expression levels of GAS6-AS1 :GAS6 is lower than the reference value.

2. A method of distinguishing mesenchymal stem cells having a high proliferative capacity from mesenchymal stem cells having a low proliferative capacity, the method comprising: (a) obtaining data indicative of the expression level of one or both of the following genes in mesenchymal stem cells: GAS6 and GAS6-AS1 ; (b) optionally calculating the ratio of the gene expression levels of GAS6-AS1 :GAS6; (c) comparing the expression level of one or both genes of step (a) and / or optionally the ratio of step (b) to a reference value; (d) distinguishing the mesenchymal stem cells as (i) having a high proliferative capacity if the expression level of the GAS6 gene, the GAS6-AS1 gene and / or the ratio of the gene expression levels of GAS6-AS1 :GAS6 is lower than the reference value; or (ii) having a low proliferative capacity if the expression level of the GAS6 gene, the GAS6-AS1 gene and / or the ratio of the gene expression levels of GAS6-AS1 :GAS6 is higher than the reference value.

3. Use of the expression level of one or both of the following genes GAS6 and GAS6-AS1, and / or the ratio of the gene expression levels of GAS6-AS1 :GAS6 as an indicator of the proliferative capacity of mesenchymal stem cells.

4. An isolated mesenchymal stem cell, wherein the mesenchymal stem cell has a high proliferative capacity, wherein the expression level of the GAS6 gene, the GAS6-AS1 gene and / or the ratio of the gene expression levels of GAS6-AS1 :GAS6 in the mesenchymal stem cell is lower than a reference value.

5. The method according to claim 1 or 2, the use according to claim 3, or the isolated mesenchymal stem cell according to claim 4, wherein the mesenchymal stem cell expresses one or more of the following markers: CD90 and CD105, preferably wherein the mesenchymal stem cell is CD90+and CD105+.

6. The method according to claim 1, 2 or 5, the use according to claim 3 or 5, or the isolated mesenchymal stem cell according to claim 4 or 5, wherein the mesenchymal stem cell lacks expression of one or more of the following markers: CD34 and CD45, preferably wherein the mesenchymal stem cell is CD34 and CD45.

7. The method according to claim 1, 2, 5 or 6, the use according to claim 3, 5 or 6, or the isolated mesenchymal stem cell according to claim 4, 5 or 6, wherein the mesenchymal stem cell is derived from a tissue selected from the group consisting of adipose tissue, bone marrow, umbilical cord tissue, blood, liver, dental pulp and skin.

8. The method according to claim 1, 2 or 5-7, the use according to claim 3 or 5-7, or the isolated mesenchymal stem cell according to claim 4 or 5-7, wherein the mesenchymal stem cell with high proliferative capacity proliferates at a faster rate or is capable of proliferating for a longer duration before senescence when compared to the average rate of proliferation and / or average duration of proliferation in a population of typical or reference MSCs.

9. The method according to claim 1, 2 or 5-8, the use according to claim 3 or 5-8, or the isolated mesenchymal stem cell according to claim 4 or 5-8, wherein the mesenchymal stem cell with high proliferative capacity has a low cell doubling time, preferably wherein the mesenchymal stem cell with high proliferative capacity has a cell doubling time of less than 20 days, preferably less than 10 days, preferably less than 5 days.

10. The method according to claim 9, the use according to claim 9, or the isolated mesenchymal stem cell according to claim 9, wherein the mesenchymal stem cell with high proliferative capacity maintains a cell doubling time of less than 20 days, preferably less than 10 days, preferably less than 5 days, over at least passages P1 to P10, preferably from passages P1 to P15.

11. The method according to claim 1, 2 or 5-10, the use according to claim 3 or 5-10, or the isolated mesenchymal stem cell according to claim 4 or 5-10, wherein the mesenchymal stem cell with high proliferative capacity has a long growth phase, preferably wherein the mesenchymal stem cell with high proliferative capacity has a growth phase of greater than eighteen passages (P18), P19, P21, P22, P23, P24, P25, P26, P27, P28, P29, P30 and / or more passages, preferably greater than twenty passages (P20), preferably greater than twenty-two passages (P22), preferably greater than twenty-four passages (P24).

12. The method according to claim 1, 2 or 5-11, the use according to claim 3 or 5-11, or the isolated mesenchymal stem cell according to claim 4 or 5-11, wherein the reference value is the median level of expression of the GAS6 gene, the GAS6-AS1 gene, and / or the median ratio of GAS6-AS1:GAS6 gene expression in a reference population of MSCs.

13. The method of claim 1, 2, or 5-12, the use of claim 3 or 5-12, or the isolated mesenchymal stem cell of claim 4 or 5-12, wherein, the reference value for GAS6 gene expression is 42, 43 or 44 relative counts per million (CPM) at passage 15 (P15).

14. The method according to claim 1, 2 or 5-13, the use according to claim 3 or 5-13, or the isolated mesenchymal stem cell according to claim 4 or 5-13, wherein the reference value for GAS6-AS1 gene expression is 10,000, 15,000, 20,000, 25,000, 30,000, 35,000 or 40,000 relative counts per million (CPM) at any passage number, preferably wherein the reference value for GAS6-AS1 gene expression is 20,000, 25,000 or 30,000 relative counts per million (CPM) at passage 15 (P15).

15. The method according to claim 1, 2 or 5-14, the use according to claim 3 or 5-14, or the isolated mesenchymal stem cell according to claim 4 or 5-14, wherein the reference value for the gene expression ratio of GAS6-AS1 :GAS6 is 1:300, 1:350, 1:400, 1:450, 500, 1:550 or 1:600 at any passage number, preferably wherein the reference value for the gene expression ratio of GAS6-AS1 :GAS6 is 1:550, 1:600 or 1:650 at passage 15 (P15).

16. The method according to claims 13-15, the use according to claims 13-15, or the isolated mesenchymal stem cell according to any one of claims 13-15, wherein the data indicative of the expression level of one or both of the following genes is determined with RNA-seq: GAS6 and GAS6-AS.

17. A population of isolated mesenchymal stem cells according to any one of claims 4-16.

18. A combination of an isolated mesenchymal stem cell according to any one of claims 4-16 or a population of mesenchymal stem cells according to claim 17 and a therapeutic agent.

19. The combination according to claim 18, wherein the therapeutic agent is selected from the group consisting of small molecule drugs or prodrugs, proteins or peptides - such as enzymes or antibodies, oligonucleotides or nucleic acids - such as DNA or RNA (e.g. mRNA, siRNA, miRNA) and viruses.

20. The combination according to claim 18 or 19, wherein the therapeutic agent is free, encapsulated or attached to the mesenchymal stem cell.

21. The combination of claim 18 or 19, wherein the therapeutic agent is produced by the mesenchymal stem cells, preferably wherein the mesenchymal stem cells comprise one or more nucleic acids encoding the therapeutic agent or a biosynthetic enzyme capable of synthesizing the therapeutic agent.

22. A pharmaceutical composition comprising the population of mesenchymal stem cells of claim 17, or the combination of any one of claims 18-21.

23. The population of mesenchymal cells of claim 17 and / or the combination of any one of claims 18-21 and / or the pharmaceutical composition of claim 22 for use as a medicament.

24. The population of mesenchymal cells of claim 17 and / or the combination of any one of claims 18-21 and / or the pharmaceutical composition of claim 22 for use in the treatment of a bone or soft tissue disease or injury, a liver disease or injury, an intestinal disease or injury, a lung disease or injury, a skin disease or injury, a heart disease or injury, a kidney disease or injury, a uterus disease or injury, or any combination thereof.