Enhancer of Cas12a fluorescence detection system, preparation of enhancer and application of enhancer in detection kit
By simplifying CRISPR/Cas12a detection with a circular amplicon (Camp) enhancer, the problems of pre-amplification dependence and aerosol contamination are solved, enabling rapid, simple, highly sensitive and specific detection of Klebsiella pneumoniae, suitable for a variety of clinical samples.
Patent Information
- Application Number
- CN202511839857.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-08
- Publication Date
- 2026-02-27
AI Technical Summary
Existing CRISPR/Cas12a detection methods rely on pre-amplification, have low detection efficiency, are prone to aerosol contamination, and have weak fluorescence signals when the target sequence is small, making it difficult to quickly determine the results, which limits their promotion and application in routine clinical testing.
A circular amplicon (Camp) was used as an enhancer for the Cas12a fluorescence detection system. It was formed by mixing equimolar amounts of chain 1 and chain c. It contains a double-stranded region that is completely consistent with the Klebsiella pneumoniae target sequence recognized by the RNP complex in the Cas12a detection system and a polyT single-stranded region that is easily cleaved by the non-specific single-stranded endonuclease of Cas12a. The circular structure was synthesized directly without the need for complex chemical cyclization steps.
It achieves high sensitivity and high specificity detection without the need for pre-amplification, simplifies operation, reduces equipment dependence, avoids aerosol contamination, and can detect 2.3 copies of Klebsiella pneumoniae DNA within 20 minutes. It is suitable for a variety of clinical samples and has strong detection universality.
Smart Images
Figure CN121575128A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical detection technology, specifically relating to an enhancer for a Cas12a fluorescence detection system, its preparation, and its application in a detection kit. Background Technology
[0002] Klebsiella pneumoniae (Kp) is a common opportunistic pathogen found in hospitals, causing a variety of diseases including respiratory infections, urinary tract infections, bacteremia, and wound infections. It is particularly prevalent in patients in intensive care, those with weakened immune systems, and those undergoing invasive procedures. Clinical isolation data show that sputum samples are the primary source of Kp detection, followed by blood and urine. It can also be detected in throat swabs and wound secretions, highlighting its important role in respiratory, urinary tract, bloodstream, and wound infections. Due to its widespread distribution and susceptibility to multidrug resistance, Kp has become one of the key pathogens monitored in clinical and public health settings.
[0003] Currently, several commercially available nucleic acid detection kits for Kp molecular diagnostics have emerged, particularly those based on qPCR. Domestic companies such as Sansure Biotech, DaAn Gene, Geneplus, and Bio-Rad have launched related products, some of which can also detect drug resistance genes (such as KPC) and have obtained NMPA certification for rapid detection of clinical samples such as sputum and throat swabs. Internationally, there are also mature platforms, such as Cepheid GeneXpert Carba-R, which can screen for multiple carbapenemase genes within one hour; the BioFire FilmArray pneumonia panel, which can detect 33 respiratory pathogens simultaneously; and Roche's LightMix kit and Bioneer's real-time PCR reagent, which are also used for rapid Kp detection. These methods offer significant improvements in sensitivity and speed compared to traditional culture and have been applied clinically. However, they generally rely on expensive real-time fluorescence PCR platforms or fully automated molecular diagnostic equipment, making widespread deployment difficult in resource-constrained environments; the detection process still requires specialized laboratory environments; and some products focus on drug resistance gene detection while lacking sufficient species-level specificity identification. Therefore, while these commercial solutions provide clinical references, they still have significant limitations in terms of rapid on-site testing, simplified operation, and widespread accessibility.
[0004] In recent years, the CRISPR / Cas system has been widely explored for the molecular detection of pathogens, including species identification and drug resistance gene detection of Klebsiella pneumoniae, due to its reliance on highly specific gRNA recognition and the parametrogenic activity of Cas nucleases. Most existing reports combine CRISPR with isothermal amplification techniques such as RPA or LAMP, amplifying the signal by triggering Cas12 or Cas13 cleavage reactions in the amplification product. Although these methods exhibit high sensitivity and specificity under laboratory conditions, they generally rely on a pre-amplification step, which introduces several significant limitations: First, pre-amplification significantly prolongs the overall detection time, often requiring 30–60 minutes or more to obtain results; second, amplification and CRISPR detection usually require separate steps or physical isolation, making the process complex and difficult to fully integrate into a single step; third, once the amplification product is opened and transferred, it is highly susceptible to aerosol contamination, leading to false positives and increased biosafety risks; finally, existing studies are mostly based on small-sample laboratory validation, lacking large-scale systematic evaluations on various clinical samples, and its stability and universality in complex matrices such as sputum, blood, and urine have not been fully confirmed. Therefore, although CRISPR detection methods possess extremely high theoretical specificity and application potential, their current heavy reliance on pre-amplification still limits their widespread adoption and application in routine clinical testing. This situation underscores the importance and necessity of developing rapid and specific detection methods that can be implemented directly without pre-amplification. Summary of the Invention
[0005] To address the aforementioned technical problems of existing CRISPR / Cas12a methods for detecting Klebsiella pneumoniae, such as reliance on pre-amplification, low detection efficiency, and susceptibility to aerosol contamination, as well as the weak fluorescence signal and difficulty in rapid result determination when the target sequence is small in conventional Cas12a detection systems, the first objective of this invention is to provide an enhancer for a Cas12a fluorescence detection system. This enhancer is a circular amplicon (Camp), formed by mixing equimolar amounts of circular chain 1 and chain c, containing a double-stranded region that is completely identical to the Klebsiella pneumoniae target sequence recognized by the RNP complex in the Cas12a detection system, and a polyT single-stranded region that is easily cleaved by the trans nonspecific single-stranded endonuclease of Cas12a.
[0006] The second objective of this invention is to provide a method for preparing the reinforcing agent, which involves directly synthesizing cyclic chain 1 and then mixing it with chain c in equimolar amounts. The operation is simple and does not require complex chemical cyclization steps.
[0007] The third objective of this invention is to apply the enhancer to the preparation of Klebsiella pneumoniae detection products and to provide a CRISPR / Cas12a Klebsiella pneumoniae detection kit containing the enhancer, which achieves high sensitivity and high specificity detection without pre-amplification through the cascade signal amplification effect of the enhancer.
[0008] To achieve the above objectives, the present invention adopts the following technical solution: An enhancer for a Cas12a fluorescence detection system, wherein the enhancer for the Cas12a fluorescence detection system is a circular amplicon, named Camp; The circular amplicon is a circular DNA consisting of a double-stranded region and a single-stranded region; The cyclic amplicon is obtained by mixing equimolar amounts of cyclic chain1 and chain c; The chain 1 and chain c complement each other to form the double-chain region; The single-stranded region is a polyT that is easily cleaved by the Cas12a trans-nonspecific single-stranded endonuclease; The double-stranded region is completely identical to the Klebsiella pneumoniae target sequence recognized by the RNP complex in the Cas12a fluorescence detection system.
[0009] Preferably, the nucleotide sequences of chain 1 and chain c are as shown in SEQ ID NO.1-2.
[0010] Preferably, chain 1 and chain c are complementary sequences.
[0011] Preferably, the RNP complex is composed of a specific gRNA and the Cas12a protein.
[0012] Preferably, the specific gRNA is an RNA chain targeting the conserved gene CQ-GRNA1 of Klebsiella pneumoniae, and the nucleotide sequence of the conserved gene CQ-GRNA1 is shown in SEQ ID NO.3.
[0013] A method for preparing an enhancer for a Cas12a fluorescence detection system includes the following steps: S1, direct synthesis of chain 1 with cyclic structure; S2. Mix equimolar amounts of cyclic chain 1 and chain c to form a double-chain region that is complementary to chain 1, thereby obtaining the enhancer of the Cas12a fluorescence detection system.
[0014] Application of an enhancer for a Cas12a fluorescence detection system in the preparation of Klebsiella pneumoniae detection products.
[0015] Preferably, the product is suitable for the detection of clinical samples such as sputum, blood, urine, throat swabs, or wound secretions; The products include testing reagents or kits.
[0016] A CRISPR / Cas12a-based Klebsiella pneumoniae detection kit includes a CRISPR / Cas12a detection system suitable for Klebsiella pneumoniae detection and an enhancer for the Cas12a fluorescence detection system. The CRISPR / Cas12a system includes a specific gRNA for CQ-GRNA1 against Klebsiella pneumoniae, Cas12a protein, ssDNA reporter molecule, 10×NEB 2.1 buffer, and DTT; The nucleotide sequence of the ssDNA reporter molecule is shown in SEQ ID NO.4.
[0017] Preferably, the concentration of the enhancer in the detection system is 300 nM.
[0018] Compared with the prior art, the present invention has at least the following technical effects: This invention provides an enhancer for a Cas12a fluorescence detection system. The enhancer is a circular amplicon (Camp) formed by mixing equimolar amounts of circular chain 1 and chain c. It contains a double-stranded region that is completely identical to the Klebsiella pneumoniae target sequence recognized by the RNP complex in the Cas12a detection system, as well as a polyT single-stranded region that is easily cleaved by the trans-nonspecific single-stranded endonuclease of Cas12a.
[0019] The preparation method of this enhancer is simple: directly synthesize cyclic chain 1 and then mix it with chain c in equimolar amounts. The operation is simple and does not require complicated chemical cyclization steps.
[0020] This enhancer is used in the preparation of Klebsiella pneumoniae detection products, and a CRISPR / Cas12a Klebsiella pneumoniae detection kit containing this enhancer is provided. Through the cascade signal amplification effect of the enhancer, high sensitivity and high specificity detection without pre-amplification can be achieved.
[0021] The enhancer of this Cas12a fluorescence detection system also has the following advantages: 1) Easy to operate: No complicated temperature cycling equipment (such as PCR instrument) is required. Only a fluorescence microplate reader is needed to complete the detection, reducing equipment dependence.
[0022] 2) No risk of aerosol contamination: Eliminating the need for nucleic acid pre-amplification avoids aerosol contamination caused by the transfer of amplification products after opening the container, reducing false positive results and improving biosafety. Existing high-sensitivity nucleic acid detection methods are all based on nucleic acid amplification principles (such as PCR methods). Long-term, large-scale amplification of the target sequence inevitably leads to aerosol contamination of the target fragment in the experimental environment, resulting in false positive results in subsequent nucleic acid detection. This method achieves high-sensitivity target sequence detection by pre-adding a "locked" target sequence to the reaction system, avoiding the pre-amplification step.
[0023] 3) High detection sensitivity: 2.3 copies of Klebsiella pneumoniae DNA can be detected after 20 minutes of reaction, achieving high sensitivity detection in a short time.
[0024] 4) High specificity: Target sequences for gRNA and enhancers are designed to target conserved genes in Klebsiella pneumoniae, screening for highly conserved gene sequences within the species. Primers designed for these conserved regions cover the vast majority of clinical strains, ensuring universality and high detection rate, while avoiding cross-reactivity with other species and exhibiting excellent specificity.
[0025] 5) High universality: Highly conserved gene sequences within the Klebsiella pneumoniae species are screened through whole-genome sequence analysis, ensuring coverage of the vast majority of clinical strains, resulting in high universality and detection rate. Attached Figure Description
[0026] Figure 1 This is a schematic diagram of the cascade reaction principle of the Cas12a fluorescence detection system in this application. Figure 2 A schematic diagram illustrating the effectiveness of the gRNA-Cas12a complex in recognizing Klebsiella pneumoniae target sequences; Figure 3 Schematic diagram of the enhancement effect of different concentrations of Camp on the Cas12a fluorescence detection system; Figure 4 This is a sensitivity verification curve for the kit's detection method against Klebsiella pneumoniae. Figure 5 This is a schematic diagram illustrating the validation results of the detection method's specificity against Klebsiella pneumoniae. Detailed Implementation
[0027] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the present invention will be briefly introduced below in conjunction with the accompanying drawings and descriptions of the embodiments or the prior art. Obviously, the following description of the structure of the accompanying drawings is only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort. It should be noted that the description of these embodiments is for the purpose of helping to understand the present invention, but does not constitute a limitation of the present invention.
[0028] One specific embodiment of the present invention: The basic principle of this application's technical solution is as follows: gRNA is an oligonucleotide chain specifically designed according to the target sequence and capable of binding complementary to the target sequence. When gRNA forms an RNP complex with Cas12a, Cas12a can specifically bind to the target sequence under the guidance of gRNA. Simultaneously, the trans-nonspecific single-stranded endonuclease activity of Cas12a is activated, and it begins to cleave the reporter in the reaction system. The reporter is a short single-stranded DNA (ssDNA) modified with both a fluorescent group and a quencher group. When the reporter is cleaved, the fluorescent group moves away from the quencher group, thereby releasing a fluorescent signal. Although the activated Cas12a can theoretically continuously trans-cleave the reporter in the system, causing the fluorescent signal to accumulate and amplify, in reality, when the target sequence is too small, the amount of activated Cas12a is very small, making it difficult to generate a sufficient fluorescent signal for a positive result in a short time.
[0029] Therefore, an enhancer for the Cas12a fluorescence detection system, a circular amplicon (Camp), was designed for Klebsiella pneumoniae. Essentially, a Camp is a circular DNA sequence consisting of a double-stranded region and a single-stranded region. Its double-stranded region is identical to the target sequence recognized by the RNP in the Cas12a system, while the single-stranded region is a polyT that is easily trans-cleaved by Cas12a. Due to the difference in topology, although the Camp possesses the target sequence recognized by the RNP, the circular Camp cannot directly activate the RNP. However, when there is a small amount of linear target sequence in the reaction system, a small amount of RNP can be activated, thereby simultaneously trans-cleaving the reporter and Camp in the system, generating a small amount of fluorescent signal and a small amount of linearized Camp (L-camp). At this point, these L-camps can be recognized by the RNP, further activating more RNPs and cleaving more reporters and Camps, thus creating a cascade reaction and achieving signal amplification.
[0030] like Figure 1 The diagram shown is a schematic diagram of the cascade reaction principle of the Cas12a fluorescence detection system in this application.
[0031] Example 1: Preparation of enhancer for Cas12a fluorescence detection system 1. Shanghai Sangon Biotech was commissioned to directly synthesize chain 1, a cyclic structure, with the following nucleotide sequence: SEQ ID NO.1: TTTCGCCGGCCAACTGCGCCGCCGCG.
[0032] 2. Synthesize chain c, whose nucleotide sequence is: SEQ ID NO.2: CGCGGCGGCGCAGTTGGCCGGCG.
[0033] 3. Mix equimolar amounts of cyclic chain 1 and chain c to form a double-stranded region that is complementary to chain 1, thus obtaining a cyclic amplicon (Camp), which is the enhancer for the Cas12a fluorescence detection system.
[0034] Example 2: Configuration of a CRISPR / Cas12a-based Klebsiella pneumoniae detection kit The kit contains the following components: 1. CRISPR / Cas12a detection system: 6 pmol Cas12a protein, 6 pmol CQ-GRNA1, 20 pmol ssDNA reporter molecule, 10 μL 10×NEB 2.1 buffer, 1 μmol DTT; CQ-GRNA1, nucleotide sequence: SEQ ID NO.3: UAAUUUCUACUAAGUGUAGAUGCCGGCCAACUGCGCCGCCCG; ssDNA reporter molecule, nucleotide sequence: SEQ ID NO.4: Texas Red-CTCTCATTTTTTTTTTAGAGAG-BHQ2; 2. Enhancer for the Cas12a fluorescence detection system: 300 nM circular amplicon (Camp); 3. Sterile ddH2O.
[0035] Example 3: Detection method for Klebsiella pneumoniae 1. Sample processing: Collect clinical sputum, blood or bronchoalveolar lavage fluid samples and extract DNA from the samples.
[0036] 2. Reaction system configuration: 2.1 gRNA-Cas12a template recognition system: Add 10 μL of 10×NEB 2.1 buffer, 6 pmol of Cas12a protein, 6 pmol of gRNA, 20 pmol of reporter, 1 μmol of DTT, and ddH2O targeting Klebsiella pneumoniae DNA (2.3+E8 copies / μL) to a final volume of 100 μL. Incubate at room temperature for 30 min.
[0037] 2.2 Camp-enhanced fluorescence-Cas12a reaction system: 10 μL of 10×NEB 2.1 buffer, 6 pmol of Cas12a protein, 6 pmol of gRNA, 20 pmol of reporter, 1 μmol of DTT, 0–500 nM Camp, and ddH2O targeting Klebsiella pneumoniae DNA (2.3+E8 copies / μL) were added to a final volume of 100 μL. After thorough mixing, the reaction mixture was incubated at room temperature for 30 minutes. Subsequently, the fluorescence signal was read using an EnSight multitemplate reader.
[0038] 3. Detection reaction: The reaction mixture was incubated at room temperature for 30 minutes, during which the fluorescence signal was read every 10 minutes using an EnSight multi-template reader (PerkinElmer, Massachusetts, USA). Result interpretation: If the fluorescence signal was significantly higher than that of the negative control group, it was considered positive for Klebsiella pneumoniae; if there was no significant fluorescence signal, it was considered negative.
[0039] like Figure 2 The diagram shown illustrates the effectiveness of the gRNA-Cas12a complex in recognizing the target sequence of Klebsiella pneumoniae.
[0040] Results combined Figure 2 It was found that the gRNA-Cas12a complex in the reaction group recognized the target sequence and was activated, trans-cleaving the reporter to generate a fluorescent signal. Based on this, a Camp-enhanced Cas12a reaction was subsequently established.
[0041] Figure 3 This is a schematic diagram showing the enhancement effect of different concentrations of Camp on the Cas12a fluorescence detection system.
[0042] Results combined Figure 3It can be seen that at the lowest Camp concentration (100 nM), the fluorescence signal is significantly higher than that of the ordinary Cas12a reaction. Furthermore, the fluorescence value gradually increases with increasing Camp concentration. Within the Camp concentration range of 100-300 nM, the increase in fluorescence signal is approximately linear. When the Camp concentration exceeds 300 nM, due to the saturation of Cas12a transcleavage ability in the reaction, although increasing the Camp concentration can still improve the fluorescence signal to some extent, the increase is diminished.
[0043] Therefore, Camp significantly improves the reaction efficiency of Klebsiella pneumoniae CRISPR / Cas12a. Considering the cost and efficiency of subsequent reactions, 300 nM Camp was selected as the optimal reaction condition for subsequent reactions.
[0044] Example 4: Sensitivity and Specificity Verification 1. Sensitivity verification: Klebsiella pneumoniae DNA was serially diluted 10-fold (2.3~2.3×10⁻⁶). 8 (copies / μL), fluorescence values were measured every 10 minutes, and the detection was performed according to the method in Example 3.
[0045] like Figure 4 The figure shows the sensitivity verification curve of the kit's detection method against Klebsiella pneumoniae.
[0046] Results combined Figure 4 It can be seen that 2.3 copies of Klebsiella pneumoniae DNA can be detected after 20 minutes of reaction, indicating that this kit can detect gas-producing Klebsiella pneumoniae with high sensitivity in a short time.
[0047] 2. Specificity verification: DNA samples from several common pathogens were used to test the specificity of this method for Klebsiella pneumoniae. DNA samples from Enterobacter cloacae, Escherichia coli, Citrobacter freundii, Serratia marcescens, Proteus mirabilis, and Raoultella plantarum were used as controls and detected according to the method in Example 3.
[0048] like Figure 5 The diagram shown is a schematic representation of the specificity verification results of the detection method for Klebsiella pneumoniae.
[0049] Results combined Figure 5 The results showed that only the Klebsiella pneumoniae sample produced a significant fluorescence signal, while the other control bacteria and negative control did not produce a significant fluorescence signal, indicating that the kit has excellent specificity.
[0050] Example 5: Clinical Sample Testing 347 clinical lower respiratory tract samples (sputum, bronchoalveolar lavage fluid) were selected and tested using the kit of this invention and Roche LightMix.® A comparative detection was performed using a Modular Klebsiella pneumoniae qPCR kit.
[0051]
[0052] Remark: a Sensitivity (true positive rate): The proportion of qPCR positive samples that are correctly detected by RPA+CRISPR / Cas12a.
[0053] b Specificity (true negative rate): The proportion of qPCR negative samples that are correctly identified as negative by RPA+CRISPR / Cas12a.
[0054] c Accuracy: The proportion of all samples for which the test results are consistent with qPCR.
[0055] d Kappa value (Cohen's Kappa coefficient): A metric for measuring the consistency of results between two methods, after adjusting for the influence of random consistency.
[0056] The results in the table above show that this kit has a sensitivity of 100%, a specificity of 95.0%, and an accuracy of 97.3% in sputum samples; and a sensitivity of 100%, a specificity of 94.4%, and an accuracy of 96.8% in bronchoalveolar lavage fluid samples. The Cohen's kappa values of the qPCR method are 0.945 and 0.935, respectively, showing near-perfect consistency, indicating that this kit is suitable for stable detection of clinical samples.
[0057] The enhancer of the Cas12a fluorescence detection system of the present invention can be prepared in batches. The Klebsiella pneumoniae detection kit containing the enhancer is easy to operate, highly sensitive and specific. It can be used for rapid detection of Klebsiella pneumoniae in clinical medical institutions, and can also be used for pathogen monitoring in the field of public health, and has significant industrial application value.
[0058] Finally, it should be noted that the above description is merely a preferred embodiment of the present invention and is not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
Claims
1. An enhancer for a Cas12a fluorescence detection system, characterized in that, The enhancer of the Cas12a fluorescence detection system is a circular amplicon, named Camp; The circular amplicon is a circular DNA consisting of a double-stranded region and a single-stranded region; The cyclic amplicon is obtained by mixing equimolar amounts of cyclic chain1 and chain c; The chain 1 and chain c complement each other to form the double-chain region; The single-stranded region is a polyT that is easily cleaved by the Cas12a trans-nonspecific single-stranded endonuclease; The double-stranded region is completely identical to the Klebsiella pneumoniae target sequence recognized by the RNP complex in the Cas12a fluorescence detection system.
2. The enhancer for a Cas12a fluorescence detection system according to claim 1, characterized in that, The nucleotide sequences of chain1 and chain c are shown in SEQ ID NO.1-2.
3. The enhancer for a Cas12a fluorescence detection system according to claim 2, characterized in that, The chain1 and chain c are complementary sequences.
4. The enhancer for a Cas12a fluorescence detection system according to claim 1, characterized in that, The RNP complex is composed of a specific gRNA and the Cas12a protein.
5. The enhancer for a Cas12a fluorescence detection system according to claim 4, characterized in that, The specific gRNA is an RNA chain targeting the conserved gene CQ-GRNA1 of Klebsiella pneumoniae, and the nucleotide sequence of the conserved gene CQ-GRNA1 is shown in SEQ ID NO.
3.
6. A method for preparing an enhancer for the Cas12a fluorescence detection system as described in any one of claims 1 to 5, characterized in that, Includes the following steps: S1, direct synthesis of chain 1 with cyclic structure; S2. Mix equimolar amounts of cyclic chain 1 and chain c to form a double-chain region that is complementary to chain 1, thereby obtaining the enhancer of the Cas12a fluorescence detection system.
7. The use of an enhancer for the Cas12a fluorescence detection system as described in any one of claims 1 to 5 in the preparation of Klebsiella pneumoniae detection products.
8. The application of the enhancer of the Cas12a fluorescence detection system according to claim 7 in the preparation of Klebsiella pneumoniae detection products, characterized in that, The product is suitable for the detection of clinical samples such as sputum, blood, urine, throat swabs, or wound secretions; The products include testing reagents or kits.
9. A CRISPR / Cas12a-based Klebsiella pneumoniae detection kit, characterized in that, Includes a CRISPR / Cas12a detection system suitable for the detection of Klebsiella pneumoniae and an enhancer for the Cas12a fluorescence detection system as described in any one of claims 5; The CRISPR / Cas12a system includes a specific gRNA for CQ-GRNA1 against Klebsiella pneumoniae, Cas12a protein, ssDNA reporter molecule, 10×NEB 2.1 buffer, and DTT; The nucleotide sequence of the ssDNA reporter molecule is shown in SEQ ID NO.
4.
10. A CRISPR / Cas12a-based Klebsiella pneumoniae detection kit according to claim 9, characterized in that, The concentration of the enhancer in the detection system is 300 nM.