Concanavalin a-like lectin / glucanase domain protein fvclg and its application in improving the production of fusarium venenatum mycelial proteins

Abstract

The application discloses a concanavalin A-like lectin / dextranase domain protein FvCLG and application thereof in improving production of fusarium venenatum mycelial protein, and belongs to the field of genetic engineering technology and food biotechnology. Fv CLG Compared with the wild type, the fusarium venenatum FG31 lacks a gene on the genome, does not produce ethanol on a fermenter for 72 h, has a significantly improved protein content (up to 61.34 %), and is 22.41 % higher than the wild type strain. Meanwhile, the sugar consumption of the FG31 strain during fermentation is significantly reduced, the glucose-to-biomass conversion rate and the glucose-to-protein conversion rate are respectively increased by 44.02 % and 76.41 %, the substrate utilization rate is significantly improved, the carbon source loss is reduced, and the production cost is reduced. The fusarium venenatum can be further used for gene engineering modification work, and a fusarium venenatum strain with high protein content is cultivated.

Description

Technical Field

[0001] This invention relates to the concanavalin A-like lectin / glucanase domain protein FvCLG and its application in increasing the yield of Fusarium venetum mycelial protein, belonging to the fields of genetic engineering and food biotechnology. Background Technology

[0002] The growing demand for sustainable protein sources has driven significant innovation in the field of alternative proteins, with fermentation-derived protein products emerging as one of the most promising areas. Fungal proteins, particularly those derived from Fusarium venetum (…), are particularly valuable. Fusarium venenatum Fungal protein, derived from *Fusarium venetum*, is a promising source. Commercialized decades ago, this product utilizes fungal biomass fermentation to produce nutrient-rich, meat-like textures. These components not only possess well-established safety profiles but also offer superior environmental sustainability compared to livestock farming. Despite these advancements, *Fusarium venetum*-based products still face key challenges, including limited protein content and substrate conversion rates.

[0003] Currently, methods to improve the protein content and substrate conversion rate of *Fusarium vesicatoria* include genetic engineering and fermentation condition optimization. Previous studies have reported that knocking out chitin synthase, a key regulator of chitin, an important cell wall component, using CRISPR technology can reduce chitin content and, by regulating carbon metabolism flux, direct more substrate carbon towards protein synthesis, thereby increasing protein content and substrate conversion rate. Furthermore, knocking out important regulatory genes controlling conidia formation... FvFLBD and FvUBQ14 This technology can promote the accumulation of biomass in *Fusarium venetum* and enhance its nutritional value. Therefore, theoretically, more regulatory factors related to the cell wall and hyphal morphology of *Fusarium venetum* can be explored to enhance fungal protein production and reduce carbon source waste. Currently, the conversion efficiency of glucose to cell or protein is relatively low, resulting in high production costs for *Fusarium venetum*. Furthermore, the large amount of substrate consumed during fermentation puts significant pressure on the environment. Although existing technologies and literature report metabolic modifications at certain sites in *Fusarium venetum*, which have to some extent increased cell protein content, a significant increase in substrate-to-cell or substrate-to-protein conversion rates has not yet been achieved. Improving protein conversion rates will help reduce substrate consumption and production costs, thereby improving production efficiency and economic benefits.

[0004] Therefore, there is an urgent need to provide a new strain with high protein content and high substrate conversion rate. Summary of the Invention

[0005] To address the shortcomings of the prior art, this invention provides the concanavalin A-like lectin / glucanase domain protein FvCLG and its application in increasing the mycelial protein yield of *Fusarium venetum*. The *Fusarium venetum* FG31 of this invention is obtained by knocking out the wild-type... Fusarium venenatum Genes within the bacteria encoding the concanavalin A-like lectin / glucanase domain. FvCLG (FVRRES_03168) was obtained. This bacterium not only has a high protein content, but also can improve the conversion rate of the substrate glucose.

[0006] The first technical solution provided by this invention is a strain of *Fusarium veitchii*, which is named *Fusarium veitchii* (Venetian Fusarium). Fusarium venenatum FG31 was deposited on October 16, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 42282. The address of the depository is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Beichen West Road, Chaoyang District, Beijing.

[0007] The second technical solution provided by this invention is a method for constructing the *Fusarium venetum* FG31 described in the first technical solution. This method involves knocking out the gene encoding the concanavalin A-like lectin / glucanase domain protein in *Fusarium venetum* using CRISPR / Cas9 scarless knockout technology. FvCLG (FVRRES_03168) was obtained.

[0008] In some implementations, encoding FvCLG The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0009] In some embodiments, the *Fusarium venetum* is *Fusarium venetum* (…). Fusarium venenatum )A3 / 5.

[0010] The third technical solution provided by the present invention is a product containing the Venetian Fusarium FG31 described in the first technical solution.

[0011] The fourth technical solution provided by this invention is a method for increasing the protein content of Fusarium venetum, wherein the method involves knocking out the concanavalin A-like lectin / glucanase domain protein FvCLG in Fusarium venetum, encoding... FvCLG The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0012] In some embodiments, the *Fusarium venetum* is *Fusarium venetum* (…). Fusarium venenatum )A3 / 5.

[0013] The fifth technical solution provided by this invention is a method for improving the substrate conversion rate of *Fusarium venetum*, wherein the method involves knocking out the concanavalin A-like lectin / glucanase domain protein FvCLG in *Fusarium venetum*, encoding... FvCLG The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0014] In some embodiments, the *Fusarium venetum* is *Fusarium venetum* (…). Fusarium venenatum )A3 / 5.

[0015] In some embodiments, the substrate conversion rate includes glucose to cell conversion rate and glucose to protein conversion rate.

[0016] The sixth technical solution provided by the present invention is a method for preparing mycelial protein, which involves culturing Fusarium vesicatoria FG31 as described in the first technical solution.

[0017] In some implementations, the following steps are included:

[0018] 1) Knocking out the gene FVRRES_03168 encoding the concanavalin A-like lectin / glucanase domain protein in *Fusarium vesicae* yielded... FvCLG A novel gene-knockout Fusarium vesicatoria FG31;

[0019] 2) The new *Fusarium vesicatoria* FG31 was inoculated into a liquid culture medium and cultured. The cells were harvested to obtain mycelial protein.

[0020] Preferably, the method for obtaining the new *Fusarium vesicatoria* FG31 includes the following steps:

[0021] Using the sgRNA fragment shown in SEQ ID NO.2 as a template and a set of primer pairs shown in SEQ ID NO.3 and 4 as primers, a 20 bp guide sequence sgRNA fragment was amplified by PCR; the fused fragment was then inserted into the backbone vector pFC322 using homologous recombinase. pFC332 obtained on Cas9 5S rRNA::sgRNA gene editing expression vector; pFC332 The 5SrRNA::sgRNA editing expression vector was transformed into *Fusarium vesicae* via protoplast transformation to obtain the novel *Fusarium vesicae* FG31.

[0022] The gene editing random repair method used in this invention is not limited to this method. If the knockout of the concanavalin A-like lectin / glucanase domain protein FvCLG (FVRRES_03168) obtained by homologous recombination, gene editing homologous recombination, or other methods has the same effect, it is within the scope of protection of this application.

[0023] Preferably, in step 2), the culture is carried out at a temperature of 26°C. Incubate at 30℃ with shaking for 3 days 5 days. Typically, after 72-96 hours of fermentation, the liquid culture mycelium is filtered and washed, and then freeze-dried to determine the protein content.

[0024] The seventh technical solution provided by the present invention is the application of the concanavalin A-like lectin / glucanase domain protein FvCLG in improving the mycelial protein yield of Fusarium venetum and / or improving the substrate conversion rate. The nucleotide sequence encoding the FvCLG gene is shown in SEQ ID NO.1.

[0025] The eighth technical solution provided by the present invention is the application of the Venetian Fusarium FG31 described in the first technical solution or the product described in the third technical solution in the preparation of mycelial protein or products containing mycelial protein.

[0026] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0027] This invention provides a gene knockout mutant of *Fusarium vesicae* (*Fusarium vesicae* FG31). Through bioinformatics analysis, this invention identified a key gene involved in the cell wall construction of *Fusarium vesicae*: a gene encoding a concanavalin A-like lectin / glucanase domain protein. FvCLG After knocking out this gene, it was found that Δ FvCLG The chitin content of the strain decreased by 33.4%, and the total glucan content decreased by 22.3%. In a 5-liter fermenter, the engineered strain FG31 achieved the highest protein content reported to date (61.34%), a 22.4% increase compared to the wild-type strain, while significantly inhibiting ethanol production. Furthermore, Δ FvCLG The strain's glucose-to-cell conversion rate and glucose-to-protein conversion rate were increased by 44% and 76%, respectively. Transcriptome analysis showed that Δ FvCLG Genes involved in nitrogen metabolism pathways related to the synthesis of various amino acids were generally upregulated in the strain, while genes involved in glycolysis pathways related to ethanol synthesis were downregulated. This invention opens up a novel pathway for increasing fungal protein content and improving substrate conversion efficiency.

[0028] Preservation of biological materials

[0029] The Venetian Fusarium provided by this invention ( Fusarium venenatumFG31 was deposited on October 16, 2025, at the China General Microbiological Culture Collection Center (CGMCC), Institute of Microbiology, Chinese Academy of Sciences, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 42282 and classified as follows: Fusarium venenatum FG31. Attached Figure Description

[0030] Figure 1 for FvCLG Identification and sequence similarity analysis; A is FvCLG A schematic diagram of the protein domains of a gene; B represents... FvCLG Homology analysis of the gene with CLG protein sequences from 14 other filamentous fungi.

[0031] Figure 2 For CRISPR / Cas9 based FvCLG Schematic diagram of gene knockout and analysis of protein content and cell wall components; A is a schematic diagram of the CRISPR gene knockout strategy; B is a schematic diagram of the CRISPR gene knockout strategy. FvCLG Verification of gene knockout nucleic acid gel PCR results; C is FvCLG The gene knockout was validated using Sanger sequencing results; D represents the mycelial protein content of wild-type and FG31 mycelia at a 5-liter bioreactor level; E represents the chitin and total glucan content of wild-type and FG31 mycelia at a 5-liter bioreactor level. U: Untreated mycelial protein sample, RR: RNA-removed mycelial protein sample (68℃, 15 min), S: Sterilized mycelial protein sample (121℃, 20 min).

[0032] Figure 3 For the starting strains WT and Δ FvCLG Environmental stress analysis of strain FG31.

[0033] Figure 4 To observe the starting strains WT and Δ under a microscope FvCLG Hyphae morphology of strain FG31.

[0034] Figure 5 The biomass accumulation curve, ethanol accumulation curve, cell protein content, and substrate-to-cell and substrate-to-protein conversion rates were obtained at the 5 L fermenter level.

[0035] Figure 6This study elucidates the mechanisms of high-yield proteins based on transcriptomics analysis. A shows the expression changes of related proteins in the carbon and nitrogen metabolism pathway; B is a heatmap of differential expression of genes related to cell wall construction; C is a heatmap of differential expression of key genes in the MAPK pathway. The enzymes are numbered as follows: ① Hexokinase; ② Phosphoglucose isomerase; ③ 6-phosphogluconate dehydratase; ④ Transaminase; ⑤ Thiamine pyrophosphate binding protein; ⑥ Ketoacid reductase; ⑦ Citrate synthase; ⑧ Citrate synthase; ⑨ Uncharacterized proteins involved in glutamate biosynthesis; ⑩ Glycoside hydrolases. Pyruvate decarboxylase; Pyruvate decarboxylase; alcohol dehydrogenase; Aldehyde dehydrogenase.

[0036] Figure 7 For Δ FvCLG Differences in the effects on gene expression changes of other concanavalin A-like lectin / glucanase domain proteins in Fusarium venetum. Detailed Implementation

[0037] The preferred embodiments of the present invention are described below. It should be understood that the embodiments are for better explanation of the present invention and are not intended to limit the present invention.

[0038] The culture media and reagents used in the following embodiments of the present invention are as follows:

[0039] Potato glucose solid medium (PDA): 20 g / L glucose, 20 g / L-30 g / L potato extract, 2 g / L potassium nitrate, 1 g / L sodium dihydrogen phosphate, 0.3 g / L magnesium sulfate heptahydrate, 20 g / L agar powder;

[0040] GYA solid medium: 10 g / L yeast extract, 20 g / L glucose, 20 g / L agar;

[0041] YEPD liquid medium: 3 g / L yeast extract, 10 g / L peptone, 20 g / L glucose;

[0042] ISM culture medium for upper tank: 60 g / L glucose, 0.9 g / L potassium sulfate, 0.77 g / L phosphate, 0.3 g / L magnesium sulfate heptahydrate, 20 mg / L zinc sulfate, 0.02 g / L manganese sulfate, 0.0025 g / L copper sulfate, 0.0025 g / L ferrous sulfate heptahydrate, 0.000025 g / L biotin, 0.2 g / L calcium acetate;

[0043] RM: 1 g / L yeast extract, 1 g / L peptone, 274 g / L sucrose, 12 g / L agar;

[0044] SMC solution: 1.2 M sorbitol, 50 mM CaCl2, 20 mM Mes / NaOH;

[0045] STC solution: 0.8 M sorbitol, 50 mM CaCl2, 50 mM Tris–HCl;

[0046] SPTC solution: 40% PEG6000 dissolved in STC;

[0047] Mycelial lysis buffer: 10 mg / mL Yatalase dissolved in SMC.

[0048] Example 1 explores technologies that play an important role in cell wall construction and modification. FvCLG Gene

[0049] Using from the NCBI database FvCLG The amino acid sequences encoding the proteins were subjected to a BLAST search, and the 14 most similar protein sequences were selected from different filamentous fungal strains. Multiple sequence alignment was performed using the online tool ClustalW (https: / / www.genome.jp / tools-bin / clustalw), and the secondary structures of all sequences were predicted using the NCBI CD-Search tool (https: / / www.ncbi.nlm.nih.gov / Structure / cdd / wrpsb.cgi).

[0050] For those from Venetian Fusarium FvCLG Protein domain analysis and homology analysis were performed on the gene-encoded concanavalin A-like lectin / glucanase domain protein. The results showed ( Figure 1 (A~B) FvCLG Composed of three exons and two introns, with an open reading frame of 1583 base pairs, it encodes a protein containing a gum arabic or chitin-like 1-binding domain (ChtBD1) and a glycosylphosphatidylinositol-glucan transferase (LamG) domain. Furthermore, FvCLG The gene exhibits high sequence conservation within the Fusarium genus, although its sequence similarity to other filamentous fungi is relatively low. These findings suggest... FvCLG It may play a role in cell wall modification / construction and carbohydrate metabolism in Fusarium vesicatoria.

[0051] Example 2: Vector construction and preparation of Fusarium venetum strain FG31

[0052] Fusarium viniferum FG31 is a wild-type Fusarium viniferum ( Fusarium venenatumA3 / 5 was the starting strain, and a gene knockout mutant was created using CRISPR / Cas9 gene editing technology. Online tools (http: / / crispor.tefor.net / ) were used to predict in situ proximity motifs for gene editing site localization. The 5S rRNA promoter, proximity motifs, and sgRNA scaffold were inserted into plasmid pUC57 to generate pTarget-CLG. For knockout... FvCLG Using two pairs of primers, CLGup-F and CLGup-R, and CLGdown-F and CLGdown-R, from Fusarium venenatum Amplification in the genome FvCLG Upstream and downstream homologous arms. A one-step cloning method was used to... FvCLG The upstream and downstream homologous arm fragments were ligated into the linear pUC57 vector to obtain a recombinant plasmid. During transformation, linear sgRNA and the donor DNA target fragment were amplified from the corresponding plasmid by PCR.

[0053] PEG-mediated protoplast transformation to knock out the target gene: Mycelia grown on PDA plates for 5 days were washed with approximately 2 mL of sterile water to obtain a conidial suspension. Conidia were cultured in 50 mL YEPD medium for 24 h. Mycelia were harvested after filtration through a Miracloth filter and washing with sterile water. 20 mL of mycelial lysis buffer was added, and the mixture was incubated at 30°C and 100 rpm for 1–3 h. 10 mL of STC solution was added, and the mixture was gently mixed. Protoplasts were collected through a Miracloth filter and washed once more with STC. The mixture was centrifuged at 10°C, 2,000 × g for 10 min. After washing with pre-cooled STC, the protoplasts were resuspended in STC and used directly for transformation. 10 μg of linear DNA and at least 100 μL of at least 10... 8 A number of protoplasts were prepared using 25 μL of SPTC solution, and the mixture was incubated on ice for 40 minutes. 1 mL of SPTC solution was added and incubated at room temperature for 30 minutes, then the protoplast mixture was diluted with 2 mL of STC. The mixture was then combined with RM medium preheated to approximately 42°C and poured into petri dishes. After overnight incubation, the mixture was covered with selective medium containing 100 μg / mL hygromycin. Fusarium mycelia were observed after 2-3 days of incubation at 28°C. Homokine was purified by transplating 1-2 times and colony PCR verification was performed.

[0054] Download from the NCBI website (https: / / www.ncbi.nlm.nih.gov / ). FvCLGThe gene sequence of gene (FVRRES_03168) was obtained by extracting Fusarium genome using the Ezup column-based fungal genomic DNA extraction kit. Genomic DNA amplification and sequencing analysis were performed on wild-type and mutant samples. Compared to the wild-type, the FG31 mutant gene sequence had a 1583 bp deletion at the target site. Figure 2 (A~C)

[0055] FvCLG Gene sequence: SEQ ID NO.1

[0056]

[0057] gRNA scaffold sequence: SEQ ID NO.2

[0058] acatacgaccaaaggtagtggaaaatacgggatcccgtccgctctcccatagtcaagccactaaccggcggattagtagttgggtcggtgacgaccagcgaatccccgctgttgtatgttgagttactggtacaacaacggttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttt。

[0059] The relevant primer sequences are as follows:

[0060] 5s-F: 5’-acatacgaccaaaggtagtg-3’ (SEQ ID NO.3);

[0061] gRNA-R: 5’-aaaaaaagcaccgactcggt-3’ (SEQ ID NO.4);

[0062] CLGup-F: 5’-tcgcgaatgcgtcgagatgttgatatggaggaaatcaggg -3’ (SEQ IDNO.5);

[0063] CLGup-R: 5’-ctcagacgaatatgttgacaggtatgctgatgtagttcg-3’ (SEQ ID NO.6);

[0064] CLGdown-F: 5’-actacatcagcatacctgtcaacatattcgtctgagtgttcc-3’ (SEQ IDNO.7);

[0065] CLGdown-R: 5’-tcggtcccggcatccgataagaaaagatgcccgctatag-3’ (SEQ IDNO.8);

[0066] FvCLGYZ-F: 5’-gttgatatggaggaaatcaggg-3’ (SEQ ID NO.9);

[0067] FvCLGYZ-R: 5'-aagaaaagatgcccgctatag-3' (SEQ ID NO. 10).

[0068] Example 3 Environmental stress sensitivity analysis

[0069] Add 10 μL (concentration of 1 × 10⁻⁶) to the center of the GYA and ISM plates. 6 Spore suspensions of either FG31 strain (spores / mL) or wild-type (WT) strain were prepared on plates containing pressure inducers: 1.5 M sorbitol (sorb), 0.8 M sodium chloride, 25 μL / mL calcium fluorescent white (CFW), or 250 μg / mL Congo red (CR). After incubating the plates at 30°C for 3 days, the colony diameter (cm) was recorded. Error bars represent the standard deviation between three replicates.

[0070] like Figure 3 As shown, when cultured on high-nutrient medium (GYA), high salt conditions and the presence of Congo red significantly limited the growth of strain FG31, resulting in a colony diameter that was significantly smaller than that of the wild-type strain. However, under cell wall stress conditions, strain FG31 grew significantly faster than the wild-type strain.

[0071] When cultured on ISM plates (simulating fermenter conditions), under most pressure conditions, there was no significant difference in colony diameter between the wild-type strain and the FG31 strain, while FG31 grew faster under Congo red conditions. The results indicate that... FvCLG The absence of Fusarium venenatum While not fatal, it plays a crucial role in cell wall construction and modification. Furthermore, the modified strain FG31 possesses self-regulation and adaptability, enabling it to grow normally under varying nutritional conditions and external stressors.

[0072] Example 4: Observation of hyphal microstructure

[0073] The microstructure of the mycelium of strains WT and FG31 was observed. Figure 4 The hyphae of *Fusarium venetum* consist of continuously distributed proteins and punctate lipid droplets. In contrast, the hyphae of strain FG31 exhibit circular regions unstained by Nile Blue and Nile Red, likely due to structural changes that create large vacuolar structures. Vacuoles are dynamic organelles that exhibit different morphologies during the growth of filamentous fungi, typically appearing as large spherical structures. Furthermore, confocal scanning microscopy (CLSM) and field emission scanning electron microscopy (FESEM) images show fewer septate structures in the FG31 hyphae. Compared to the coarse hyphae of *WT*, the hyphae of FG31 are smoother.

[0074] Example 5: Fermentation Production of Microbial Protein

[0075] The production of cell protein by fermentation using the *Fusarium venetum* strain FG31 prepared in Example 1 includes the following steps:

[0076] 5.1 Cultivation Method: The seed culture medium was YEPD liquid, and the upper culture medium was ISM liquid. *Fusarium venetum* spore suspension (1×10⁻⁶) was prepared from PDA plates after 7 days of growth. 6 (Spores / mL). 200 μL of spore suspension was added to a 2 L shake flask containing 500 mL of YEPD liquid medium. Seed culture was prepared by incubation at 30°C and 220 rpm for 48 h. The activated seed culture was then cultured in a sterilized 5-L fermenter in 3.5 L of ISM medium (containing 60 g / L glucose) for 72 h. 5-L fermenter conditions: pH 6.0, temperature 30°C, 100-400 rpm, dissolved oxygen 30%, fermentation was stopped after 72 h.

[0077] 5.2 Determination of mycelial dry weight: Mycelia were obtained by vacuum filtration, rinsed three times with deionized water, freeze-dried, and weighed.

[0078] 5.3 Protein Content Determination: Fresh mycelium after fermentation was divided into three groups: untreated group (U), heat-treated group (RR, 68℃ for 15 min), and autoclaved group (S, 121℃ for 20 min). The protein content of the three groups of mycelium was determined by the Kjeldahl method after freeze-drying. The conversion factor for protein was 6.25. The determination was repeated three times.

[0079] 5.4 Determination of glucose and ethanol content: The residual glucose concentration and ethanol content in the fermentation supernatant were measured using an M-100 biosensor analyzer (Siemens).

[0080] 5.5 Determination of cell wall component content:

[0081] (1) Chitin content determination: 5 mg of lyophilized mycelium was suspended in 1 mL of 6 M HCl and hydrolyzed at 100 °C for 17 hours. After removing HCl under vacuum at 50 °C, the dried sample was resuspended in 1 mL of distilled water and centrifuged to remove insoluble substances. Aliquots (0.1 mL) of the sample were added to 0.1 mL of solution A (1.5 M Na2CO3 dissolved in 4% (v / v) acetylacetone). The mixture was boiled at 100 °C for 20 minutes. Then, 0.7 mL of 95% (v / v) ethanol and 0.1 mL of solution B (1.6 g of p-dimethylaminobenzaldehyde dissolved in 30 mL of concentrated HCl and 30 mL of 95% (v / v) ethanol) were added and the solution was used. N- Acetaminophen was used as a standard. Chitin content data are the average of 18 replicates.

[0082] (2) Determination of total glucan content: The yeast and mushroom β-glucan assay kit (Megazyme) was used and the procedure was performed according to the manufacturer's instructions. The assay was repeated three times.

[0083] 5.6 Determination of substrate glucose conversion rate:

[0084] (1) The conversion rate of glucose to bacterial cells is calculated as: biomass / glucose consumption.

[0085] (2) The conversion rate of glucose to protein is calculated as: biomass × protein content / glucose consumption.

[0086] 5.7 Results

[0087] like Figure 2 As shown in Figure D, after the mycelium underwent an RNA removal step at 65℃ (FG31-RR group), the protein content of FG31 slightly increased to 62.60%. This phenomenon is consistent with previous research results, namely that heat treatment to remove nucleic acids increases fungal protein content. When the fermented cells were directly sterilized at 121℃ (FG31-S group), there was no significant difference in protein content between the two groups. Figure 2 As shown in Figure E, analysis of the cell wall components of the fermentation mycelium of wild-type (WT) and FG31 revealed a significant decrease in chitin and total glucan content in FG31. Specifically, the chitin content of FG31 was 5.40%, a decrease of 33.4% compared to the wild-type strain; while the total glucan content of FG31 was 7.71%, a decrease of 22.3% compared to the wild-type strain.

[0088] like Figure 5As shown, between 24 and 48 hours of fermentation in the tank, strain FG31 grew more slowly and accumulated less biomass than the wild type. However, between 48 and 72 hours, it exhibited a faster growth rate and reached a maximum biomass dry weight accumulation of 15.61 g / L at 72 h (FG31 group). The addition of ZnSO4 (previously reported to increase cell protein content) appeared to inhibit the growth of both the wild type and strain FG31 in the fermenter. Furthermore, ZnSO4 reduced ethanol production in the wild type but promoted ethanol production in strain FG31. Without ZnSO4, strain FG31 did not produce ethanol within 72 hours, indicating reduced carbon source waste. Strain FG31 had a higher cell protein content (up to 61.34%) in a 5-L fermenter, a 22.41% increase compared to the wild type (50.11%). This represents the highest protein content reported to date for a genetically modified *Fusarium venetum* strain without any production promoters. ZnSO4 significantly increased the protein content of the wild-type strain (by 6.5%), but had no significant enhancing effect on the FG31 strain. Considering substrate conversion rates, without zinc sulfate, the glucose-to-biomass conversion rate of the FG31 strain increased to 28.04% (44.02% higher than the wild-type) and the glucose-to-protein conversion rate increased to 17.20% (76.41% higher than the wild-type); with zinc sulfate, the glucose-to-biomass conversion rate of the FG31 strain increased to 34.75% (88.96% higher than the wild-type) and the glucose-to-protein conversion rate increased to 21.05% (114.58% higher than the wild-type). In summary, the FG31 strain exhibits higher substrate-to-cell and substrate-to-protein conversion rates, and the addition of 20 mg / L zinc sulfate further promotes substrate conversion.

[0089] Example 6: Transcriptomic analysis of the mechanism of high protein production by FG31

[0090] Analysis of the carbon and nitrogen metabolism pathways of glucose based on transcriptomic data showed that the expression levels of several key enzymes involved in glycolysis were downregulated. For example, the expression levels of pyruvate decarboxylases (FVRRES_12865 and FVRRES_12505), which are downstream pyruvate metabolism, were reduced by 5-fold and 22-fold, respectively. Figure 6(A) The expression of aldehyde dehydrogenase (ALDH), which catalyzes the conversion of acetaldehyde to acetic acid, decreased by 4-fold. Furthermore, the expression of alcohol dehydrogenase, which converts aldehydes to ethanol, decreased by 3-fold, while the expression of L-lactate dehydrogenase (LDH), involved in the conversion of pyruvate to lactate, decreased by 11-fold. This decrease in the expression of these key enzymes directly led to an overall reduction in glycolytic activity. Further experiments showed that after 72 hours of fermentation, the glucose consumption rate of FG31 was lower than that of the wild-type strain, indicating reduced glucose utilization efficiency and a decrease in ethanol production. Since glycolysis is the main pathway of glucose metabolism, the reduced glucose consumption rate in strain FG31 likely reflects a downregulation of the glycolytic pathway.

[0091] In contrast, the expression of genes related to nitrogen metabolism generally showed an upward trend. In the leucine metabolism pathway, the expression levels of aminotransferases and malate dehydrogenases increased by 8-fold and 5-fold, respectively. Similarly, in glutamate metabolism, the expression level of FVRRES_01748, involved in the glutamate biosynthesis pathway, increased by 3-fold. In the metabolism of isoleucine and valine, the expression level of 6-phosphate gluconate dehydrogenase, which catalyzes the 6-phosphate gluconate dehydrogenase reaction, increased by 3-fold. The expression of ketol-acid reductase, which promotes branched-chain amino acid biosynthesis, also increased by 3-fold. In conclusion, the increased synthesis of amino acids (such as leucine, glutamate, isoleucine, and valine) in nitrogen metabolism pathways may drive increased protein synthesis, leading to an increase in fungal protein content.

[0092] The transcriptome results also revealed other phenomena ( Figure 6 (B), i.e., knockout FvCLG Genes significantly affected the expression levels of most enzymes involved in fungal cell wall remodeling. For example, genes from several chitin synthase families previously identified in *Fusarium vesicatoria* showed varying degrees of downregulation, with FVRRES_02330 downregulated by 3-fold and FVRRES_06397 downregulated by 9-fold. This is consistent with the significant reduction in chitin content observed in FG31 fungal proteins. Furthermore, the expression of glycoside hydrolase family members FVRRES_08968 and FVRRES_13661 decreased by 6-fold and 12-fold, respectively. Given the crucial role of glycoside hydrolase family genes in fungal cell wall remodeling, this downregulation likely reflects impaired cell wall glucan synthesis.

[0093] This invention further analyzes the MAPK pathway, which is closely related to the fungal response to environmental stresses (such as osmotic pressure). Figure 6As shown in Figure C, transcriptome analysis identified several key genes in *Fusarium vesicae* (e.g., mitogen-activated protein kinase HOG1, catalase, etc.). The differentially downregulated expression levels of these key genes suggest they play a role in regulating the sensing of osmotic pressure in FG31, leading to enhanced cell wall sensitivity in the FG31 strain. This finding is consistent with... Figure 3 The experimental results were consistent with those in the study, indicating that the cell wall sensitivity of strain FG31 was increased.

[0094] Analysis shows that, Fusarium venenatum Several other proteins with concanavalin A-like lectin / glucanase domains are present. In the knockout... FvCLG Following (FVRRES_03168), some other identified [items / items] FvCLG Gene expression levels were also upregulated or downregulated. Figure 7 This suggests that the expression of concanavalin A-like lectin / glucanase domain proteins may be mutually regulated, and the deletion of a single gene may not necessarily have a significant impact on hyphal growth. Therefore, future inventions could focus on exploring other... FvCLG Genes in cultivating high-protein fungal protein Fusarium venenatum The role of the strain.

[0095] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. A strain of Venetian Fusarium ( Fusarium venenatum FG31, characterized in that, It was deposited at the China General Microbiological Culture Collection Center on October 16, 2025, with accession number CGMCC No. 42282.

2. A fermented product, characterized in that, The fermentation product contains Fusarium vesicatoria FG31 as described in claim 1.

3. A method for increasing the protein content of Fusarium vesicatoria, characterized in that, The method involves knocking out the concanavalin A-like lectin / glucanase domain protein in Fusarium vesicatoria. FvCLG Genes, encoding FvCLG The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

4. A method for improving the substrate conversion rate of Fusarium vesicatoria, characterized in that, The method involves knocking out the concanavalin A-like lectin / glucanase domain protein in Fusarium vesicatoria. FvCLG Genes, encoding FvCLG The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the substrate conversion rate is glucose to biomass conversion rate and / or glucose to protein conversion rate.

5. A method for preparing mycelial protein, characterized in that, The *Fusarium vesicatoria* FG31 as described in claim 1 was cultured.

6. The method according to claim 5, characterized in that, Incubate with shaking at 26-30℃ for 3-5 days.

7. Knockout of concanavalin A-like lectin / glucanase domain protein FvCLG The application of genes in increasing the mycelial protein yield of Fusarium venetum and / or improving substrate conversion efficiency is characterized by, coding FvCLG The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the substrate conversion rate is glucose to biomass conversion rate and / or glucose to protein conversion rate.

8. The use of Fusarium vesicatoria FG31 as described in claim 1 or the fermentation product as described in claim 2 in the preparation of mycelial protein.

Images