Construction and application of recombinant African swine fever virus strain

Abstract

The invention belongs to the technical field of biology, and particularly relates to construction and application of a recombinant African swine fever virus strain. The method comprises the following steps: firstly, simultaneously mutating 103-site and 240-site amino acid lysine of an African swine fever virus pE248R protein into arginine, and carrying out SIM (Subscriber Identity Module) mutation on the pE248R protein to construct a recombinant African swine fever virus strain; the average level of a p30 antibody in an animal immunized by the recombinant African swine fever virus strain exceeds 40% from the tenth day and the eleventh day, animal death does not occur after challenge, the recombinant African swine fever virus strain has good safety, and after ASFV immunization, the level of the p30 antibody continuously rises and the immune protection rate is 100%, which indicates that the recombinant African swine fever virus strain can resist attack of virulent parent ASFV, and has good application prospects. And clinical disease symptoms do not appear.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the construction and application of a recombinant African swine fever virus strain. Background Technology

[0002] African swine fever (ASF) is an acute, highly virulent, hemorrhagic infectious disease caused by the African swine fever virus (ASFV), primarily infecting domestic and wild pigs. Highly pathogenic strains can cause mortality and morbidity rates of up to 100% in domestic pigs. ASFV is a large, enveloped, double-stranded DNA virus that replicates in the cytoplasm of host cells. The virus particle is approximately 260-300 nanometers in diameter, with a genome size of approximately 170-193 kbp, encoding more than 180 open reading frames.

[0003] SUMOylation, a post-translational modification process that covalently links small ubiquitin-like modified proteins (SUMOs) to target proteins, has been proven to be an important mechanism regulating viral life cycles. Studies have found that proteins in various viruses undergo SUMOylation during replication, such as the 3C protein of the small RNA virus EV71, the integrase and p6 protein of HIV, and the M1, NS1, NS2, and NP proteins of influenza virus. However, the specific mechanisms of SUMOylation of these viral proteins are mostly still unclear.

[0004] ASFV pE248R is a late-expressed structural protein located on the viral inner membrane, encoded by the viral E248R gene. This protein consists of 248 amino acids, and its structural features include internal disulfide bonds, an N-terminal myristoylation site, and a C-terminal transmembrane region. Studies have shown that pE248R is an essential gene for ASFV replication, participating in the fusion of the viral inner membrane with the host cell membrane, and interacting with the viral protein pA151R, participating in viral redox reactions. However, the specific molecular mechanism by which pE248R regulates viral replication remains unclear.

[0005] This invention reveals for the first time a novel mechanism by which pE248R regulates viral replication through SUMOylation modification. It discovers that the host cell's SUMO E3 ligase PIAS4 promotes SUMOylation modification of pE248R, thereby significantly enhancing viral replication. Mutating the SUMOylation site of pE248R or its SUMO interaction motif (SIM) can effectively block viral replication. More importantly, recombinant viruses carrying these mutations exhibit a completely attenuated phenotype in pigs, losing their pathogenicity. This invention elucidates for the first time the key molecular mechanism of SUMOylation modification in mediating ASFV infection and pathogenicity, deepening the fundamental understanding of ASFV replication principles and providing a solid theoretical basis and highly promising molecular target for developing novel attenuated live African swine fever vaccines targeting the SUMOylation pathway. Summary of the Invention

[0006] This invention involves simultaneously mutating lysine residues at positions 103 and 240 of the African swine fever virus (ASFV) pE248R protein to arginine, and then constructing a recombinant ASFV strain by SIM mutation of the pE248R protein. In animals immunized with this recombinant ASFV strain, the average levels of p30 and p72 antibodies exceeded 40% on days 10 and 11, respectively. No animal deaths occurred after challenge, demonstrating good safety. The sustained increase in p30 antibody levels after ASFV challenge indicates that the recombinant ASFV strain can resist challenge from the virulent parent ASFV without exhibiting clinical symptoms. Specifically, it includes the following: In a first aspect, the present invention provides a recombinant African swine fever virus strain, wherein the recombinant African swine fever virus strain is obtained by simultaneously mutating lysine at positions 103 and 240 of the parental African swine fever virus pE248R protein to arginine, and then mutating SIM. The SIM mutation is as follows: SIM1: Mutate amino acids 131-135 of the PE248R protein from VLVVK to AAAAR; SIM2: Mutate amino acids 207-211 of the PE248R protein to AAAAA.

[0007] Preferably, the parent African swine fever virus is the CN / GS / 2018 isolate.

[0008] In a second aspect, the present invention provides an attenuated African swine fever vaccine, wherein the attenuated African swine fever vaccine comprises the recombinant African swine fever virus strain described in the first aspect above.

[0009] Thirdly, the present invention provides a method for preparing the recombinant African swine fever virus strain described in the first aspect above, wherein the method comprises: simultaneously mutating lysine at positions 103 and 240 of the parental African swine fever virus pE248R protein to arginine using genetic engineering methods; and obtaining the strain after SIM mutation; The SIM mutation is as follows: SIM1: Mutate amino acids 131-135 of the PE248R protein from VLVVK to AAAAR; SIM2: Mutate amino acids 207-211 of the PE248R protein to AAAAA.

[0010] Preferably, the genetic engineering method is conditional induced mutation.

[0011] Preferably, the parent African swine fever virus is the CN / GS / 2018 isolate.

[0012] Preferably, the method includes the following steps: (1) Construct a conditional mutant vector for pE248R protein by simultaneously mutating lysine at positions 103 and 240 to arginine, and simultaneously mutating amino acids VLVVK at positions 131-135 to AAAAR and amino acids IVILII at positions 207-211 to AAAAA. (2) The upstream and downstream sequences of the start codon of the ASFV-E248R gene were designed as the left and right homologous recombination arms. The two homologous arms were cloned into the conditional mutation vector described in step (1) by Gibson ligation. The left and right homologous recombination arms were located at the 5' and 3' ends of the conditional knockout gene fragment, respectively, and a homologous recombination transfer vector was obtained. (3) Transfect the homologous recombination transfer vector described in step (2) into BMDM cells infected with the original type II African swine virus strain, and screen to obtain recombinant African swine fever virus strains with arginine mutations at positions 103 and 240 of the pE248R protein, VLVVK mutation at positions 131-135 to AAAAR, and IVLII mutation at positions 207-211 to AAAAA.

[0013] Preferably, the conditional mutation vector comprises, from 5' to 3', the following gene in sequence: a selection gene, an ASFV-pE248R mutant gene in which lysine at positions 103 and 240 of the pE248R protein is simultaneously mutated to arginine and amino acids VLVVK at positions 131-135 are mutated to AAAAR and IVLII at positions 207-211 are mutated to AAAAA, a lac repressor expression gene, and a lac operon expression gene.

[0014] Preferably, the conditional mutation vector comprises, from 5' to 3', the following in sequence: p72 promoter, eGFP gene, p30 promoter, ASFV-pE248R mutant gene in which lysine at positions 103 and 240 of pE248R protein is simultaneously mutated to arginine and amino acids VLVVK at positions 131-135 is mutated to AAAAR and IVLII at positions 207-211 is mutated to AAAAA, U104L promoter, lac repressor expression gene, p72 promoter, and lac operon expression gene.

[0015] Preferably, the sequence of the p72 promoter is shown in SEQ ID NO.1.

[0016] Preferably, the sequence of the eGFP gene is shown in SEQ ID NO.2.

[0017] Preferably, the sequence of the p30 promoter is shown in SEQ ID NO.3.

[0018] Preferably, the sequence of the ASFV-pE248R mutant gene, in which lysines at positions 103 and 240 of the pE248R protein are simultaneously mutated to arginine, and amino acids VLVVK at positions 131-135 are mutated to AAAAR and IVILII at positions 207-211 are mutated to AAAAA, is shown in SEQ ID NO.6.

[0019] Preferably, the sequence of the U104L promoter is shown in SEQ ID NO.7.

[0020] Preferably, the sequence of the lac repressor expression gene is shown in SEQ ID NO.8.

[0021] Preferably, the sequence of the lac operon expressed gene is shown in SEQ ID NO.9.

[0022] Preferably, the sequence of the left homologous recombination arm is shown in SEQ ID NO.10; and the sequence of the right homologous recombination arm is shown in SEQ ID NO.11.

[0023] The beneficial effects of this invention are as follows: Firstly, this invention discovered that amino acids 103 and 240 of the African swine fever virus (ASFV) pE248R protein are potential SUMOylation sites and that the ASFV pE248R protein contains a SUMO interaction motif. Simultaneously mutating lysine at positions 103 and 240 to arginine, and mutating VLVVK at positions 131-135 of the ASFV protein to AAAAR and ILVLII at positions 207-211 of the ASFV protein to AAAAA, significantly inhibits SUMOylation modification. Secondly, this invention, through genetic engineering, constructed a SIM mutation (where lysine at positions 103 and 240 of the ASFV pE248R protein is simultaneously mutated to arginine) at positions 103 and 240 of the ASFV protein. The ASFV-pE248R recombinant virus strain was developed by mutating amino acids VLVVK (positions 31-135) to AAAAR and mutating amino acids IVLII (positions 207-211) to AAAAA. In animals immunized with this recombinant African swine fever virus strain, the average level of p30 antibodies exceeded 40% on days 10 and 11, respectively. No animal deaths occurred after challenge, demonstrating good safety. The sustained increase in p30 antibody levels after ASFV challenge indicates that the recombinant African swine fever virus strain can resist challenge from the virulent parent ASFV without showing clinical symptoms, indicating promising application prospects. Attached Figure Description

[0024] Figure 1pE248R-mSIM1 and pE248R-mSIM2 weaken the interaction between PIAS4 and pE248R.

[0025] Figure 2 pE248R-mSIM1 and pE248R-mSIM2 suppressed the SUMOylation of pE248R.

[0026] Figure 3 A schematic diagram of the conditional mutation strategy of the African swine fever virus (ASFV)-pE248R(K103 / 240RmSIM) gene.

[0027] Figure 4 Pure line identification diagram of ASFV-pE248R conditional mutant strain.

[0028] Figure 5 One-step growth curve of ASFV-pE248R conditional mutant strain.

[0029] Figure 6 Results of body temperature changes in animals immunized with the conditionally mutant strain of ASFV-pE248R.

[0030] Figure 7 Survival rate of animals immunized with the conditionally mutant strain of ASFV-pE248R gene.

[0031] Figure 8 Image showing the results of bloodborne infection in experimental pigs after immunization with the conditionally mutant strain of the ASFV-pE248R gene.

[0032] Figure 9 The level of P30 antibody in experimental pigs after immunization with the ASFV-pE248R gene conditional mutant strain. Detailed Implementation

[0033] To make the technical means, creative features, objectives, and effects of this invention easier to understand, the invention is further described below in conjunction with specific embodiments. However, the scope of protection of this invention is not limited to the embodiments described below.

[0034] The experiments described in the following examples obtained biosafety clearance and African swine fever laboratory activity clearance: In accordance with the requirements for a Biosafety Level 3 (BSL-3) laboratory and related biosafety for African swine fever, the Lanzhou Veterinary Research Institute of the Chinese Academy of Agricultural Sciences, through a hierarchical reporting process involving the Lanzhou Veterinary Research Institute's Biosafety Committee, Laboratory Animal Ethics Committee, the Chinese Academy of Agricultural Sciences' Biosafety Committee, the Lanzhou Veterinary Research Institute's Laboratory Animal Ethics Committee, and the Lanzhou Veterinary Research Institute's Biosafety Committee, obtained permission from the Ministry of Agriculture and Rural Affairs to conduct research on highly pathogenic ASFV pathogens and related animals. This permission has been registered with the Ministry of Agriculture and Rural Affairs and meets the national biosafety level requirements.

[0035] The experimental cells, viruses, and plasmids described in the following examples are from: Primary porcine alveolar macrophages (PAM) and primary bone marrow macrophages (BMDM) were obtained from healthy SPF Bama miniature pigs aged 2-4 months. After aseptic collection, red blood cells were removed using erythrocyte lysis buffer (Biosharp). After low-speed centrifugation, the supernatant was discarded, and the cell pellet was resuspended in RPMI 1640 complete medium (Gibco) containing 10% FBS (PAN) and cultured at 37°C in a 5% CO2 incubator. For BMDM cell culture, an additional 10 ng / mL of recombinant porcine GM-CSF (R&D Systems) was added to the RPMI 1640 complete medium. Induction was performed at 37°C in a 5% CO2 incubator, with washing every 2-3 days. Non-adherent cells were centrifuged and re-added to new cell culture dishes, the medium was changed, and induction continued. Cells were then cryopreserved or used after 5-7 days. ASFV was amplified using PAM cells and the viral load was titrated. BMDM cells were used for plasmid transfection and viral recombination experiments.

[0036] The African swine fever virus strain CN / GS / 2018, type II, originated from the National African Swine Fever Regional Laboratory (Lanzhou). It belongs to genotype II and has a viral titer of 5 × 10⁻⁶. 7 TCID 50 / mL, which is the 4th generation seed virus after PAM cell propagation, was deposited at the China Center for Type Culture Collection on December 21, 2020, with accession number CCTCC NO: V202096; deposit address: Wuhan University, Wuhan, China; contact number: 027-68752319; in the following examples, it is referred to as the ASFV CN / GS / 2018 isolate.

[0037] An operon is a collective term for a promoter gene, an operator gene, and a series of tightly linked structural genes; it is a functional unit of transcription. The lac operon described in this invention, also known as the lactose operon, is an operon responsible for the transport and metabolism of lactose in *Escherichia coli* and other enterobacteriaceae.

[0038] Repressors are regulatory genes, referring to gene fragments whose expression products, when bound to an operator gene in an inducible expression system, prevent ribonucleic acid polymerase from passing through the operator gene, thus hindering the synthesis of messenger ribonucleic acid and preventing the synthesis and expression of the enzyme. The expression product of the lac repressor described in this invention, when bound to the *E. coli* lactose operator, prevents ribonucleic acid polymerase from passing through the operator gene, thus hindering the synthesis of messenger ribonucleic acid and preventing the synthesis and expression of the gene. The inducer (e.g., IPTG) can bind to the lac repressor, rendering it inactive, inhibiting its binding to the lac operator gene, relieving the inhibition of the lac operator, and allowing the target gene to be synthesized and expressed normally.

[0039] Plasmids are small, circular DNA molecules that can autonomously replicate outside the chromosome of a cell. The plasmid containing a conditional knockout fragment constructed in this invention can recombine with the viral genome after transfection into cells and, through conditional induction, regulate the expression of the ASFV-pE248R gene, thereby achieving the knockout of the ASFV-pE248R gene. The HA-pE248R, Flag-SUMO1, and Myc-PIAS4 plasmids involved in this invention were all synthesized by General Biotechnology (Anhui) Co., Ltd.

[0040] Unless otherwise specified, the experimental methods described in the following examples are all operating methods known in the art; unless otherwise specified, the experimental materials used in the following examples were all purchased from conventional biochemical reagent companies.

[0041] Example 1: Identification of potential SUMOylation sites in pE248R SUMOylation sites typically have conserved amino acid motifs: KxD / E ( x: hydrophobic amino acid; any amino acid. To determine the SUMOylation sites of pE248R, bioinformatics analysis of its amino acid sequence revealed that K35, K103, K240, and K243 are potential SUMOylation sites. Immunoprecipitation showed that K103R and K240R are key SUMOylation sites of pE248R. Further construction of the dual-site mutant pE248R (K103 / 240R) revealed that this mutant almost completely eliminated SUMOylation of pE248R. These results confirm that K103 and K240 are key SUMOylation sites of pE248R.

[0042] Example 2: The role of SIM in the interaction between pE248R and PIAS4 To investigate the role of SIM in the interaction between pE248R and PIAS4, pE248R SIM mutant plasmids were constructed, including: pE248R-mSIM1 (mutating amino acids VLVVK at positions 131-135 of the PE248R protein to AAAAR) and pE248R-mSIM2 (mutating amino acids IVBII at positions 207-211 of the PE248R protein to AAAAA).

[0043] Using the original plasmid HA-pE248R as a template, primers were extended by about 15 bp to the left and right of the mutation sites (amino acids 131-135 of pE248R protein VLVVK mutation to AAAAR and amino acids 207-211 of pE248R protein IVLII mutation to AAAA). The upstream and downstream primers were reverse complementary sequences. A pair of completely complementary primers of about 30 bp in length were designed for point mutation to construct SIM site mutants (pE248R-mSIM1 and pE248R-mSIM2).

[0044] The primers are as follows: pE248R-mSIM1-F: CTGTCGGGTATGAACGCGGCAGCGGCGCGAGGGAATGGCAACATTG (shown in SEQ ID NO. 12), pE248R-mSIM1-R: CAATGTTGCCATTCCCTCGCGCCGCTGCCGCGTTCATACCCGACAG (shown in SEQ ID NO. 13); pE248R-mSIM2-F: TGGTCGCGGCTGTAGTTGCAGCAGCAGCAGCAGTAGGGTTTATAGCCG (shown in SEQ ID NO.14). pE248R-mSIM2-R: CGGCTATAAACCCTACTGCTTGCTGCTGCTGCAACTACAGCCGCGACCA (shown in SEQ ID NO. 15).

[0045] Immunoprecipitation assay: First, 293T cells were pre-seeded in 10 cm dishes. When the cells reached about 50-60% confluency, the HA-pE248R plasmid and Myc-PIAS4 plasmid were co-transfected into 293T cells using calcium chloride transfection (or transfected with the transfection reagent jetPRIME® after the cells reached about 90% confluency). After 4-6 h of transfection, the medium was changed and the cells were cultured for another 24 h before the samples were collected (the transfection methods for EV, pE248R(mSIM1) and pE248R(mSIM2) were the same as above).

[0046] The collected cell pellet was placed in 1.5 mL centrifuge tubes and placed on ice for further processing. The cell pellet was resuspended in 1 mL of NP40 lysis buffer (containing inhibitors such as PMFS, Aprotinin, Na3VO4, Leupeptin, sodium pyrophosphate, β-glycerophosphate, and NaF). The pellet was then sonicated for 1 min using a 5-second sonication, 5-second pause program (20% power). After sonication, the cell suspension was further lysed on a 4°C rotary shaker for 10 min, followed by centrifugation at 12,000 rpm / min for 10 min at 4°C. 80 μL of the supernatant was collected and 20 μL of 5×SDS loading buffer was added as input. The remaining sample was brought to 1 mL with NP40, followed by the addition of 1 μL of Myc antibody and 50 μL of protein G for enrichment. The processed sample was then incubated on a 4°C rotary shaker for approximately 4-6 h before washing. The sample was then rinsed with a solution containing 0.5 M... Wash three times with NP40 containing NaCl, then wash three times with NP40 without NaCl. Finally, discard the NP40 and add about 60 μL of 2×SDS loading buffer to each tube. Then boil the samples at 100 °C and centrifuge at 12,000 rpm / min for 10 min. Perform Western blotting on the centrifuged samples for verification.

[0047] Results of co-immunoprecipitation experiment as follows Figure 1 As shown, pE248R-mSIM1 and pE248R-mSIM2 weaken the interaction between PIAS4 and pE248R.

[0048] Further research revealed that pE248R-mSIM1 and pE248R-mSIM2 suppressed the SUMOylation modification of pE248R. Specific experimental results are as follows... Figure 2 As shown.

[0049] These data indicate that the SIM of pE248R is a region that interacts with PIAS4 and affects the SIMification modification of pE248R.

[0050] Example 3 Construction of recombinant strains 1. Homologous recombination transfer vector (1) Gene synthesis Synthesize the lac repressor gene element (SEQ ID NO.8) initiated by the U104L promoter (SEQ ID NO.7); synthesize the lac operon gene element (SEQ ID NO.9) initiated by the p72 promoter (SEQ ID NO.1); synthesize the gene fragment (SEQ ID NO.4) of the ASFV-pE248R-K103 / 240R mutation (mutating the codons encoding lysines at positions 103 and 240 of pE248R to arginine codons) initiated by the p30 promoter (SEQ ID NO.3); synthesize the gene fragment (SEQ ID NO.5) of the ASFV-pE248R-SIM mutation (mutating amino acids VLVVK at positions 131-135 of the pE248R protein to AAAAR and amino acids IVLII at positions 207-211 of the pE248R protein to AAAA) initiated by the p30 promoter (SEQ ID NO.7); synthesize the gene fragment (SEQ ID NO.8) of the p72 promoter (SEQ ID NO.9); synthesize the gene fragment (SEQ ID NO.9) of the p72 promoter (SEQ ID NO.1 ... The gene fragments initiated by the ASFV-pE248R-K103 / 240R mutation (mutating the codons encoding lysine at positions 103 and 240 of pE248R to arginine codons and the ASFV-pE248R-SIM mutation (mutating amino acids VLVVK at positions 131-135 of the pE248R protein to AAAAR and amino acids IVBII at positions 207-211 of the pE248R protein to AAAA) (shown in SEQ ID NO. 6) are shown.

[0051] (2) Construction of expression boxes To facilitate subsequent virus purification, a selection marker element for the eGFP gene, initiated by the p72 promoter (shown in SEQ ID NO.1), was synthesized simultaneously with the synthesis of the regulatory sequence. The eGFP gene sequence is shown in SEQ ID NO.2.

[0052] (3) Construction of homologous recombination transfer vector The pUC118 vector was digested with EcoRI and HindIII restriction endonucleases, and the backbone fragment was recovered. Then, the lac repressor gene expression element lacI, the lac operon gene expression element lacO, the ASFV-pE248R mutant gene (the ASFV-pE248R-K103 / 240R mutant gene fragment shown in SEQ ID NO.4, the ASFV-pE248R-SIM mutant gene fragment shown in SEQ ID NO.5, and the ASFV-pE248R-K103 / 240R and ASFV-pE248R-SIM mutant gene fragment shown in SEQ ID NO.6, respectively) and the eGFP selection marker element were simultaneously ligated into the pUC118 backbone fragment to obtain pUC118-ASFV. IPTG vector; the vector contains, from 5' to 3', the p72 promoter, eGFP gene, p30 promoter, ASFV-pE248R mutant gene with lysine at positions 103 and 240 mutated to arginine, U104L promoter, lac repressor expression gene (lacI), p72 promoter, lac operator expression gene (lac operator), and ASFV-pE248R gene, respectively, to obtain homologous recombination transfer vectors pUC118-LR-vE248Ri(K103 / 240R)-eGFP-lacI, pUC118-LR-vE248Ri(mSIM)-eGFP-lacI, and pUC118-LR-vE248Ri(K103 / 240RmSIM)-eGFP-lacI. Specific construction strategies are as follows: Figure 3 As shown.

[0053] Although this embodiment selects specific homologous recombination arm sequences based on the upstream and downstream sequences of the ASFV-pE248R gene start codon (the sequence of the left homologous recombination arm is shown in SEQ ID NO. 10; the sequence of the right homologous recombination arm is shown in SEQ ID NO. 11), the homologous recombination arm sequences can be selected without disrupting the translation of the ASFV-pE248R gene into a protein.

[0054] 2. Cell transfection and recombinant virus screening Resuscitate BMDM cells and seed them in 6-well plates (approximately 10 cells per well). 6Transfect the homologous recombination transfer vector pUC118-LR-vE248Ri(K103 / 240R)-eGFP-lacI prepared in step 1 above with JetPEI®-Macrophage DNA transfection reagent (100 μl buffer, 2 μg recombinant plasmid, and 4 μl transfection reagent into an EP tube, mix thoroughly, let stand for 10 min, and then transfer to a six-well plate.

[0055] Six hours after transfection, the complete culture medium used for transfection was discarded and replaced with complete medium containing IPTG. BMDM cells were directly infected with the ASFV CN / GS / 2018 virus strain (MOI=1). The medium was not changed after infection. After 48 hours, the number of fluorescent cells was observed and photographed using a fluorescence microscope. After culturing in complete medium containing IPTG, a large amount of fluorescence expression was observed, indicating that the suspected recombinant virus had successfully infected the cells. Single fluorescent cells were picked and seeded into 96-well plates of BMDM cells cultured in complete medium containing IPTG (final IPTG concentration 1.25 mM). The wells showing fluorescence were observed. Newly emerging fluorescent cells were picked and seeded again into 96-well plates of BMDM cells cultured in complete medium containing IPTG (final IPTG concentration 1.25 mM). This selection process was repeated several times.

[0056] 3. Identification of Gene Knockout Results When the fluorescent cells reached the 7th and 8th generations, the toxins in the 96-well plates were sterilized in a 65°C metal bath for 10 min. The purity of the toxins was then determined by PCR using primers from wild-type ASFV (WT-ASFV-F: ACTTCAAGATCCGCCACAACA (SEQ ID NO.16); WT-ASFV-R: TGATCGGCGCGAGATTTAATCG (SEQ ID NO.17)), the left arm detection primer (E248R-LA-F: GTAGACGTATACTGTTGCTCCGAC (SEQ ID NO.18); E248R-LA-R: GTTGCCGTCGTCCTTGAAGAA (SEQ ID NO.19)), and the right arm detection primer (E248R-LACRA-F: CATCGTTCCCACTGCGATG (SEQ ID NO.20); E248R-LACRA-R: TGATCGTGAGTTCCTGCGT (SEQ ID NO.21)).

[0057] Purity test results as follows Figure 4As shown, the 7th generation deletion virus can detect recombinant elements of vE248R(K103 / 240RmSIM), vE248Ri(K103 / 240R), and vE248Ri(mSIM), and wild-type virus is no longer present. This indicates that IPTG conditionally induced vE248R(K103 / 240RmSIM), (vE248Ri(K103 / 240R)) and (vE248Ri(mSIM)) mutant strains have been successfully constructed and purified, and named vE248R(K103 / 240RmSIM), vE248Ri(K103 / 240R), and vE248Ri(mSIM), respectively.

[0058] One-step growth curve results are as follows Figure 5 As shown, the mutant recombinant strains vE248R(K103 / 240RRmSIM), vE248Ri(K103 / 240R), and vE248Ri(mSIM) could not be detected replicating without IPTG, but could replicate normally in the presence of IPTG. These data indicate that the K103 and K240 motifs, as well as the SIM motif, of pE248R are important for viral replication.

[0059] Example 4: Virulence of the recombinant virus and its protective efficacy against porcine parent virus To investigate whether the recombinant virus was attenuated in pigs, pigs weighing 80 to 90 pounds were injected (intramuscularly) with 10... 6 HAD 50 The recombinant strains vE248Ri(K103 / 240RmSIM), vE248Ri(K103 / 240R), and vE248Ri(mSIM), or 10 4 HAD 50 The wild-type ASFV CN / GS / 2018 was detected and pigs were observed for 17 days. Animals infected with ASFV CN / GS / 2018 exhibited disease-related clinical symptoms, including high fever, anorexia, depression, purple skin discoloration, unsteady gait, and diarrhea, and died within 7 days of infection.

[0060] Immunized animals maintained a normal average body temperature throughout the observation period. Figure 6 As shown, the animal survival rate is as follows: Figure 7 As shown, the survival rate of pigs immunized with the recombinant strain vE248Ri(K103 / 240RmSIM) described in this application is 100%.

[0061] Further testing was conducted on viral DNA copies in blood, oral cavity, nasal cavity, stool swabs, and tissues. Results are as follows... Figure 8As shown, compared with parental ASFV-inoculated animals, animals inoculated with recombinant strains vE248Ri(K103 / 240R), vE248Ri(K103 / 240R), and vE248Ri(mSIM) had relatively fewer viral DNA copies in their blood.

[0062] The above results indicate that the conditional mutant virus vE248Ri (K103 / 240RmSIM) of the ASFV-pE248R gene constructed in this application is significantly attenuated in pigs.

[0063] Example 5: Evaluation of the protective efficacy of recombinant virus against African swine fever virus (ASFV) challenge. To assess the immunogenicity of recombinant strains (vE248Ri(K103 / 240RmSIM), vE248Ri(K103 / 240R), and vE248Ri(mSIM), animals were inoculated intramuscularly (IM) on day 17 following infection with the recombinant virus, receiving 20 half-maximal hemagglutination doses (HADs) of the three strains. 50 The virulent parent ASFV was used to challenge the immunized cells. Peripheral blood was collected daily after immunization until day 17.

[0064] The results are as follows Figure 9 As shown, after ASFV challenge, only animals immunized with vE248Ri (K103 / 240RmSIM) did not die, and their average p30 antibody levels continued to rise, eventually stabilizing at around 80% and 70%, respectively.

[0065] In summary, this invention first discovered that by mutating lysine at positions 103 and 240 of the parent African swine fever virus strain ASFV-pE248R to arginine, and by mutating amino acids VLVVK at positions 131-135 of the pE248R protein to AAAAR and IVLII at positions 207-211 of the pE248R protein to AAAA, a mutant strain can be obtained. This mutant strain, as a candidate vaccine strain, completely attenuates pigs, and immunized pigs do not exhibit typical ASF clinical symptoms. It can produce a specific immune response to ASFV and can serve as a safe and effective candidate vaccine for the prevention and control of ASF outbreaks, thus possessing significant social value. Secondly, this invention has discovered that by constructing conditional knockout fragments, conditional mutations can be achieved, such as mutating lysine at positions 103 and 240 of the ASFV-pE248R gene to arginine, mutating amino acid VLVVK at positions 131-135 of the pE248R protein to AAAAR, and mutating amino acid IVLII at positions 207-211 of the pE248R protein to AAAA. The resulting mutant strains can replicate normally under IPTG induction without affecting the production of the mutant strains, while producing the vE248Ri (K103 / 240RmSIM) protein under conditions without IPTG induction, which can be used as a safe and effective vaccine for production.

Claims

1. A recombinant African swine fever virus strain, characterized in that, The recombinant African swine fever virus strain was obtained by simultaneously mutating lysines at positions 103 and 240 of the parental African swine fever virus pE248R protein to arginine, followed by a SIM mutation; the SIM mutation is as follows: SIM1: Mutate amino acids 131-135 of the PE248R protein from VLVVK to AAAAR; SIM2: Mutate amino acids 207-211 of the PE248R protein to AAAAA.

2. The application as described in claim 1, characterized in that, The parent African swine fever virus was the CN / GS / 2018 isolate.

3. An African swine fever attenuated vaccine, characterized in that, The attenuated African swine fever vaccine comprises the recombinant African swine fever virus strain described in claim 1 or 2.

4. The method for preparing the recombinant African swine fever virus strain as described in claim 1, characterized in that, The method involves simultaneously mutating lysines at positions 103 and 240 of the parental African swine fever virus pE248R protein to arginine using genetic engineering techniques; and obtaining the SIM mutation. The SIM mutation is as follows: SIM1: Mutate amino acids 131-135 of the PE248R protein from VLVVK to AAAAR; SIM2: Mutate amino acids 207-211 of the PE248R protein to AAAAA.

5. The method as described in claim 4, characterized in that, The genetic engineering method mentioned is conditional induced mutation.

6. The method as described in claim 5, characterized in that, The parent African swine fever virus was the CN / GS / 2018 isolate.

7. The method as described in claim 6, characterized in that, The method includes the following steps: (1) Construct conditional mutation vectors that simultaneously mutate lysine at positions 103 and 240 of the pE248R protein to arginine, mutate amino acid VLVVK at positions 131-135 of the pE248R protein to AAAAR, and mutate amino acid IVII at positions 207-211 of the pE248R protein to AAAAA. (2) The upstream and downstream sequences of the start codon of the ASFV-E248R gene were designed as the left and right homologous recombination arms. The two homologous arms were cloned into the conditional mutation vector described in step (1) by Gibson ligation. The left and right homologous recombination arms were located at the 5' and 3' ends of the conditional knockout gene fragment, respectively, and a homologous recombination transfer vector was obtained. (3) Transfect the homologous recombination transfer vector described in step (2) into BMDM cells infected with the original type II African swine virus strain, and screen to obtain recombinant African swine fever virus strains with arginine mutations at positions 103 and 240 of the pE248R protein, and VLVVK mutation at positions 131-135 of the pE248R protein to AAAAR, and IVLII mutation at positions 207-211 of the pE248R protein to AAAAA.

8. The method as described in claim 7, characterized in that, The conditional mutation vector, from 5' to 3', includes, in sequence: a selection gene, an ASFV-pE248R mutant gene in which lysine at positions 103 and 240 of the pE248R protein is simultaneously mutated to arginine and amino acids at positions 131-135 (VLVVK) are mutated to AAAAR and amino acids at positions 207-211 (IVLII) are mutated to AAAAA, a lac repressor expression gene, and a lac operon expression gene.

9. The method as described in claim 8, characterized in that, The conditional mutation vectors from 5' to 3' include, in sequence: p72 promoter, eGFP gene, p30 promoter, ASFV-pE248R mutant gene with lysine at positions 103 and 240 of pE248R protein simultaneously mutated to arginine and amino acids VLVVK at positions 131-135 mutated to AAAAR and IVLII at positions 207-211 mutated to AAAAA, U104L promoter, lac repressor expression gene, p72 promoter, and lac operon expression gene.

10. The method as described in claim 9, characterized in that, The sequence of the left homologous recombination arm is shown in SEQ ID NO.10; the sequence of the right homologous recombination arm is shown in SEQ ID NO.11.

Images