Induction medium for inducing transdifferentiation of fibroblasts into nucleus pulposus cells and application of induction medium

Abstract

The invention discloses an induction culture medium for inducing fibroblasts to transdifferentiate into nucleus pulposus cells and application of the induction culture medium, and belongs to the technical field of cytobiology and regenerative medicine. The induction culture medium comprises a basic culture medium and an induction composition, can be used for realizing 2D / 3D transdifferentiation of fibroblasts into nucleus pulposus cells, and meets the requirements of different application scenes. Meanwhile, the invention further provides an amplification culture medium, a technical system for forming a 3D (three-dimensional) organoid through amplification of the amplification culture medium is provided, and the method has important significance in promoting cell therapy of the intervertebral disc degenerative change.

Description

Technical Field

[0001] This invention belongs to the field of cell biology and regenerative medicine technology, specifically relating to an induction culture medium for inducing fibroblasts to transdifferentiate into nucleus pulposus cells and its application. Background Technology

[0002] Intervertebral disc degeneration is the main cause of lower back pain, with core pathological features including decreased nucleus pulposus cell function and reduced extracellular matrix (ECM) synthesis. Current clinical treatments primarily involve surgical decompression or fusion, which cannot achieve functional repair of the nucleus pulposus tissue. Cell therapy has emerged as the most promising alternative.

[0003] Ideal seed cells for nucleus pulposus repair should meet requirements such as convenient sourcing, low ethical risks, strong proliferative capacity, and possession of nucleus pulposus cell functions. Human skin fibroblasts (HDF) have become a popular seed cell source for cell therapy due to their advantages such as minimal invasiveness, autologous acquisition, and vigorous in vitro proliferation capacity. However, the directed transdifferentiation of HDF into nucleus pulposus cells still faces many challenges: existing transdifferentiation technologies mostly rely on viral vector-mediated transcription factor overexpression (such as MYC, SOX9, etc.), which carries the risk of gene integration and limits clinical translation; moreover, most adopt a single 3D culture mode, lacking the technical design of 2D / 3D synergistic induction, making it difficult to adapt to the needs of different application scenarios.

[0004] In vitro expansion of nucleus pulposus cells and organoid construction are crucial for large-scale application. Existing nucleus pulposus culture media are mostly designed for primary or progenitor cells, such as progenitor cell culture media containing p38 inhibitors and TGF-β inhibitors. These require the addition of multiple high-titer inhibitors and are only applicable to specific cell types. Furthermore, current technologies cannot achieve unified expansion of 2D and 3D derived nucleus pulposus cells, making it even more difficult to form structurally stable 3D organoids. In addition, reported HDF transdifferentiation studies have only reached the nucleus pulposus cell induction stage, without addressing subsequent expansion and organoid construction, failing to meet the cell quantity and functional requirements for clinical transplantation.

[0005] Therefore, developing a technology system that can achieve dual-pathway transdifferentiation of HDF into nucleus pulposus cells without the need for exogenous gene intervention and can be expanded into 3D organoids through universal culture medium is of great significance for promoting cell therapy for intervertebral disc degenerative diseases. Summary of the Invention

[0006] 1. Purpose of the invention This invention addresses one of the problems of existing transdifferentiation technologies, which mostly rely on viral vector-mediated transcription factor overexpression, resulting in the risk of gene integration and limited clinical translation. It provides an induction culture medium for inducing fibroblast transdifferentiation into nucleus pulposus cells and its application, which can be used to achieve 2D / 3D transdifferentiation of fibroblasts into nucleus pulposus cells and meet the needs of different application scenarios.

[0007] On the other hand, this invention addresses the problem that existing nucleus pulposus culture media are mostly designed for primary nucleus pulposus cells or progenitor cells, such as nucleus pulposus progenitor cell culture media containing p38 inhibitors and TGF-β inhibitors, which require the addition of multiple high-titer inhibitors and are only applicable to specific cell types. At the same time, existing technologies cannot achieve unified expansion of 2D and 3D-derived nucleus pulposus cells, and it is even more difficult to form structurally stable 3D organoids. The invention develops a technical system that does not require exogenous gene intervention, can achieve dual-pathway transdifferentiation of HDF into nucleus pulposus cells, and can be expanded into 3D organoids through expansion culture media. This is of great significance for promoting cell therapy for intervertebral disc degenerative diseases.

[0008] 2. Technical Solution To achieve the above-mentioned objectives, the technical solution adopted by this invention is as follows: In a first aspect, the present invention provides an induction medium for inducing fibroblasts to transdifferentiate into nucleus pulposus cells. The induction medium includes a basal medium and an induction composition, wherein the induction composition includes: FGF2, IGF-1, vitamin C, proline, ROCK inhibitor, TGF-β3 and fetal bovine serum.

[0009] Furthermore, the pH of the above-mentioned induction medium is 7.2-7.4.

[0010] Furthermore, the aforementioned ROCK inhibitor is Y27632.

[0011] Furthermore, the above-mentioned basal culture medium is DMEM / F12 (volume ratio 1:1).

[0012] Furthermore, the concentrations of each component in the above-mentioned inducing composition are as follows: FGF2: 10-50 ng / mL IGF-1: 20-80 ng / mL Vitamin C: 50-200 μg / mL Proline: 1-5 mM ROCK inhibitor: 5-20 μM TGF-β3: 10-20 ng / mL Fetal bovine serum: 1-10% (v / v).

[0013] Furthermore, the concentrations of each component in the above-mentioned inducing composition are as follows: FGF2: 30 ng / mL IGF-1: 50 ng / mL Vitamin C: 100 μg / mL Proline: 3 mM ROCK inhibitor: 12 μM TGF-β3: 10 ng / mL Fetal bovine serum: 5% (v / v).

[0014] Secondly, the present invention provides a method for inducing fibroblasts to transdifferentiate into nucleus pulposus cells, the method comprising: culturing fibroblasts using the above-mentioned induction culture medium.

[0015] Furthermore, the aforementioned fibroblasts include any one or more of the following: tissue-isolated fibroblasts, stem cell-differentiated fibroblasts, and fibroblasts transdifferentiated from other cells.

[0016] Furthermore, the fibroblasts isolated from the aforementioned tissues include fibroblasts isolated from skin tissue.

[0017] Furthermore, the aforementioned stem cell-differentiated fibroblasts include fibroblasts induced to differentiate into pluripotent stem cells.

[0018] Further, the above method includes: seeding fibroblasts into culture dishes coated with Matrigel, adding the above-mentioned induction medium, and culturing at 37°C and 5% CO2 for 7-10 days to obtain 2D nucleus pulposus cells.

[0019] Furthermore, the above method includes: preparing fibroblasts into 1×10 6 Cell suspensions of cells / mL were placed in 15mL centrifuge tubes, and the above-mentioned induction culture medium was added. The cells were cultured at 37℃ and 5% CO2 for 10-14 days to form 3D nucleus pulposus cells.

[0020] Thirdly, the present invention provides an amplification culture medium for transdifferentiated nucleus pulposus cells, the amplification culture medium comprising a basal culture medium and an amplification composition, wherein the amplification composition comprises: FGF2, IGF-1, vitamin C and platelet lysis buffer.

[0021] Furthermore, the above-mentioned basal culture medium is DMEM / F12 (volume ratio 1:1).

[0022] Furthermore, the concentrations of each component in the above amplification composition are as follows: FGF2, 20-60 ng / mL, IGF-1, 10-40 ng / mL Vitamin C, 100-300 μg / mL Platelet lysis buffer, 1-5% (v / v).

[0023] Furthermore, the concentrations of each component in the above amplification composition are as follows: FGF2, 40 ng / mL IGF-1, 20 ng / mL Vitamin C, 200 μg / mL Platelet lysis buffer, 2% (v / v).

[0024] Fourthly, the present invention provides the application of the above-mentioned amplification culture medium for transdifferentiated nucleus pulposus cells in the amplification of transdifferentiated nucleus pulposus cells.

[0025] Fifthly, the present invention provides a method for constructing nucleus pulposus organoids, the method comprising: seeding 2D or 3D nucleus pulposus cells into a culture plate, adding an amplification medium and culturing for 14-21 days to form nucleus pulposus organoids.

[0026] Furthermore, the diameter of the aforementioned nucleus pulposus organoids is 800-1000 μm.

[0027] 3. Technical Effects Compared with the prior art, the advantages of this invention are as follows: (1) The induction medium for inducing fibroblasts to transdifferentiate into nucleus pulposus cells provided by the present invention can be used to induce fibroblasts to transdifferentiate into nucleus pulposus cells. It does not rely on the overexpression of transcription factors mediated by viral vectors, so there is no risk of gene integration and it is safer for clinical use.

[0028] (2) The induction medium for inducing fibroblasts to transdifferentiate into nucleus pulposus cells provided by the present invention and its application can be used to realize the 2D / 3D transdifferentiation of fibroblasts into nucleus pulposus cells, that is, it can be used for both 2D transdifferentiation and 3D transdifferentiation, and can adapt to different application scenarios.

[0029] (3) The amplification culture medium for transdifferentiated nucleus pulposus cells provided by the present invention can be used for both 2D nucleus pulposus cell amplification and 3D nucleus pulposus cell amplification, and can adapt to different application scenarios.

[0030] (4) The present invention provides a method for constructing a nucleus pulposus organoid, which is formed by culturing in an amplification culture medium. The method is simpler and has important significance for promoting cell therapy for intervertebral disc degenerative diseases. Attached Figure Description

[0031] Figure 1 These are P4 generation fibroblasts.

[0032] Figure 2 This is the result of fibroblast identification.

[0033] Figure 3 This is a 2D image of nucleus pulposus cells 10 days after transdifferentiation.

[0034] Figure 4 The results are obtained by detecting gene expression in 2D and 3D nucleus pulposus cells using qPCR.

[0035] Figure 5 The images show the morphology of 3D nucleus pulposus cells at 14 days after transdifferentiation, as well as the results of HE and Safranin-Fix Green staining.

[0036] Figure 6 These are images of nucleus pulposus organoids after 20 days of 2D / 3D amplification.

[0037] Figure 7 This is the result of safranin-fast green staining of the nucleus pulposus organoids.

[0038] Figure 8 This is the result of COL2A1 immunohistochemical detection of nucleus pulposus organoids. Detailed Implementation

[0039] The present invention will be further described below with reference to specific embodiments.

[0040] It should be noted that, unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains; the term “and / or” as used herein includes any and all combinations of one or more of the associated listed items.

[0041] Unless otherwise specified in the examples, the procedures should be performed under standard conditions or conditions recommended by the manufacturer. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0042] As used herein, the term “about” is used to provide for the flexibility and imprecision associated with a given term, measure, or value. Those skilled in the art can readily determine the degree of flexibility for a particular variable. As used herein, the term “at least one of…” is intended to be synonymous with “one or more of…”. For example, “at least one of A, B, and C” explicitly includes only A, only B, only C, and combinations thereof.

[0043] Concentration, amount, and other numerical data may be presented in range format herein. It should be understood that such range format is used solely for convenience and brevity and should be flexibly interpreted to include not only the values ​​explicitly stated as the limits of the range, but also all individual values ​​or subranges encompassed within the range, as if each value and subrange were explicitly stated. For example, a range of values ​​from about 1 to about 4.5 should be interpreted to include not only the explicitly stated limits of 1 to 4.5, but also individual numbers (such as 2, 3, 4) and subranges (such as 1 to 3, 2 to 4, etc.). The same principle applies to ranges that describe only a single value, such as "less than about 4.5," which should be interpreted to include all the values ​​and ranges described above. Furthermore, this interpretation should apply regardless of the breadth of the range or characteristic described.

[0044] In this invention, the primers involved include: KRT19 : F: TGAGCGGCAGAATCAGGAGTA (SEQ ID NO.1), R: GAGGACCTTGGAGGCAGACAA (SEQ ID NO. 2); ACAN : F: AAAACTTCTTTGGAGTGGGGG (SEQ ID NO.3), R: TGGGCTTTACGGTAAGGATCA (SEQ ID NO.4); SOX9 : F: AAAGCACTCATAATATGGCA (SEQ ID NO.5), R: AAACAAACAAAACACGAACA (SEQ ID NO.6); COL2A1 : F: TGGTCTGAGGGGTCTTCC (SEQ ID NO.7), R: CTGGTCACCTGGGTTTTCC (SEQ ID NO.8); CD24 : F: TAAGAATAGAAATAAAGGATGGG (SEQ ID NO.9), R: TACGTTGAGGAATTACAGTAACA (SEQ ID NO. 10).

[0045] In this invention, the reagents involved include: DMEM high-glucose basal medium, Gibco, C11995500BT; Fetal bovine serum (FBS), Gibco, A5256701; Dispase II dispersant enzyme, Sigma-Aldrich, D4693; Type I collagenase, Sigma-Aldrich, C0130; 0.25% pancreatin-EDTA digestion solution, Gibco, 25200056; PBS buffer (calcium and magnesium-free), Shanghai Yuanpei Biotechnology Co., Ltd., B310KJ; Trypan blue staining solution (0.4%), Solarbio, C0011; Flow cytometry staining buffer, BD Biosciences, 554656; FITC-HLA-DR / DP / DQ, BD Biosciences, 555811; PE-Vimentin, abcam, ab49918; FITC-CD45, BD Biosciences, 561865; FITC IgG1 κ, BD Biosciences, 555748; PE IgG1 κ, abcam, ab81200; FITC-Desmin,abcam,ab185033; FITC-Rabbit IgG, Isotype Control, abcam, ab199091; FGF2, abcam, ab9596; IGF-1, MedChemExpress, HY-P7018; Vitamin C, Sigma-Aldrich, A92902; Proline, Sigma-Aldrich, 81709; Y27632, MedChemExpress, HY-10071; TGF-β3, MedChemExpress, HY-P7120; Platelet lysate, Sexton, PL-SP-500.

[0046] Example 1 This embodiment provides the isolation and identification of human dermal fibroblasts (HDF).

[0047] (1) Isolation and culture of fibroblasts After circumcision, the tissue was placed in pre-cooled PBS buffer containing 1% penicillin and antibiotics and transported to the laboratory within 30 minutes. In a laminar flow hood, the tissue was transferred to sterile culture dishes and rinsed repeatedly with PBS containing 1% penicillin and antibiotics 5-6 times until no visible blood was visible. Subcutaneous fat, fascia, and other connective tissues were removed, retaining the main skin portion. The tissue was cut into 1 cm × 0.5 cm strips using sterile ophthalmic scissors and placed in new sterile culture dishes. Dispase II working solution was prepared: Dispase II was dissolved in serum-free DMEM medium to a working solution of 2.4 U / mL and filtered sterile. Enzymatic separation: The tissue strips were placed in 50 mL centrifuge tubes, 10 mL of Dispase II working solution was added, and the mixture was incubated overnight at 4°C. After overnight incubation, the ends of the tissue strips were gently grasped with sterile ophthalmic forceps, and the epidermis (transparent layer) was gently peeled off in sterile PBS, retaining the underlying milky-white dermis. The dermis was then cut into 1 mm pieces. 3 Transfer small pieces of cells to 50 mL centrifuge tubes, add 10 mL of serum-free DMEM medium containing 0.1% type I collagenase, and digest at 37°C with shaking for 1 hour, gently pipetting every 15 minutes. Add 10 mL of complete medium containing 10% FBS (DMEM + 10% FBS + 1% antibiotics) to stop digestion. Filter the cell suspension through a 70 μm cell sieve to remove undigested tissue residue. Centrifuge the filtered cell suspension at 300×g for 5 minutes and discard the supernatant; resuspend the cell pellet in 5 mL of complete medium and gently pipet to prepare a single-cell suspension. Mix 20 μL of the cell suspension with 20 μL of trypan blue staining solution for counting; count according to (3-5)×10 4 live cells / cm 2 Cells were seeded at a density of 1:1 in T25 culture flasks, and 5 mL of complete culture medium was added. Cells were incubated at 37°C with 5% CO2. After 24 hours of primary culture, the medium was replaced with fresh complete culture medium to remove non-adherent cells. The medium was then replaced every 48 hours until cell confluence reached 80%-90%. For passage, the old medium was discarded, and the cells were washed twice with PBS. 2 mL of 0.25% trypsin-EDTA digestion solution was added, and the cells were incubated at 37°C for 2-3 minutes. When cell shrinkage and increased intercellular spaces were observed under an inverted microscope, 4 mL of complete culture medium was added to stop digestion. The cells were gently pipetted to detach completely and a single-cell suspension was prepared. The cell suspension was centrifuged at 300×g for 5 minutes, and the supernatant was discarded. The cells were resuspended in complete culture medium and seeded into new culture flasks at a 1:3 ratio. Cells from passages P3-P5 were used for subsequent experiments. Images of P4 growth are shown below. Figure 1 .

[0048] (2) Identification of fibroblasts Fibroblasts were identified using flow cytometry (FACS). P3 generation cells in logarithmic growth phase were collected, trypsinized, and resuspended into single-cell suspensions. These suspensions were centrifuged at 180×g for 7 minutes, washed twice with PBS, and finally resuspended in flow cytometry staining buffer to adjust the cell concentration to 1×10⁻⁶ cells / mL. 6 Cells / mL. Take 5 flow cytometry tubes and add 100 μL of cell suspension (containing 1×10⁻⁶ cells / mL) to each tube. 5 (1 cell), and each cell was treated as follows: Blank control tube: No antibodies added; Isotype control tubes: Add the corresponding fluorescently labeled isotype control antibody to each tube.

[0049] All flow cytometry tubes were incubated at room temperature for 30 minutes, protected from light. After incubation, 2 mL of flow cytometry staining buffer was added to each tube, and the tubes were centrifuged at 180×g for 5 minutes, discarding the supernatant. The cells were washed once more, and finally resuspended in 300 μL of flow cytometry staining buffer for analysis. Identification results are shown below. Figure 2 .

[0050] Results analysis: Figure 1 These are P4 generation fibroblasts. As can be seen from the image, the isolated human dermal fibroblasts are spindle-shaped and / or star-shaped, and grow adherently, which is consistent with the morphology of fibroblasts.

[0051] Figure 2 The results of fibroblast identification show that the cells highly express Vimentin and Desmin, but do not express CD45 and HLA-DRDPDQ, which is consistent with the characteristics of HDF.

[0052] Example 2 This embodiment provides a method for inducing fibroblasts to transdifferentiate into nucleus pulposus cells.

[0053] (1) Preparation of induction culture medium Using DMEM / F12 (1:1 volume ratio) as the basal medium, 30 ng / mL FGF2, 50 ng / mL IGF-1, 100 μg / mL vitamin C, 3 mM proline, 12 μM Y27632 (ROCK inhibitor), 10 ng / mL TGF-β3 and 5% fetal bovine serum (v / v) were added, and the pH was adjusted to 7.2.

[0054] (2) Inducing fibroblast 2D transdifferentiation The 6-well plates were pre-cooled at -20°C, and Matrigel matrix (brand: Coring, catalog number: 354277) was added and coated in a 37°C incubator for 1 h; HDF was added at (3-5)×10 4 pcs / cm 2 Density seeding was performed on coated 6-well plates, with 2 mL of induction medium added to each well. The medium was changed every 2 days, and the cells were cultured at 37°C and 5% CO2 for 7-10 days to obtain 2D nucleus pulposus cells (2D-HNP). Cell images are shown below. Figure 3 .

[0055] qPCR detection of 2D nucleus pulposus cells SOX9 , ACAN , KRT19 , COL2A1 and CD24 Gene expression. At 10 days of differentiation, cells were digested with trypsin for 3 minutes, counted, and 1×10⁶ cells were collected. 6 Nucleus pulposus cells and HDF were transferred to centrifuge tubes, and 300 μL of RNA lysis buffer was added to each. After thorough mixing, total RNA was extracted (brand: Promega, catalog number: LS1040). The RNA was transcribed into cDNA using the Promega reverse transcription kit (brand: Promega, catalog number: LS2052). Specific operating procedures are detailed in the product instructions. The cDNA template was then diluted 10-fold, and the primers were diluted to 10 μM. The RT-qPCR reaction mixture consisted of: 10 μL RT-q-PCR mix, 2 μL cDNA template, 0.5 μL primer F, 0.5 μL primer R, and 7 μL sterile water. Two replicates were prepared. The prepared solution was added to the qPCR reaction plate, and the conditions were set as follows: 95°C for 8 min, followed by 40 cycles (95°C for 15 s and 60°C for 1 min). After sealing the plate, the samples were analyzed, and the CT values ​​and ΔCT were processed to create bar charts.

[0056] (3) Inducing 3D transdifferentiation of fibroblasts HDF is made into 1×10 6 For a cell suspension of cells / mL, take 1 mL of cell suspension into a 15 mL centrifuge tube, centrifuge and discard the supernatant, add 1 mL of induction medium, do not resuspend the precipitate, loosen the cap and place in an incubator for static culture for 48 h; after 48 h of culture, discard 0.5 mL of supernatant, add 0.5 mL of fresh induction medium, change the medium every 2-3 days, and culture for 10-14 days to form 3D nucleus pulposus cells (3D-HNP).

[0057] 2D / 3D nucleus pulposus cells were collected and subjected to qPCR detection. The results are shown below. Figure 4 3D nucleus pulposus cells were stained with hematoxylin and eosin and fast green. Results are shown below. Figure 5 .

[0058] Results analysis: Figure 3 This is a 2D image of nucleus pulposus cells 10 days after transdifferentiation. The cells exhibit nucleus pulposus-like morphology, and subsequent qPCR detection of nucleus pulposus cell markers is required.

[0059] Figure 4 The results of gene expression detection in 2D and 3D nucleus pulposus cells were obtained using qPCR. As shown in the figure, compared to the HDF control, the gene expression of both 2D and 3D nucleus pulposus cells increased by approximately 3-4 times, indicating that HDF cells successfully transdifferentiated into nucleus pulposus cells.

[0060] Figure 5 These images show the morphology of 3D nucleus pulposus cells at 14 days of transdifferentiation, along with the results of HE and Safranin-Fix Green staining. The left image shows the morphology of the 3D nucleus pulposus cells, the middle image shows HE staining, and the right image shows Safranin-Fix Green staining. The left image shows that the 3D nucleus pulposus cells are spherical. The middle and right images show that these cells have abundant extracellular matrix and cells, indicating that the 3D nucleus pulposus cells are solid spheres composed of a mixture of cells and extracellular matrix.

[0061] Example 3 This embodiment provides a method for constructing nucleus pulposus organoids.

[0062] (1) Preparation of amplification medium The basal medium was DMEM / F12 (volume ratio 1:1), supplemented with 40 ng / mL FGF2, 20 ng / mL IGF-1, 200 μg / mL vitamin C and 2% platelet lysis buffer.

[0063] (2) Construction of nucleus pulposus organoids The 6-well plates were pre-cooled at -20°C, and then coated with Matrigel matrix (brand: Coring, catalog number: 354277) in a 37°C incubator for 1 hour. 2D nucleus pulposus cells obtained through transdifferentiation were (3-4) × 10 5 3D nucleus pulposus cells were seeded at a density of 1 / mL into a culture plate, and then cultured in amplification medium for 14-21 days to form 3D nucleus pulposus organoids with a diameter of 800-1000μm. The distribution of ECM in nucleus pulposus organoids was verified using safranin-fast green staining and COL2A1 immunohistochemistry.

[0064] Results analysis: Figure 6These are images of nucleus pulposus organoids after 20 days of 2D / 3D amplification. The left image shows the organoid constructed from 2D amplified nucleus pulposus cells, and the right image shows the nucleus pulposus organoid constructed from 3D amplified nucleus pulposus cells.

[0065] Figure 7 These are the results of Safranin-Fibr-Green staining of nucleus pulposus organoids. The left image shows Safranin-Fibr-Green staining of 2D nucleus pulposus cell-expanded organoids, and the right image shows Safranin-Fibr-Green staining of 3D nucleus pulposus cell-expanded organoids. As can be seen from the images, both methods of constructing nucleus pulposus organoids result in abundant extracellular matrix.

[0066] Figure 8 These are the COL2A1 immunohistochemical results for nucleus pulposus organoids. The left image shows the immunohistochemical staining of 2D nucleus pulposus cell-expanded organoids, and the right image shows the immunohistochemical staining of 3D nucleus pulposus cell-expanded organoids. As shown in the images, both methods of constructing nucleus pulposus organoids exhibit strong red fluorescence in COL2A1 immunohistochemical staining, covering the entire organoid. This indicates that the organoids have abundant extracellular matrix and high expression of the nucleus pulposus-specific marker COL2A1, consistent with the characteristics of nucleus pulposus organoids.

Claims

1. A culture medium for inducing the transdifferentiation of fibroblasts into nucleus pulposus cells, characterized in that, The induction medium includes a basal medium and an induction composition, wherein the induction composition includes: FGF2, IGF-1, vitamin C, proline, ROCK inhibitor, TGF-β3 and fetal bovine serum.

2. The induction culture medium according to claim 1, characterized in that, The concentrations of each component in the above-mentioned inducing composition are as follows: FGF2: 10-50 ng / mL IGF-1: 20-80 ng / mL Vitamin C: 50-200 μg / mL Proline: 1-5 mM ROCK inhibitor: 5-20 μM TGF-β3: 10-20 ng / mL Fetal bovine serum: 1-10% (v / v).

3. A method for inducing fibroblasts to transdifferentiate into nucleus pulposus cells, characterized in that, The method includes culturing fibroblasts using the induction medium described in claim 1 or 2.

4. The method according to claim 3, characterized in that, The fibroblasts include any one or more of the following: tissue-isolated fibroblasts, stem cell-differentiated fibroblasts, and fibroblasts transdifferentiated from other cells.

5. The method according to claim 3 or 4, characterized in that, The method includes: seeding fibroblasts into culture dishes coated with Matrigel, adding the induction medium as described in claim 1 or 2, and culturing at 37°C and 5% CO2 for 7-10 days to obtain 2D nucleus pulposus cells.

6. The method according to claim 3 or 4, characterized in that, The method includes: preparing fibroblasts into 1×10 6 Cell suspensions of cells / mL were placed in 15 mL centrifuge tubes, and the induction culture medium described in claim 1 or 2 was added. The cells were cultured at 37°C and 5% CO2 for 10-14 days to form 3D nucleus pulposus cells.

7. A culture medium for the expansion of transdifferentiated nucleus pulposus cells, characterized in that, The amplification medium includes a basal medium and an amplification composition, wherein the amplification composition includes: FGF2, IGF-1, vitamin C and platelet lysis buffer.

8. The amplification culture medium according to claim 7, characterized in that, The concentrations of each component in the amplification composition are as follows: FGF2, 20-60 ng / mL, IGF-1, 10-40 ng / mL Vitamin C, 100-300 μg / mL Platelet lysis buffer, 1-5% (v / v).

9. The application of the amplification culture medium for transdifferentiated nucleus pulposus cells as described in claim 7 or 8 in the amplification of transdifferentiated nucleus pulposus cells.

10. A method for constructing a nucleus pulposus organoid, characterized in that, The method includes: seeding 2D or 3D nucleus pulposus cells onto a culture plate, adding the amplification medium as described in claim 7 or 8, and culturing for 14-21 days to form nucleus pulposus organoids.

Images