BHK-21 cell line capable of stably expressing human c-Myc gene as well as construction method and application of BHK-21 cell line

Abstract

The invention discloses a BHK-21 cell line capable of stably expressing a human c-Myc gene and a construction method and application thereof, the cell line is hamster kidney tissue fibroblast BHK-c-Myc, the cell line carries the human c-Myc gene, and the cell line can be hijacked by viruses to be used for accelerating one-carbon metabolism in host cells and improving the synthetic efficiency of purine, so that the human c-Myc gene can be used for preparing the human c-Myc gene. The virus titer generated after the Newcastle disease virus infects host cells is improved. The construction method of the cell line comprises the following steps: amplifying a human c-Myc gene, constructing a stable expression vector, co-transfecting the stable expression vector and packaging plasmids psPAX2 and pMD2. G to an HEK-293T cell, culturing, collecting a supernatant rich in lentiviral particles, infecting a BHK-21 cell by using the collected lentivirus, screening by using a puromycin drug, and carrying out enlarged culture to obtain the cell line. And the BHK-c-Myc cell is obtained.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a BHK-21 cell line that stably expresses the human c-Myc gene, its construction method, and its application. Background Technology

[0002] Newcastle disease (ND) is an acute, highly contagious infectious disease caused by the Newcastle disease virus (NDV). It not only causes enormous economic losses to the poultry industry but also poses a persistent threat to the global poultry industry. Developing safe and effective new vaccines has become a crucial aspect of prevention and control efforts to effectively control and block the spread of the virus. In recent years, cell vaccines have received increasing attention due to their significant advantages in production safety, cost-effectiveness, and immunization efficacy. Particularly in the field of ND vaccines, cell-based culture technology is gradually demonstrating its potential to replace traditional chicken embryo production methods and is expected to become the mainstream direction for next-generation vaccine production processes. Against this backdrop, establishing cell lines capable of efficiently supporting viral replication is of significant technical importance for improving vaccine production capacity and quality, and strengthening the overall prevention and control capabilities against ND.

[0003] The efficient replication of Newcastle disease virus (NDV) within cells relies on its hijacking of host cell nutrient resources, thereby establishing a unique virus-cell interaction metabolic pattern. Nucleotides, as the basic units of nucleic acid biosynthesis, are the most crucial components of viral particles. One-carbon metabolism, as the source of key one-carbon units in nucleotide synthesis, plays an indispensable role in this process. Previous studies have confirmed that NDV replication depends on the mitochondrial one-carbon metabolic pathway, which provides the necessary one-carbon units for viral nucleotide biosynthesis. Based on this, theoretically, constructing cell lines that enhance the host cell's one-carbon metabolic pathway will help improve the efficiency of purine synthesis, thereby further increasing the viral yield of NDV.

[0004] BHK-21 cells offer several significant advantages as a substrate for Newcastle disease virus (NDV) amplification. First, these cells are highly susceptible to multiple NDV subtypes, exhibiting rapid intracellular viral replication and achieving high viral titers. Second, the rapid proliferation rate of BHK-21 cells helps shorten the production cycle, thereby improving overall vaccine production efficiency. Furthermore, viruses amplified using BHK-21 cells demonstrate good genetic stability, are less prone to mutation, and more closely resemble the genetic characteristics of the original viral strain. Compared to traditional production substrates such as chicken embryos, BHK-21 cells provide viral products that are highly consistent with the original strain. In conclusion, BHK-21 cells have significant application value in Newcastle disease vaccine production and offer new directions and potential for future vaccine development.

[0005] The MYC oncogene family mainly consists of three members: c-Myc, N-Myc, and L-Myc. The Myc proteins they encode act as key transcription factors, serving as core regulatory hubs within the cell and broadly coordinating multiple fundamental biological processes such as cell proliferation, metabolism, protein synthesis, and survival. Studies have shown that c-Myc can "reprogram" cellular metabolic patterns by integrating one-carbon metabolism into the core of its pro-proliferation signaling network through a sophisticated transcriptional regulatory program. This mechanism ensures that metabolic precursors, represented by one-carbon units (such as those derived from serine), can efficiently flow to the nucleotide synthesis pathway, thereby providing sufficient one-carbon units for the nucleotide biosynthesis necessary for viral replication and ultimately supporting efficient viral replication.

[0006] Therefore, a BHK-21 cell line that stably expresses the human c-Myc gene, its construction method, and its application are urgently needed. Summary of the Invention

[0007] To address the shortcomings of existing technologies, this invention provides a BHK-21 cell line stably expressing the human c-Myc gene, its construction method, and its applications. This invention successfully constructs and screens a high-yielding BHK-21 cell line suitable for Newcastle disease virus (NDV) proliferation, significantly promoting NDV growth. By introducing the human c-Myc gene, the one-carbon metabolic flux within the host cell is enhanced, thereby increasing purine synthesis efficiency and resulting in higher viral titers produced after NDV infection of the host cell.

[0008] To solve the above-mentioned technical problems, the present invention provides the following technical solution:

[0009] The first objective of this invention is to provide a BHK-21 cell line that stably expresses the human c-Myc gene. The cell line is a hamster kidney fibroblast BHK-c-Myc, classified as Mesocricetus auratus, with accession number CCTCCNO: C2025342, accession date November 12, 2025, and deposited at the China Center for Type Culture Collection, located at No. 299 Bayi Road, Wuchang District, Wuhan City, Hubei Province, within the campus of Wuhan University.

[0010] Preferably, the nucleotide sequence of the human c-Myc gene is shown in SEQ ID No. 1.

[0011] The second objective of this invention is to provide an application of the BHK-21 cell line stably expressing the human c-Myc gene in the propagation of Newcastle disease virus.

[0012] The third objective of this invention is to provide a method for constructing a BHK-21 cell line that stably expresses the human c-Myc gene, comprising the following steps:

[0013] (A) Amplify the human c-Myc gene and construct a stable expression vector;

[0014] (B) The stable expression vector described in step (A) was co-transfected with psPAX2 and pMD2.G plasmids into HEK-293T cells to package and produce infectious lentiviruses;

[0015] (C) After infecting BHK-21 cells with the lentivirus obtained in step (B), puromycin drug screening and large-scale culture are performed to obtain the BHK-21 cell line that stably expresses the human c-Myc gene.

[0016] Preferably, in step (A), the primer sequences for amplifying the human c-Myc gene are shown in SEQ ID No. 2 and SEQ ID No. 3.

[0017] Preferably, in step (A), the construction step of the stable expression vector is specifically performed as follows:

[0018] The amplified human c-Myc gene was ligated to the vector fragment, and the resulting ligation product was added to DH5α competent cells. After heat shock, the cells were added to culture medium for further culture. Single colonies were selected and plasmids were extracted.

[0019] Preferably, the vector fragment is a vector fragment digested by Phage plasmid.

[0020] Preferably, the heat shock is performed at 42°C for 45 seconds; the culture medium is LB solid culture medium containing ampicillin. Compared with the prior art, the present invention has the following advantages:

[0021] This invention provides a BHK-21 cell line that stably expresses the human c-Myc gene. The BHK-21 cell line is a hamster kidney fibroblast BHK-c-Myc cell line containing the human c-Myc gene, which can be hijacked by the virus to accelerate one-carbon metabolism in the host cell, increase the efficiency of purine synthesis, and increase the viral titer produced by Newcastle disease virus after infecting the host cell.

[0022] This invention provides a method for constructing a BHK-21 cell line stably expressing the human c-Myc gene. First, the human c-Myc gene is amplified and a stable expression vector is constructed. Then, the stable expression vector, along with psPAX2 and pMD2.G plasmids, is co-transfected into HEK-293T cells, packaging and generating infectious lentiviruses. Finally, the obtained lentiviruses are used to infect BHK-21 cells, followed by puromycin drug screening and large-scale culture to obtain a BHK-21 cell line stably expressing the human c-Myc gene. Cells successfully constructed using this method exhibit consistent activation of cell proliferation and protein synthesis pathways without significant increase in apoptosis or genetic instability, resulting in shorter culture cycles, reduced batch-to-batch variability, and the ability to maintain high yields even under low serum conditions. This enables higher titers and more uniform product quality in recombinant protein or virus production, significantly improving process scale-up and reproducibility.

[0023] Cell Preservation:

[0024] This invention provides a stable BHK-21 cell line expressing the human c-Myc gene. The cell line is a hamster kidney fibroblast BHK-c-Myc, classified as Mesocricetus auratus, which was obtained by the inventors through screening. The accession number is CCTCC NO: C2025342, the accession date is November 12, 2025, and the depositary institution is the China Center for Type Culture Collection, located at No. 299 Bayi Road, Wuchang District, Wuhan City, Hubei Province, within the campus of Wuhan University. Attached Figure Description

[0025] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0026] Figure 1 This is a diagram showing the identification results of the human c-Myc gene amplified by RT-PCR as described in Example 1 of this invention;

[0027] Figure 2 This is the identification of BHK-c-Myc cell subclones obtained in Example 1 of the present invention. Mock is BHK-21 cell, 1 is subclone 1, 2 is subclone 2, and 3 is subclone 3.

[0028] Figure 3 This is a graph showing the stability test results of BHK-c-Myc cells obtained in Example 1 of this invention;

[0029] Figure 4 This invention relates to the expression levels of one-carbon metabolism pathway proteins in BHK-21 (wild-type BHK-21 cell line in the figure) and BHK-c-Myc cells.

[0030] Figure 5 This invention relates to the TCID of Newcastle disease virus in BHK-21 (wild-type BHK-21 cell line in the figure) and BHK-c-Myc cells at different time points. 50 . Detailed Implementation

[0031] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be described in detail below. Obviously, the described embodiments are only a part of the embodiments of this invention, and not all of them. Based on the embodiments of this invention, all other implementation methods obtained by those skilled in the art without creative effort are within the scope of protection of this invention.

[0032] The above technical solution will be described in detail below with reference to specific embodiments.

[0033] In the following examples, the plasmids psPAX2 and pMD2.G were purchased from addgene, and the DH5α competent cells were provided by Tiangen.

[0034] Example 1: Amplification of the human c-Myc gene and construction of a stable expression vector.

[0035] Step 1: Extract RNA from HeLa cells. Use the Total RNA Extraction Kit for HeLa Cells (catalog number: ET101-01-V2) and follow the instructions below:

[0036] (1) Cell samples were collected using Trans Zol lysis buffer. The lysis buffer was collected into 1.5 mL RNase-free EP tubes and shaken at room temperature for 5 min.

[0037] (2) For every 1 mL of Trans Zol used, add 0.2 mL of RNA Extraction Agent, shake vigorously for 15 seconds, and incubate at room temperature for 3 minutes.

[0038] (3) Centrifuge at 10000g at 4℃ for 15min. At this time, the sample is divided into three layers: colorless aqueous phase (upper layer), middle layer, and pink organic phase (lower layer).

[0039] (4) Transfer the colorless aqueous phase to a new centrifuge tube, add 0.5 mL of isopropanol, invert and mix well, and incubate at room temperature for 10 min.

[0040] (5) Centrifuge at 4℃ for 10 minutes with 10000g, remove the supernatant, and form a gel-like precipitate on the side and bottom of the tube.

[0041] (6) Add 1 mL of 75% ethanol (prepared with DEPC water), vortex vigorously, and centrifuge at 7500g at 4℃ for 5 min.

[0042] (7) Discard the supernatant, let stand at room temperature for 5 min, add 50 μL of RNA lysis solution, incubate at 55℃ for 10 min to obtain the RNA sample, and store at -80℃ for long-term use.

[0043] (8) Using the Yisheng Reverse Transcription Kit (catalog number: 11123ES60), follow the steps outlined in the product instructions as follows:

[0044] Reagent Name Dosage RNA 1-5μg Remove DNA enzymes 3μL RNase-free water To 15μL

[0045] Incubate at 42℃ for 2 minutes.

[0046] Reagent Name Dosage previous RNA reaction solution 15μL Premixed reverse transcriptase 5μL

[0047] First at 55℃ for 15 minutes; then at 85℃ for 5 seconds.

[0048] Step 2: Design primers for the human c-Myc gene.

[0049] Primers F and R were designed based on the predicted sequence of the human c-Myc gene (gene ID: 4609) from GenBank. The sequence of primer F (endonuclease: KpnI) is shown in SEQ ID No. 2.

[0050] TAAGCTTGCGGCCGCGAATTCCTGGATTTTTTTCGGGTAGTGGAAAACC;

[0051] The sequence of primer R (endonuclease: BamHI) is shown in SEQ ID No. 3:

[0052] GGATCCTCTAGAGTCGACTGGTACCatCGCACAAGAGTTCCGTAGCTG.

[0053] Step 3: Amplify the human c-Myc gene and purify it using gel extraction.

[0054] The PCR system is as follows:

[0055] Reagent Name Dosage (μL) High-fidelity enzymes 1 F 1 R 1 dNTP 1 10× buffer solution 10 DNA template 3 <![CDATA[ddH2O]]> 33 Total 50

[0056] The PCR procedure is as follows:

[0057]

[0058] After electrophoresis on a 1% agarose gel, the results are as follows: Figure 1 As shown in SEQ ID No. 1. The obtained human c-Myc gene sequence is shown in SEQ ID No. 1.

[0059] Step four: Connect and transform.

[0060] The connection system is as follows:

[0061]

[0062]

[0063] The conversion steps are as follows:

[0064] (1) Add the ligation product to 50 μL of DH5α competent cells and incubate on ice for 30 min.

[0065] (2) Heat shock at 42℃ for 60 seconds;

[0066] (3) Add 1 mL of LB medium and incubate at 37°C and 200 rpm for 1 h.

[0067] (4) Coating the plate.

[0068] Step 5: Select bacteria and extract plasmid Phage-c-Myc to construct the stable expression vector.

[0069] Example 2: Packaging lentiviruses.

[0070] The stable expression vector was combined with psPAX2 and pMD2.G plasmids to form a three-plasmid system, which was then co-transfected into HEK-293T cells. After 60 hours, the supernatant was collected and centrifuged at 4000 rpm for 5 minutes to obtain the packaged lentivirus.

[0071] The specific composition of the three-plasmid system is shown in the table below. The three-plasmid system is obtained by mixing the reagents in tube A and tube B.

[0072]

[0073] Example 3: Lentiviral infection of cell lines.

[0074] Step 1: Seed BHK-21 cells at an appropriate density in 6-well plates. When the cell density reaches approximately 80%, replace the medium with a lentiviral transfection mixture. This mixture is prepared by mixing equal volumes of serum-free DMEM medium and lentiviral concentrate at a 1:1 ratio, with a total volume of 2 mL per well, and contains 2 μL of polybrene to enhance transfection efficiency.

[0075] Step 2: 12 hours after inoculation, replace the medium with DMEM containing 1% fetal bovine serum and continue culturing for 24 hours. Then add puromycin (antibiotic screening). After two screenings, the resulting cells are the BHK-21 cell line (BHK-c-Myc cells) expressing the human c-Myc gene. A portion is expanded and frozen, while the other portion is limitedly diluted and plated into 96-well plates. Single subclones are selected and expanded.

[0076] Example 4: Identification.

[0077] Step 1: Western Blot identification.

[0078] (1) The single subclonal cells selected in step 2 of Example 3 were seeded into a 6-well plate. After the cells were confluent, they were lysed with 200 μL of 2×loading protein lysis buffer and placed in a centrifuge tube.

[0079] (2) The sample was placed at 100℃ and left to stand for 10 minutes.

[0080] (3) Gel running: Prepare 10% PAGE protein gel, add the sample, run at 80V for 120min.

[0081] (4) Transfer: Carefully remove the SDS-PAGE gel from the glass plate and place 4 layers of filter paper, PVDF membrane, gel layer and 4 layers of filter paper in the order from positive to negative electrode. After removing air bubbles from each layer, transfer it into the electrophoresis apparatus, pour in the pre-cooled transfer buffer (Tris-glycine-methanol buffer), and place the electrophoresis tank in an ice box. Transfer the membrane at 250mA for 95 minutes.

[0082] (5) Sealing: Prepare a 5% skim milk powder sealing solution and seal it in a shaker at room temperature for 1 hour.

[0083] (6) Primary antibody incubation: Prepare 5% BSA solution and dilute the primary antibody (homoc-Myc, rabbit antibody, proteintech catalog number: 10828-1-AP) 1:1000, and incubate overnight at 4°C on a shaker. Washing: Wash the PVDF membrane 3 times with TBST solution, 5 min each time.

[0084] (7) Secondary antibody incubation: Dilute the corresponding secondary antibody (rabbit secondary antibody, abclonal catalog number: AS014) with TBST at a ratio of 1:10000, place the PVDF membrane on the secondary antibody, and incubate on a shaker at room temperature for 1 hour. Rinsing: Rinse the PVDF membrane 3 times with TBST solution for 5 minutes each time.

[0085] (8) Chemiluminescence: Under light-protected conditions, mix the chemiluminescence developer in a 1:1 ratio, rinse the membrane, and then place it in a chemiluminescence developer to detect the results. Figure 2As shown. Cells with high c-Myc gene expression levels after subcloning were expanded, cultured, and preserved.

[0086] Step 2: qPCR was used to detect the stability of c-Myc gene expression in cell lines.

[0087] The cells constructed in step three of Example 1 were cryopreserved, thawed, and passaged for counting. RNA was extracted from the cells at passages 0, 10, 20, and 30. Quantitative reverse transcription (1 μg) was performed, followed by qPCR detection. Figure 3 As shown, the c-Myc gene can be stably inherited during cell passage, indicating that the BHK-21 cell line stably expressing the human c-Myc gene has been successfully constructed.

[0088] Step 3: Western blotting was used to detect the levels of one-carbon metabolism pathway proteins in cells.

[0089] (1) The single subclonal cells selected in step one of Example 4 were seeded into a 6-well plate. After the cells were confluent, they were lysed with 200 μL of 2×loading protein lysis buffer and placed in a centrifuge tube.

[0090] (2) The sample was placed at 100℃ and left to stand for 10 minutes.

[0091] (3) Gel running: Prepare 10% PAGE protein gel, add the sample, run at 80V for 120min.

[0092] (4) Transfer: Carefully remove the SDS-PAGE gel from the glass plate and place 4 layers of filter paper, PVDF membrane, gel layer and 4 layers of filter paper in the order from positive to negative electrode. After removing air bubbles from each layer, transfer it into the electrophoresis apparatus, pour in the pre-cooled transfer buffer (Tris-glycine-methanol buffer), and place the electrophoresis tank in an ice box. Transfer the membrane at 250mA for 95 minutes.

[0093] (5) Sealing: Prepare a 5% skim milk powder sealing solution and seal it in a shaker at room temperature for 1 hour.

[0094] (6) Primary antibody incubation: Prepare 5% BSA solution and dilute the primary antibody (homoc-Myc, SHMT1, SHMT2, MTHFD2, MTHFD1L, rabbit antibody, Proteintech catalog numbers: 10828-1-AP, 30192-1-AP, 11099-1-AP, 12270-1-AP, 16113-1-AP) at a ratio of 1:1000, and incubate overnight at 4°C on a shaker. Washing: Wash the PVDF membrane three times with TBST solution for 5 min each time.

[0095] (7) Secondary antibody incubation: Dilute the corresponding secondary antibody (rabbit secondary antibody, abclonal catalog number: AS014) with TBST at a ratio of 1:10000, place the PVDF membrane on the secondary antibody, and incubate on a shaker at room temperature for 1 hour. Rinsing: Rinse the PVDF membrane 3 times with TBST solution for 5 minutes each time.

[0096] (8) Chemiluminescence: Under light-protected conditions, mix the chemiluminescence developer in a 1:1 ratio, rinse the membrane, and then place it in a chemiluminescence developer to detect the results. Figure 2 As shown. Cells with high c-Myc gene expression levels after subcloning were expanded, cultured, and preserved.

[0097] like Figure 4 As shown: After stable expression of c-Myc, Western blot results showed that the expression levels of proteins in the one-carbon metabolism pathway (SHMT1, SHMT2, MTHFD2, MTHFD1L) increased in the host cells.

[0098] Step 4: Newcastle disease virus growth curves on BHK-21 and BHK-c-Myc cells.

[0099] The single subclonal cells selected in step one of Example 4 were seeded into 6-well plates. When the cells reached 70% confluence, the cells in one well were digested for counting. The supernatant was collected at 6h, 18h, and 24h after BHK-21 and BHK-c-Myc cells were infected with 1 MOI of Newcastle disease virus and used to detect TCID. 50 The result is as follows Figure 5 As shown, the TCID of Newcastle disease virus on BHK-c-Myc cells 50 The titer was higher than that on BHK cells.

[0100] Finally, it should be noted that the above descriptions are merely preferred embodiments of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A BHK-21 cell line stably expressing the human c-Myc gene, characterized in that, The cell line is hamster kidney fibroblast BHK-c-Myc, classified as Mesocricetus auratus, with accession number CCTCC NO: C2025342, deposit date November 12, 2025, and deposited at the China Center for Type Culture Collection, located at No. 299 Bayi Road, Wuchang District, Wuhan City, Hubei Province, within the campus of Wuhan University.

2. The BHK-21 cell line stably expressing the human c-Myc gene according to claim 1, characterized in that, The nucleotide sequence of the human c-Myc gene is shown in SEQ ID No.

1.

3. The application of a BHK-21 cell line stably expressing the human c-Myc gene as described in any one of claims 1-2 in the propagation of Newcastle disease virus.

4. A method for constructing a BHK-21 cell line stably expressing the human c-Myc gene as described in any one of claims 1-2, characterized in that, Includes the following steps: (A) Amplify the human c-Myc gene and construct a stable expression vector; (B) The stable expression vector described in step (A) was co-transfected with psPAX2 and pMD2.G plasmids into HEK-293T cells to package and produce infectious lentiviruses; (C) After infecting BHK-21 cells with the lentivirus obtained in step (B), puromycin drug screening and large-scale culture are performed to obtain the BHK-21 cell line that stably expresses the human c-Myc gene.

5. The construction method according to claim 4, characterized in that, In step (A), the primer sequences for amplifying the human c-Myc gene are shown in SEQ ID No. 2 and SEQ ID No.

3.

6. The construction method according to claim 4, characterized in that, In step (A), the construction of the stable expression vector is specifically performed as follows: The amplified human c-Myc gene was ligated to the vector fragment, and the resulting ligation product was added to DH5α competent cells. After heat shock, the cells were added to culture medium for further culture. Single colonies were selected and plasmids were extracted.

7. The construction method according to claim 6, characterized in that, The vector fragment is the vector fragment obtained after Phage plasmid digestion.

8. The construction method according to claim 6, characterized in that, The heat shock was performed at 42°C for 45 seconds; the culture medium was LB solid medium containing ampicillin.

Images