Use of isobutyrate in constructing a heart failure cell model

By treating cardiomyocytes with isobutyrate, a non-neurohormone-dependent heart failure cell model was constructed, which solves the problem of the single mechanism of existing models, realizes the simulation of multifactorial heart failure pathology and the flexibility of heart failure research, and provides an experimental platform with scientific research value.

CN121574911BActive Publication Date: 2026-04-10INSTITUTE OF BASIC MEDICAL SCIENCES CHINESE ACADEMY OF MEDICAL SCIENCES
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
INSTITUTE OF BASIC MEDICAL SCIENCES CHINESE ACADEMY OF MEDICAL SCIENCES
Filing Date
2026-01-27
Publication Date
2026-04-10

AI Technical Summary

Technical Problem

Existing cell models of heart failure mainly rely on neurohormonal induction, which has a single mechanism and cannot fully simulate the pathological process of heart failure caused by multiple factors such as metabolic disorders.

Method used

Cardiac cardiomyocytes were treated with isobutyrates (such as sodium isobutyrate or potassium isobutyrate) at concentrations of 0.5-5 mM, especially 5 mM, to induce the expression of heart failure marker genes and increase cell area, thus constructing a novel non-neurohormone-dependent cell model of heart failure.

Benefits of technology

This model can stably upregulate the expression of heart failure marker genes such as Anp, Bnp, and Myh7, significantly increase the area of ​​cardiomyocytes, match the pathological characteristics of heart failure, and provide a flexible and reliable experimental platform for various cardiomyocyte types, making it suitable for studying the pathogenesis and treatment of heart failure.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121574911B_ABST
    Figure CN121574911B_ABST
Patent Text Reader

Abstract

The application discloses application of isobutyrate in construction of a heart failure cell model and relates to the technical field of biology.The application constructs a new heart failure cell model by innovatively applying isobutyric acid or isobutyrate.The model can efficiently induce a heart failure phenotype by treating myocardial cells with 0.5-5 mM concentration of isobutyrate, wherein the effect of 5 mM concentration is optimal, can stably up-regulate the expression of core heart failure marker genes such as Nppa, Nppb and Myh7, and can significantly increase the myocardial cell area, which is consistent with the pathological characteristics of heart failure.Compared with a traditional neurohormone type such as angiotensin II, the application provides a novel heart failure cell model construction path which is not dependent on neurohormones, focuses on metabolic disorder related heart failure inducement, and makes up for the defect of single mechanism of an existing model, and provides a unique tool for research on myocardial injury caused by metabolic abnormalities or intestinal flora metabolites.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to the application of isobutyrate in constructing a heart failure cell model. BACKGROUND

[0002] Heart failure is a clinical syndrome caused by structural or functional abnormalities of the heart, resulting in a decrease in pumping capacity and an inability to meet the body's metabolic demands. Heart failure is the end stage of various heart diseases, and its core features include overactivation of the neuroendocrine system, cardiac hypertrophy, fibrosis, and energy metabolism remodeling. At the cellular level, cardiomyocyte hypertrophy is a key pathological change in the early stage of heart failure, characterized by increased cell volume, increased protein synthesis, and reactivation of the "fetal gene program", such as significant upregulation of atrial natriuretic peptide (ANP) and brain natriuretic peptide (BNP) expression. ANP and BNP have been recognized as gold blood markers for heart failure diagnosis and prognosis assessment, and their upregulation in cardiomyocytes is a classic molecular phenotype of heart failure cell models. Constructing a suitable heart failure cell model is a necessary means to study its pathogenesis and treatment methods.

[0003] The study of heart failure relies heavily on reliable disease models. The most commonly used method for constructing cardiomyocyte hypertrophy / heart failure cell models is currently the use of angiotensin II (Ang II). The specific steps are as follows: a certain concentration of Ang II is added to the culture medium of in vitro cultured cardiomyocytes, and after 24-48 hours of treatment, the area of cardiomyocytes is increased, and the mRNA and protein expression levels of ANP and BNP are upregulated. This model mainly simulates myocardial remodeling caused by neurohormone activation. The mechanism of this model is single, mainly activating the downstream signals of the renin-angiotensin system (RAS), and cannot cover other heart failure causes such as metabolic toxicity.

[0004] In addition to the angiotensin II construction method, neurohormones such as endothelin-1 (ET-1) and phenylephrine (PE) are also used to induce cardiomyocyte hypertrophy or damage. Although these models are commonly used, the induced phenotype may be relatively single, and the mechanism of action is highly concentrated in specific receptor signaling pathways, which cannot fully simulate the complex pathological process of heart failure caused by metabolic disorders and other multiple causes. Therefore, it is urgent to develop more in vitro cell models. SUMMARY

[0005] The purpose of the present application is to provide the application of isobutyrate in constructing a heart failure cell model, to solve the problems existing in the prior art. The present application provides a new heart failure cell model construction method that is not dependent on neurohormones, focusing on metabolic disorder-related heart failure causes, and overcoming the defect of single mechanism of existing models, providing a unique tool for studying myocardial damage caused by metabolic abnormalities or intestinal flora metabolites.

[0006] To achieve the above object, the present application provides the following scheme:

[0007] The present application provides application of isobutyric acid or isobutyric acid salt in constructing a heart failure cell model.

[0008] Further, the isobutyric acid salt is sodium isobutyrate or potassium isobutyrate.

[0009] Further, the concentration of the isobutyric acid or isobutyric acid salt used is 0.5-5 mM.

[0010] Preferably, the concentration of the isobutyric acid or isobutyric acid salt used is 5 mM.

[0011] The present application also provides a method for constructing a heart failure cell model, comprising the step of culturing myocardial cells with a culture medium containing isobutyric acid or isobutyric acid salt.

[0012] Further, the isobutyric acid salt is sodium isobutyrate or potassium isobutyrate.

[0013] Further, the concentration of the isobutyric acid or isobutyric acid salt used is 0.5-5 mM.

[0014] Preferably, the concentration of the isobutyric acid or isobutyric acid salt used is 5 mM.

[0015] The present application also provides a heart failure cell model constructed according to the above-mentioned construction method.

[0016] The present application also provides application of the above-mentioned heart failure cell model in studying the pathogenesis or treatment method of heart failure.

[0017] The present application discloses the following technical effects:

[0018] The present application constructs a new heart failure cell model by innovative application of isobutyric acid or isobutyric acid salt. The model can efficiently induce a heart failure phenotype by treating myocardial cells with isobutyric acid salt at a concentration of 0.5-5 mM, wherein a concentration of 5 mM is optimal, can stably up-regulate expression of core heart failure marker genes such as Anp (Nppa), Bnp (Nppb), and Myh7, and can significantly increase the area of myocardial cells, which is consistent with the pathological characteristics of heart failure.

[0019] Compared with traditional neurohormone-induced models such as angiotensin II, the present application provides a novel heart failure cell model construction path that is not dependent on neurohormones, focuses on metabolic disorder-related heart failure inducers, and makes up for the defect of single mechanism of existing models, thereby providing a unique tool for studying myocardial injury caused by metabolic abnormalities or intestinal flora metabolites.

[0020] In addition, the model is suitable for multiple types of cardiomyocytes, can be used alone or in combination with other stimulating factors, and has strong flexibility. The construction method is simple and has good repeatability, which provides a reliable in vitro experimental platform for the study of the pathogenesis of heart failure, candidate drug screening and treatment scheme optimization, and has important scientific research value and application prospect. BRIEF DESCRIPTION OF DRAWINGS

[0021] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the embodiments will be briefly introduced as follows. Obviously, the drawings in the following description only constitute some embodiments of the present application, and for those skilled in the art, other drawings can also be obtained without creative labor on the basis of these drawings.

[0022] Figure 1 Statistical diagram of the expression level of heart failure related gene Nppa after treating cells with different concentrations of isobutyrate;

[0023] Figure 2 Statistical diagram of the expression level of heart failure related gene Nppb after treating cells with different concentrations of isobutyrate;

[0024] Figure 3 Statistical diagram of the expression level of heart failure related gene Myh7 after treating cells with different concentrations of isobutyrate;

[0025] Figure 4 α-actin immunofluorescence staining diagram after treating with isobutyrate for 48 hours; the scale is 30 μm.

[0026] Figure 5 Statistical diagram of the area of cardiomyocytes after treating with isobutyrate for 48 hours;

[0027] Figure 6 GO function annotation diagram of the genes up-regulated after treating with isobutyrate sodium;

[0028] Figure 7 KEGG pathway analysis diagram of the genes up-regulated after treating with isobutyrate sodium. DETAILED DESCRIPTION

[0029] Now, various exemplary embodiments of the present application will be described in detail, which should not be considered as limiting the present application, but should be understood as a more detailed description of some aspects, characteristics and embodiments of the present application.

[0030] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the present application. In addition, where particular ranges of values are given, understand that each intervening value, to the upper or lower limit of the ranges is also specifically included. The upper and lower limits of these intervening values are also

[0031] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application. All documents mentioned herein are incorporated by reference to disclose and describe the methods and / or materials in connection with which the documents are cited. In case of conflict, the content of the present specification will control.

[0032] Various modifications and changes can be made to the specific embodiments described herein without departing from the scope or spirit of the application. Other embodiments will be apparent to those of ordinary skill in the art from the description and examples provided herein. The description and examples are illustrative only.

[0033] As used herein, the terms "comprises", "comprising", "includes", "including", "has", "having", "contains", "containing", or variations thereof, are intended to be open-ended terms that mean including, but not limited to.

[0034] Example 1

[0035] 1. Experimental materials

[0036] Cells: Rat primary cardiomyocytes

[0037] Compound: Sodium isobutyrate (Aladdin, CAS: 79-31-2).

[0038] Main reagents: Rat primary cardiomyocyte extraction kit (Thermo Fisher, 88281); DMEM culture medium (Savillex, G4515); FBS (HyClone, SH30396.03); secondary antibody (Solebo, P7630); RNA extraction kit (Yishan Biotech, RN001); reverse transcription kit (Takara, 6215A); qPCR premix (Novozyme, Q713); Anp (Nppa), Bnp (Nppb), Myh7 and reference gene Gapdh primers.

[0039] Primer sequences (5'-3'):

[0040] Rat Nppa F: GAAGATGCCGGTAGAAGATGAG (SEQ ID NO. 1);

[0041] Rat Nppa R: AGAGCCCTCAGTTTGCTTTTC (SEQ ID NO. 2).

[0042] Rat Nppb F: GGTCGCTGCCCCAGATGATT (SEQ ID NO. 3);

[0043] Rat Nppb R: CTGGAGACTGGCTAGGACTTC (SEQ ID NO. 4).

[0044] Rat Myh7 F: GCCCCAAATGCAGCCAT (SEQ ID NO. 5);

[0045] Rat Myh7 R: CGCTCAGTCATGGCGGAT (SEQ ID NO. 6).

[0046] Rat Gapdh F: TGACAACTCCCTCAAGATTGTCA (SEQ ID NO. 7);

[0047] Rat Gapdh R: GGCATGGACTGTGGTCATGA (SEQ ID NO. 8).

[0048] 2. Experimental method

[0049] Take the newborn milk rats, take out the heart, use the rat primary myocardial cell separation kit to prepare the primary myocardial cell. The primary myocardial cell is inoculated in the culture plate, and the DMEM culture medium containing 10% FBS, 1x triantigen is used, and the culture is carried out at 37°C, 5% CO2. After the cells adapt to the growth environment and grow to the appropriate density, replace the fresh culture medium containing different concentrations of sodium isobutyrate (0 mM, 0.5 mM, 1 mM, 5 mM). After 48 hours of culture, the total RNA of the cells is extracted, and then reversely transcribed into cDNA. The relative expression amount of mRNA of heart failure marker genes atrial natriuretic peptide (Nppa), brain natriuretic peptide (Nppb) and myosin heavy chain 7 (Myh7) is detected by real-time fluorescent quantitative PCR (qPCR) technology.

[0050] The statistical test method is one-way analysis of variance, ** p<0.01, **** p<0.0001.

[0051] 3. Experimental results

[0052] As shown in Figures 1-3 Figure 2, after treatment of cells with isobutyrate at gradient concentrations of 0, 0.5, 1, 5 mM, the heart failure related genes Nppa, Nppb, Myh7 were all significantly up-regulated, indicating that isobutyrate treatment induced a significant heart failure phenotype in primary cardiomyocytes. Using 5 mM isobutyrate can stably construct a cell model of heart failure.

[0053] Example 2

[0054] 1. Experimental materials

[0055] Cells: Rat primary cardiomyocytes

[0056] Compound: Sodium isobutyrate.

[0057] Main reagents: paraformaldehyde (Selleck, G1101); anti-a-actin antibody (Sigma, A7811); lexaFluor TM 594 secondary antibody (Invitrogen, A-11005).

[0058] 2. Experimental method

[0059] The cardiomyocytes were seeded in culture plates, and after growing to the appropriate density, fresh culture medium containing 5 mM sodium isobutyrate was replaced, and fresh culture medium containing an equal amount of PBS buffer was used as a control. After 48 hours of culture, 4% paraformaldehyde was used for fixation, and anti-a-actin antibody (Sigma, A7811) and Alexa Fluor TM 594 secondary antibody (Invitrogen, A-11005) were used for immunofluorescence staining. An inverted microscope (Leica DMi8) was used to collect images, and software was used to measure the cell surface area. The statistical test method was unpaired t-test, *** p < 0.001.

[0060] 3. Experimental results

[0061] As shown in Figure 4 Figure 3, after 48 hours of isobutyrate treatment, a-actin immunofluorescence staining was performed, and the area of primary cardiomyocytes was significantly increased, indicating that 5 mM isobutyrate treatment caused hypertrophy changes in primary cardiomyocytes.

[0062] As shown in Figure 5 Figure 4, the area of cardiomyocytes was statistically analyzed, and the relative difference fold of the area was calculated. Compared with the control, after treatment of primary cardiomyocytes with isobutyrate, the cell area was significantly increased.

[0063] Example 3

[0064] 1. Experimental materials

[0065] Cells: Rat primary cardiomyocytes

[0066] Compound: Sodium isobutyrate.

[0067] Main reagent: TRIzol (RNA extraction).

[0068] 2. Experimental methods

[0069] Cardiomyocytes were seeded in culture plates and, after growing to an appropriate density, were switched to fresh medium containing 5 mM sodium isobutyrate. RNA was extracted after 48 hours of culture and transcriptome sequencing was performed using an Illumina HiSeq sequencer. Clean reads were compared to the reference genome using HISAT and differential expression analysis was performed using DESeq2. Functional annotation and pathway enrichment analysis were performed using ToppGeneSuite (http: / / toppgene.cchmc.org).

[0070] 3. Experimental results

[0071] As shown in Figures 6-7 GO functional annotation and KEGG pathway analysis of genes upregulated by sodium isobutyrate treatment enriched multiple pathways related to myocardial hypertrophy and cardiomyopathy.

[0072] In summary, the present application proposes and verifies that sodium isobutyrate, as a novel, non-neurohormonal tool compound, can be used to construct a cell model of heart failure, providing a new path different from the traditional Ang II model. This model may focus more on simulating myocardial injury caused by metabolic disorders or abnormal intestinal flora metabolites, providing a unique tool for studying the metabolic etiology of heart failure.

[0073] It has been verified that other salt forms of sodium isobutyrate (such as potassium salt) or isobutyric acid itself (dissociated into isobutyrate ions in the culture medium) have similar effects. Cardiomyocytes are not limited to primary rat cardiomyocytes, but can also include H9C2 cells or primary mouse or human cardiomyocytes, as well as human-derived cardiomyocytes obtained by differentiation of induced pluripotent stem cells (iPSC), all of which can achieve the purpose of the present application. Sodium isobutyrate can be used in combination with other heart failure stimulators (such as low-concentration Ang II) to construct a complex model with more complex or severe phenotypes.

[0074] The above-described embodiments are merely preferred modes of the present application and are not intended to limit the scope of the present application. Without departing from the design spirit of the present application, various modifications and improvements to the technical solutions of the present application made by those of ordinary skill in the art should fall within the scope of protection determined by the claims of the present application.

Claims

1. The use of isobutyrate in the construction of a heart failure cell model using rat primary myocardial cells, characterized in that, The isobutyrate is sodium isobutyrate.

2. Use according to claim 1, characterized in that, The isobutyrate is used at a concentration of 0.5-5 mM.

3. Use according to claim 2, characterized in that, The isobutyrate is used at a concentration of 5 mM.

4. A method of constructing a heart failure cell model, characterized by, The step of culturing the cardiomyocytes using a culture medium containing isobutyrate to obtain the heart failure cells; The isobutyrate is sodium isobutyrate.

5. The construction method according to claim 4, characterized in that, The isobutyrate is used at a concentration of 0.5-5 mM.

6. The construction method of claim 5, wherein, The isobutyrate is used at a concentration of 5 mM.

7. A heart failure cell model constructed according to the construction method of any one of claims 4-6.

Citation Information

Patent Citations

  • Application of sodium butyrate in preparation of drugs or functional foods for preventing and treating myocardial hypertrophy

    CN109010327A

  • Method for constructing human myocardial cell apoptosis model

    CN111411075A