Use of insect adult cytochrome b5 in pest control

Abstract

The application discloses application of insect adult cytochrome b5 in pest control and belongs to the field of plant protection. Through a molecular cloning technique, the application successfully obtains full-length sequences of two Cyt b5 genes Cyt b5v1 and Cyt b5v2, and confirms that the two genes are in a high expression state in a whitefly resistant population. Double-stranded RNAs, namely dsCyt b5v1 and dsCyt b5v2, are synthesized by using an RNA interference (RNAi) technique, and after feeding treatment, the expression of target genes is significantly inhibited, and the sensitivity of the whitefly to different neonicotinoid insecticides is effectively improved. The application has the core advantages of low toxicity, high efficiency and high safety while realizing high insecticidal activity, and provides important technical support for a green pest control system in a field.

Description

Technical Field

[0001] This invention belongs to the field of plant protection, specifically relating to the application of insect adult cytochrome b5 in pest control. Background Technology

[0002] Cytochrome b5 (Cyt b5) is a mitochondrial and microsomal membrane protein (approximately 15 kDa) containing a heme group, serving as an electron transport mediator or allosteric modifier. This protein is widely involved in various physiological processes, including metabolism, fatty acid desaturation, methemoglobin / hemoglobin cycling, and steroid hormone biosynthesis. Furthermore, Cyt b5 can synthesize glycerol-type phospholipids in the heart and neuronal tissues. In the field of drug development, the metabolic function of Cyt b5 is particularly important. Current research indicates that Cyt b5 can affect the catalytic activity of more than 20 P450 isoenzymes (such as P450s 3A4, 2B6, 2C9, 2C19, and 2E1), demonstrating that differences in Cyt b5 activity are a key determinant of P450s drug metabolism. Cytochrome b5 (Cyt b5) shows great potential as a novel target for insecticide development, especially in combating pesticide-resistant pests. Traditional resistance management often targets a single P450 enzyme, but pests have hundreds of P450 enzymes, which can easily lead to compensation or new mutations. The biggest advantage of cytochrome b5 as a target is that it is a key electron donor for the cytochrome P450 enzyme system. Inhibiting Cyt b5 is equivalent to cutting off the "power supply" of multiple P450 enzymes, which is a "bottleneck" strategy, making it more difficult for pests to develop resistance. Traditional synergists such as piperitin (PBO) can improve the efficacy of insecticides by inhibiting mixed-function oxidases (MFO), but they have the following significant drawbacks: (1) Poor specificity: PBO not only inhibits the enzymes of pests, but may also affect the metabolic enzyme systems of non-target organisms (including beneficial insects in the environment and even mammals), posing environmental toxicity risks; (2) Photodegradability: Traditional chemical synergists are easily decomposed under ultraviolet radiation in the field, resulting in a short duration of effectiveness; (3) Self-resistance: Long-term use has led to some pests developing adaptations to the synergists themselves.

[0003] The whitefly (Bemisia tabaci) (Insecta: Hemiptera: Aleyrodidae: Sternorrhyncha: Hemiptera: Aleyrodidae) is a phloem-feeding insect characterized by its wide host adaptability, high reproductive rate, rapid virus transmission, and susceptibility to pesticide resistance, making it a significant pest in global agriculture. Currently, whitefly control relies primarily on chemical insecticides, but traditional pesticides have gradually revealed limitations over long-term use, such as increased resistance and environmental pollution. The emergence of neonicotinoid insecticides has brought a breakthrough to chemical control, quickly becoming the mainstream product in the market. However, due to the high frequency and large-scale use of neonicotinoid insecticides, whiteflies have developed varying degrees of resistance to these pesticides. Just as the effectiveness of antibiotics in controlling human diseases is threatened by the evolution of resistant strains, crop pests and diseases also face the challenge of evolving pesticide resistance.

[0004] Therefore, it is urgent to effectively manage neonicotinoid resistance in order to reduce pesticide use and ensure the lifespan and control efficacy of insecticides. Summary of the Invention

[0005] To address the aforementioned problems, the present invention aims to provide a Cyt b5 inhibitor as a novel target for insecticide development, specifically for the effective control of neonicotinoid resistance in whiteflies. This invention represents a revolutionary shift from the traditional "targeting the main enzyme" strategy to a "targeting the auxiliary network" strategy, and, most importantly, provides solid theoretical guidance for the management of insecticide resistance in pests.

[0006] Based on in-depth analysis of previous transcriptome data, we found that Cyt b5 expression was significantly upregulated in resistant populations, suggesting that this gene may be closely related to resistance mechanisms. Using information from the whitefly genome and the NCBI database, this invention reveals the existence of two different forms of Cyt b5 in adult whiteflies: Cyt b5v1 and Cyt b5v2. To further verify whether Cyt b5 (including Cyt b5v1 and Cyt b5v2) is associated with resistance to neonicotinoid insecticides, we compared the coding sequences of Cyt b5 in resistant and susceptible populations. The results showed that the Cyt b5 sequence did not mutate in the resistant population compared to the susceptible population, suggesting that sequence mutations may not play a major role in resistance mechanisms. Using qRT-PCR and Western blot techniques, we found that the mRNA and protein levels of Cyt b5 (Cyt b5v1 and Cyt b5v2) were significantly higher in the resistant population than in the susceptible population. The midgut of the whitefly is a key tissue involved in detoxification, and Cyt b5, as an important component of the P450s redox system, plays a crucial role. Therefore, we further investigated the enrichment of Cyt b5 (Cyt b5v1 and Cyt b5v2) in the midgut tissue of resistant populations. The results showed that the enrichment level of Cyt b5 (Cyt b5v1 and Cyt b5v2) in resistant populations was significantly higher than that in susceptible populations, indicating a significant association between the overexpression of Cyt b5 (Cyt b5v1 and Cyt b5v2) and resistance to neonicotinoid insecticides. This invention not only deepens our understanding of the resistance mechanism in whiteflies but also provides important reference for the detection and early warning of resistant whitefly populations.

[0007] On one hand, the present invention provides the application of cytochrome b5 in pest control, wherein the cytochrome b5 gene is selected from the Cyt b5v1 gene and / or the Cyt b5v2 gene, the accession number of the whitefly genome database for the nucleotide sequence of the Cyt b5v1 gene is Bta11921, the accession number of the whitefly genome database for the nucleotide sequence of the Cyt b5v2 gene is Bta13632, and the pest species is whitefly.

[0008] Specifically, the application involves inhibiting the expression or activity of the cytochrome b5 gene, reducing the resistance of pests to pesticides, increasing their sensitivity to pesticides, and / or increasing the efficacy of pesticides against pests.

[0009] Specifically, the inhibition is achieved through RNA interference.

[0010] Specifically, the cytochrome b5 gene is selected from the Cyt b5v1 gene and / or the Cyt b5v2 gene. The accession number of the nucleotide sequence of the Cyt b5v1 gene in the whitefly genome database is Bta11921 (http: / / www.whiteflygenomics.org / cgi-bin / bta / blast.cgi), and the accession number of the nucleotide sequence of the Cyt b5v2 gene in the whitefly genome database is Bta13632 (http: / / www.whiteflygenomics.org / cgi-bin / bta / blast.cgi). Preferably, the insect is a whitefly.

[0011] Specifically, the insecticide is a neonicotinoid insecticide.

[0012] Specifically, the neonicotinoid insecticide is selected from imidacloprid, thiamethoxam, acetamiprid, acetamiprid, and thiamethoxam.

[0013] On the one hand, the present invention provides a gene interference agent for pest control, the active ingredient of which is a double-stranded RNA that targets the cytochrome b5 gene. The double-stranded RNA is synthesized using RNA interference technology, and the gene interference agent is used in the form of spraying or feeding.

[0014] Specifically, the double-stranded RNA is selected from dsCyt b5v1 and / or dsCyt b5v2. Preferably, the nucleotide sequence of dsCyt b5v1 is shown in SEQ ID NO.9, and the nucleotide sequence of dsCyt b5v2 is shown in SEQ ID NO.10.

[0015] On the one hand, the present invention provides the application of the gene disruptor in the preparation of products that inhibit or alleviate insecticide resistance in pests.

[0016] On the other hand, the present invention provides a method for pest control, which involves feeding or spraying the pest with the gene-interfering agent to inhibit the expression or activity of the cytochrome b5 gene, and then spraying an insecticide.

[0017] Specifically, the concentration of the gene interfering agent in feeding or spraying is 0.5-2.0 μg / μl, and the insecticide is sprayed 24h and 48h after feeding. Preferably, the concentration is 0.6-1.0 μg / μl.

[0018] Beneficial Technical Effects: This invention clarifies the link between Cyt b5 and pesticide resistance in whiteflies, innovatively using Cyt b5 as a new target for insecticide development. By interfering with Cyt b5 expression using RNAi technology, highly targeted targeting is achieved, specifically targeting the pests and blocking resistance upstream in the electron transport chain. This is safer and more thorough than traditional chemical synergists, significantly improving the control efficacy of various neonicotinoid insecticides. After treatment with dsCyt b5v1 and dsCyt b5v2, the mRNA and protein levels of neonicotinoid-resistant whitefly populations significantly decreased, while their sensitivity to neonicotinoids significantly increased, effectively enhancing insecticide control. This invention represents a strategic shift from "targeting the main enzyme" to "targeting the auxiliary network," providing a new pathway for pest resistance management. It not only reduces pesticide usage and extends insecticide lifespan but also reduces environmental pollution, balancing control efficacy and ecological safety, and has significant application value. Attached Figure Description

[0019] Figure 1 This refers to the sequence alignment analysis of Cyt b5 in the Q-type whitefly; where R represents the resistant population, S represents the susceptible population, RA-RD represents biological repeats of the resistant population, and SA-SD represents biological repeats of the susceptible population.

[0020] Figure 2 Phylogenetic analysis of Cyt b5 in different insect species.

[0021] Figure 3 Analysis of Cyt b5 (Cyt b5v1 and Cyt b5v2) mRNA and protein expression levels in different populations of adult whiteflies; where A represents the mRNA expression levels of Cyt b5v1 and Cyt b5v2, respectively, and B represents the electrophoresis results of the protein expression levels of Cyt b5v1 and Cyt b5v2, where S #1 As a sensitive population, R #1 R #2 R #3 R #4 (For resistant populations).

[0022] Figure 4 Immunofluorescence staining of Cyt b5 (Cyt b5v1 and Cyt b5v2) proteins in the midgut of the resistant adult whitefly was performed. #1 / Cyt b5v1、R #1 / Cyt b5v1 represents the immunofluorescence staining results of Cyt b5v1 in susceptible and resistant populations. #1 / Cyt b5v2、R #1 / Cyt b5v2 represents the results of Cyt b5v2 immunofluorescence staining in susceptible and resistant populations.

[0023] Figure 5 The study investigated the changes in Cyt b5 (Cyt b5v1 and Cyt b5v2) expression levels in adult whiteflies treated with dsCyt b5 and assessed their sensitivity to imidacloprid, thiamethoxam, acetamiprid, acetamiprid, and thiamethoxam after interference. dsEGFP served as the experimental control group. A and C represent the RNAi interference efficiency of Cyt b5 (Cyt b5v1 and Cyt b5v2); B and D represent the RNAi interference efficiency of two resistant whitefly populations (R...). #1 R #2 ) and a sensitive population (S #1 Sensitivity assays for different neonicotinoid agents after a decrease in Cyt b5 (Cyt b5v1 and Cyt b5v2) mRNA levels. Detailed Implementation

[0024] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer as a result of the description. However, these embodiments are merely illustrative and do not constitute any limitation on the scope of protection defined by the claims of the present invention.

[0025] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that the upper and lower limits of the range and each intermediate value between them are specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, are also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0026] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0027] The insecticides used in the following examples are five different neonicotinoid insecticides. Detailed information is shown in Table 1.

[0028] Table 1. Detailed information on neonicotinoid insecticides used in this experiment.

[0029]

[0030] a This indicates that the component descriptors of all active ingredients listed in this table are classified according to the Mechanism of Action (MoA) classification criteria established by the Insecticide Resistance Action Committee (IRAC).

[0031] Example 1: Detection of resistance level of whiteflies to neonicotinoid agents

[0032] The susceptibility of different experimental populations of whiteflies to five neonicotinoid pesticides was determined. Mortality rates were calculated for each treatment group, and the median lethal concentration (LC50) was calculated using POLO software. 50 The resistance multiple is determined by the resistant population LC. 50 With sensitive populations LC 50 Ratio calculation. The resistance levels of different whitefly populations to five different neonicotinoid insecticides are shown in Table 2. S #1 As a sensitive population, R #1 -R #5 It is a resistant population.

[0033] Table 2. Resistance of different whitefly populations to five different neonicotinoid insecticides

[0034]

[0035] The results in Table 2 indicate that: compared with the sensitive population (S) #1 Compared to the whitefly resistant population (R), #1 -R #5 They developed varying degrees of moderate to high resistance to five neonicotinoid agents.

[0036] Example 2: Correlation analysis between redox element Cyt b5 and resistance

[0037] Based on the Whitefly Genome Database and the NCBI database, two different forms of Cyt b5 (Cyt b5v1, with accession number Bta11921 in the Whitefly Genome Database, and Cyt b5v2, with accession number Bta13632 in the Whitefly Genome Database) were identified in adult whiteflies (http: / / www.whiteflygenomics.org / cgi-bin / bta / blast.cgi). The full-length sequences of the Cyt b5 (Cyt b5v1 and Cyt b5v2) genes were obtained through molecular cloning. First, total RNA was extracted from whiteflies and reverse transcribed to synthesize cDNA. Cloning primers for Cyt b5 (Cyt b5v1 and Cyt b5v2) were then synthesized (Cyt b5v1-F: CGTGTTGTAGATAGGAACTAAGGCTC as shown in SEQ ID NO.1; Cyt b5v1-R: GTAAAAGTCACGAGGTCATAATGATG as shown in SEQ ID NO.2; Cyt b5v2-F: ATGGCCGAAGAAGCTGTTGT as shown in SEQ ID NO.3; Cyt b5v2-R: TTAGAAGTAGGATTTGAAGATG as shown in SEQ ID NO.4). PCR was then performed. The PCR products were then recovered from the gel, ligated, and transformed. Positive single colonies were selected and sent to a company for sequencing to obtain the accurate sequences of the whitefly Cyt b5 (Cyt b5v1 and Cyt b5v2) genes. The PCR system is shown in Table 3, and the PCR reaction procedure is shown in Table 4.

[0038] Table 3. PCR Reaction System

[0039]

[0040] Table 4. PCR reaction procedure

[0041]

[0042] Experimental results are as follows Figure 1-2 As shown in the figure, the results of the Cyt b5 sequence alignment analysis in the Q-type whitefly are as follows: Figure 1As shown, Cytb5v1 and Cytb5v2 are 396 bp and 393 bp in length, respectively, encoding 131 and 130 amino acids. Both encoded proteins contain conserved domains of microsomal monooxygenases, such as the heme / steroid-binding domain. Of particular note is the presence or absence of a transmembrane domain between Cytb5v1 and Cytb5v2; Cytb5v1 has a transmembrane domain at positions 107-129, while Cytb5v2 does not. No mutations were found in either Cytb5 (Cytb5v1 or Cytb5v2) sequences, suggesting that sequence mutations may play a limited role in antibiotic resistance. Figure 2 This study presents a phylogenetic analysis of Cyt b5 genes from different insect species. The clustering of Cyt b5 genes within the same order (e.g., Hemiptera) indicates high sequence similarity and close evolutionary relationships. Certain clades (e.g., Bemisia tabaci within Hemiptera, with subtypes v1 and v2 labeled) show gene diversity, suggesting the possible existence of multiple Cyt b5 homologs or subtypes within the same species. The differentiation of Cyt b5 genes among different insect groups indicates that this gene exhibits both conservation and variability during insect evolution.

[0043] The expression levels of Cyt b5v1 and Cyt b5v2 in the resistance of whiteflies were analyzed by real-time quantitative qPCR. Based on the cDNA template of the resistance population of whiteflies, qPCR primers for Cyt b5v1 and Cyt b5v2 genes were synthesized (qCytb5v1-F: TCCCTGACGCTCGTGAAATG as shown in SEQ ID NO.11, qCyt b5v1-R: CACTGATGCTTGTTGTGGCTG as shown in SEQ ID NO.12);

[0044] qCyt b5v2-F: TGCTGGTAAAGATGCCACTGAGAAT (as shown in SEQ ID NO.13), qCyt b5v2-R: AGAGTTGTCGCTGTTGCTAGATGAG (as shown in SEQ ID NO.14), using the whitefly EF1α gene and ribosomal protein RPL29 gene as internal reference genes, were analyzed using a QuantStudio 3 Real-time PCR System. 2 -ΔΔCT The relative gene expression levels were calculated using the method shown in Table 5, and the procedure is shown in Table 6.

[0045] Table 5. Quantitative Fluorescence System

[0046]

[0047] Table 6. Quantitative Fluorescence Procedure

[0048]

[0049] Collect 200 adult whiteflies, flash-freeze in liquid nitrogen, add 1-2 steel balls, 400 μL of cell lysis buffer, and 4 μL of PMSF, and grind in a homogenizer 5-6 times. Centrifuge at 14,000 rpm for 5 min at 4°C, and transfer the supernatant to a new 1.5 ml centrifuge tube. Quantify protein concentration using the BCA protein assay kit (#23229, Thermo Fisher Scientific, Waltham, MA, USA), with a total protein quantification of 20 μg per sample. Load 20 μL of the precast gel from a 4°C freezer, incubate at 160 V for 60 min. After electrophoresis, transfer the membrane to a PDVF membrane and filter paper in a plastic container, add 5 ml of activation buffer, and activate for 30 s. According to the marker size, transfer the target protein into the transfer buffer. The transfer order is sponge, filter paper, gel block, PDVF membrane, filter paper, sponge. Secure the transfer clamps and place the membrane in the transfer tank. Add an appropriate amount of transfer buffer and place an ice pack in the transfer tank for cooling. Maintain a constant current of 400 mA for 30 min. After transfer, wash the sample with 1×TBST three times, 8 min each time. After washing, add 5 ml of skim milk powder and incubate at 4℃ for ≥3 h at 75 rpm. After incubation, wash the sample with 1×TBST five times, 8 min each time. After washing, add 5 ml of skim milk powder and incubate overnight at 4℃ with primary antibody at 75 rpm. The next day, wash the sample with 1×TBST six times, 8 min each time. After washing, add 5 ml of skim milk powder and incubate at 4℃ with secondary antibody at room temperature for 45 min at 75 rpm. After secondary antibody treatment, the sample was washed with 1×TBST 7 times, 8 min each time, and then photographed with chemiluminescence.

[0050] Rabbit anti-Cyt b5 polyclonal antibodies were prepared using synthetic peptides (Jiaxuan Biotechnology) as antigens. The Cyt b5v1 peptide sequence is SDKKALQSKKDKNKAPA as shown in SEQ ID NO.15; the Cyt b5v2 peptide sequence is EEIKQLTDNKRN as shown in SEQ ID NO.16; β-actin was used as an internal reference gene.

[0051] The results are as follows Figure 3 As shown, the expression levels of Cyt b5v1 and Cyt b5v2 genes in the resistant population were significantly higher than those in the susceptible population, both at the mRNA and protein levels, indicating that high expression of these genes is significantly associated with resistance. A represents the mRNA expression levels of Cyt b5v1 and Cyt b5v2 genes, B represents the protein expression levels, and S represents the expression levels of Cyt b5v1 and Cyt b5v2 genes. #1 As a sensitive population, R #1 -R#4 It is a resistant population.

[0052] Immunofluorescence staining was performed on the midgut Cyt b5 (Cyt b5v1 and Cyt b5v2) proteins of the resistant adult whitefly to immunofluorescence. Immunofluorescence was used to detect protein signals in experimental samples. The midgut is the site in the whitefly where the expression level and activity of its detoxification enzyme system are highest. When whiteflies come into contact with pesticides or toxins from the plant itself, the midgut is responsible for breaking down and metabolizing these toxic substances. The Cyt b5 gene mainly functions in the midgut, assisting the P450 enzyme in breaking down pesticides. Results were as follows... Figure 4 As shown, Cyt b5 (Cyt b5v1 and Cyt b5v2) in the resistant population (R #1 The enrichment levels in the ) were significantly higher than those in the sensitive population (S) #1 This further illustrates that high expression of Cyt b5 (Cyt b5v1 and Cyt b5v2) is significantly associated with resistance.

[0053] Example 3: Sensitivity of resistant whiteflies to five neonicotinoid agents after treatment with Cyt b5 (Cyt b5v1 and Cyt b5v2)

[0054] We used double-stranded RNAs of the Cyt b5 (Cyt b5v1 and Cyt b5v2) genes, namely dsCyt b5v1 (its nucleotide sequence is shown in SEQ ID NO.9) and dsCyt b5v2 (its nucleotide sequence is shown in SEQ ID NO.10), to inhibit the expression of Cyt b5v1 and Cyt b5v2 by RNAi, and then used insecticide bioassays to assess their impact on the survival rate of the experimental population.

[0055] The synthesis method of dsCyt b5 (dsCyt b5v1 and dsCyt b5v2) is as follows: insect exogenous dsRNA primers are designed using the Drosophila siRNA binding site website (http: / / www.flyrnai.org / cgi-bin / RNAi_find_primers.pl). Specific interference primers with T7 adapters (RNA polymerase promoter sequences) are designed.

[0056] dsCyt b5v1-F: TAATACGACTCACTATAGGAACAACTCGCCAGCAAGAAT as shown in SEQ ID NO.5; dsCyt b5v1-R: TAATACGACTCACTATAGGATGGCCGACATCTTCAAAAG as shown in SEQ ID NO.6;

[0057] dsCyt b5v2-F: TAATACGACTCACTATAGGGGCCGAAGAAGCTGTTGTAT as shown in SEQ ID NO.7; dsCyt b5v2-R: TAATACGACTCACTATAGGCTTCTTCACCTCCAGGATGC as shown in SEQ ID NO.8;

[0058] Based on the cloning of the whitefly dsCyt b5v1 and dsCyt b5v2 gene bacterial culture DNA, dsRNA was synthesized using the Promega RNA double-strand synthesis kit.

[0059] Table 7. dsRNA synthesis system (10 μg DNA)

[0060]

[0061] Methods for using dsCyt b5 (dsCyt b5v1 and dsCyt b5v2): Synthesized dsCyt b5v1 and dsCyt b5v2 were diluted to 0.8 μg / μl with whitefly feeding solution (30% sucrose water) and fed to adult whiteflies. Live insects were collected after 24 h and 48 h for insecticide bioassays. dsEGFP was used as the experimental control group. Insecticide bioassay method: The sensitivity of the above-mentioned resistant whitefly populations to the above five neonicotinoid agents was determined using a feeding method. Specifically, the above insecticide stock solution was first diluted with 30% sucrose water to prepare 6-7 series concentration gradient solutions. Parafilm was stretched into a thin film and covered one end of a glass bioassay tube. 60-80 μL of the solution was placed on the film, and a second layer of Parafilm was placed on top and flattened. Then, about 20 adult whiteflies were collected using a suction device and placed into a test tube. The other end of the tube was covered with a layer of parafilm and small holes were punched for ventilation. The survival of the test insects was checked after 12 hours.

[0062] Changes in Cyt b5 (Cyt b5v1 and Cyt b5v2) expression levels after dsCyt b5 treatment of adult whiteflies, and sensitivity determination of imidacloprid, thiamethoxam, acetamiprid, acetamiprid, and thiamethoxam after interference. Figure 5As shown, A and C represent the RNAi interference efficiency of Cytb5 (Cytb5v1 and Cytb5v2). After treatment with dsCytb5v1 and dsCytb5v2, the mRNA and protein levels of neonicotinoid-resistant populations of whiteflies decreased, while their sensitivity to neonicotinoids increased. In adult whiteflies, treatment with 0.8 μg / μL dsCytb5v1 for 48 h significantly reduced Cytb5v1 expression by 48% (P=0.0046), and treatment with 0.8 μg / μL dsCytb5v2 for 24 h significantly reduced Cytb5v2 expression by 42% (P<0.0001). B and D represent the two resistant populations of whiteflies (R... #1 R #2 ) and a sensitive population (S #1 The sensitivity of whiteflies to different neonicotinoid agents was determined after the decrease in Cyt b5 (Cyt b5v1 and Cyt b5v2) mRNA levels. When resistant whiteflies were fed with feed solutions containing Cyt b5v1 and Cyt b5v2 (200 mg / L, 500 mg / L, 600 mg / L, and 800 mg / L), the mortality rate of whiteflies to the five neonicotinoid agents was significantly increased by 25-55% compared with the control group. This indicates that dsCyt b5 (dsCyt b5v1 and dsCyt b5v2) significantly reduced the drug resistance level of whiteflies at both low and high concentrations, thereby increasing the sensitivity of whiteflies to insecticides.

[0063] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. The application of dsRNA from the cytochrome b5 gene in pest control, characterized in that, The cytochrome b5 gene is selected from the Cyt b5v1 gene and / or the Cyt b5v2 gene. The accession number of the whitefly genome database for the nucleotide sequence of the Cyt b5v1 gene is Bta11921, and the accession number of the whitefly genome database for the nucleotide sequence of the Cyt b5v2 gene is Bta13632. The pest species is whitefly. The nucleotide sequence of the dsRNA is shown in SEQ ID NO.9 or SEQ ID NO.10; The application involves reducing insecticide resistance, increasing insecticide sensitivity, and / or increasing insecticide efficacy against pests by inhibiting cytochrome b5 gene expression or activity. The insecticide is a neonicotinoid insecticide.

2. The application according to claim 1, characterized in that, The neonicotinoid insecticide is selected from at least one of imidacloprid, thiamethoxam, acetamiprid, acetamiprid, and thiamethoxam.

3. A gene-interfering agent for pest control, characterized in that, Its active ingredient is a double-stranded RNA that targets the cytochrome b5 gene. The double-stranded RNA is synthesized using RNA interference technology. The gene interference agent is used in the form of feeding or spraying. The double-stranded RNA is selected from dsCyt b5v1 and / or dsCyt b5v2, the nucleotide sequence of dsCyt b5v1 is shown in SEQ ID NO.9, and the nucleotide sequence of dsCyt b5v2 is shown in SEQ ID NO.

10.

4. The use of the gene disruptor according to claim 3 in the preparation of products that inhibit or alleviate drug resistance in whiteflies.

5. A method for controlling pests, characterized in that, Feeding or spraying the pest with the gene-interfering agent of claim 3 to inhibit the expression or activity of the cytochrome b5 gene, or spraying a neonicotinoid insecticide, wherein the pest is a whitefly.

6. The method according to claim 5, characterized in that, The concentration of the gene-interfering agent for feeding or spraying is 0.5-2.0 μg / μl, and the insecticide is sprayed 24h and 48h after feeding.

Images