Gene expression cassette and application thereof

Abstract

The invention relates to a gene expression cassette and application thereof. The gene expression cassette comprises a tyrosinase gene, a transcriptional repressor protein gene, a melanin response promoter and a reporter gene, and the reporter gene is located at the downstream of the melanin response promoter and is regulated by the promoter. The gene expression cassette with a specific structure is designed, melanin in cells can be responded, a melanin biosensor can be further constructed by utilizing the gene expression cassette, the gene expression cassette has good specificity, and high-throughput screening of strains can be realized. Furthermore, ALE evolution is carried out on the strain for producing melanin, high-throughput screening is carried out based on a designed sensor, the strain for producing melanin with high yield is obtained, through shake-flask culture and 5L fermentation tank culture, the yield of melanin reaches up to 10.84 g / L and 29.04 g / L respectively, and an efficient and feasible solution is provided for large-scale production of melanin.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology and relates to a gene expression cassette and its application, particularly its application in constructing melanin biosensors and screening melanin-producing strains. Background Technology

[0002] Melanin is a biological pigment widely found in human skin, retina, pia mater, and mucous membranes. It plays several important physiological roles in the body, primarily involving photoprotection, visual regulation, and immune regulation. Melanin not only absorbs UVB (280–315 nm) and UVA (315–400 nm), reducing direct damage to skin cells from ultraviolet radiation, but it also reduces the formation of thymine dimers by absorbing and scattering UV radiation, thereby decreasing the risk of skin cancers such as melanoma. Furthermore, melanin possesses excellent semiconductor properties and biocompatibility, showing great potential in functional materials and biomedicine.

[0003] Melanin is synthesized from tyrosine through a series of enzymatic reactions via oxidative polymerization. Currently, melanin can be produced in microorganisms such as *Escherichia coli* and *Streptomyces*. For example, CN118325801A discloses a recombinant strain for melanin preparation via fermentation using tyrosine as a substrate. Using *E. coli* as the starting strain, the genes pheA, trpR, and pykA were knocked out, and the tyrosine operon genes melC1 and melC2 were overexpressed. The melanin yield in M9 medium was 635 mg / L, but the yield using this method is still relatively low. Currently, microbial fermentation methods generally suffer from low yields and high costs, making them difficult to apply to industrial production. Therefore, developing low-cost, high-yield microbial fermentation methods for melanin has become one of the research hotspots in the field of microbial melanin preparation.

[0004] Discovering and screening high-yielding strains is one of the main methods to increase melanin production. Currently, physical and chemical mutagenesis combined with plate screening of high-yielding mutant strains can be used. However, the above methods have the problems of low beneficial mutation rate, large-scale screening required, high toxicity of mutagen, high safety risk, and traditional plate screening of high-yielding colonies is labor-intensive, time-consuming and inefficient.

[0005] In conclusion, there is an urgent need to develop a highly efficient and environmentally friendly strain of melanin-producing bacteria to achieve the goal of producing high-yield melanin. Summary of the Invention

[0006] To address the shortcomings of existing technologies and practical needs, this invention provides a gene expression cassette and its application. By designing a gene expression cassette that responds to melanin, a highly specific melanin biosensor can be constructed for rapid and efficient screening of genetically engineered strains with high melanin production potential.

[0007] To achieve the above objectives, the present invention adopts the following technical solution:

[0008] In a first aspect, the present invention provides a gene expression cassette, the gene expression cassette comprising a regulatory gene, a melanin-responsive promoter, and a reporter gene, wherein the reporter gene is located downstream of the melanin-responsive promoter and is regulated by the melanin-responsive promoter; the regulatory gene comprises a tyrosinase gene and a transcriptional repressor protein gene.

[0009] This invention designs a novel gene expression cassette that expresses regulatory genes to produce tyrosinase and transcriptional repressor proteins. It utilizes a melanin-responsive promoter. The normally active form of the transcriptional repressor protein binds to the melanin-responsive promoter, inhibiting the expression of its downstream reporter genes. However, when intracellular melanin concentration increases, intracellular melanin binds to tyrosinase to form a complex. This complex causes a conformational change in the transcriptional repressor protein, causing it to dissociate from the melanin-responsive promoter, thereby releasing the repression and activating the expression of the melanin-responsive promoter. This, in turn, activates the expression of downstream reporter genes, giving the bacteria the corresponding trait. Therefore, the ability of corresponding cells to produce melanin can be analyzed by detecting the expression of reporter genes. This gene expression cassette can serve as a high-throughput screening system for high-melanin-producing bacteria.

[0010] Optionally, the melanin-responsive promoter, transcriptional repressor protein gene, tyrosinase gene, and reporter gene are sequentially linked; alternatively, the regulatory gene is expressed in a different gene expression cassette than the melanin-responsive promoter and reporter gene. It is understood that the regulatory gene can also be expressed in a different gene expression cassette than the melanin-responsive promoter and reporter gene, as long as they are within the same microenvironment (e.g., intracellular), and this will also achieve the regulatory expression function. For example, they can be inserted into different plasmids. Similarly, the two regulatory genes can also be expressed in different gene expression cassettes.

[0011] Optionally, the nucleic acid sequence of the tyrosinase gene includes the sequence shown in SEQ ID NO.1.

[0012] Optionally, the nucleic acid sequence of the transcriptional repressor protein gene includes the sequence shown in SEQ ID NO.2.

[0013] Optionally, the melanin-responsive promoter includes the Ptet promoter.

[0014] Optionally, the nucleic acid sequence of the Ptet promoter includes the sequence shown in SEQ ID NO.4.

[0015] Optionally, the reporter gene includes a fluorescent protein gene.

[0016] In this invention, a fluorescent protein gene is used as a reporter gene to establish a correlation between melanin concentration and fluorescence intensity, and high-melanin-producing strains can be screened using fluorescence sorting technology.

[0017] Optionally, the fluorescent protein gene includes a red fluorescent protein gene or a green fluorescent protein gene.

[0018] Optionally, the nucleic acid sequence of the red fluorescent protein gene includes the sequence shown in SEQ ID NO.3.

[0019] In a second aspect, the present invention provides a recombinant expression vector containing the gene expression cassette described in the first aspect.

[0020] In this invention, the gene expression cassette is constructed in an expression vector, which can serve as a melanin biosensor in response to melanin in the expression environment.

[0021] Thirdly, the present invention provides a recombinant cell containing the gene expression cassette described in the first aspect or the recombinant expression vector described in the second aspect.

[0022] Fourthly, the present invention provides the application of the gene expression cassette described in the first aspect, the recombinant expression vector described in the second aspect, or the recombinant cell described in the third aspect in screening strains that produce melanin.

[0023] Fifthly, the present invention provides a method for screening melanin-producing strains, the method comprising expressing the gene expression cassette described in the first aspect in the melanin-producing strain, screening strains with high expression of the reporter gene based on the expression signal of the reporter gene, and obtaining high-yielding melanin-producing strains.

[0024] Specifically, the method for screening melanin-producing strains includes the following steps:

[0025] The population of strains to be screened is brought into contact with the gene expression cassette described in the first aspect, so that the gene expression cassette functions within the strain;

[0026] Cultivate the bacterial strain to produce melanin;

[0027] The expression signal of the reporter gene was detected, wherein the expression level of the reporter gene was positively correlated with the melanin production in the strain;

[0028] Based on the expression signal of the reporter gene, strains with high expression of the reporter gene are screened out, which are high-melanin-producing strains.

[0029] In a sixth aspect, the present invention provides a method for preparing a melanin mutant strain, wherein the preparation method induces spontaneous gene mutations in the melanin-producing strain through continuous subculturing.

[0030] Optionally, the glucose concentration in the culture medium for continuous subculturing is 90-110 g / L, for example, it can be 95, 98, 100, 105 or 108 g / L.

[0031] Optionally, the method further includes screening the mutated strain using the method for screening melanin-producing strains described in the fifth aspect.

[0032] In a seventh aspect, the present invention provides a melanin-producing engineered strain, which is obtained by the method for preparing the melanin mutant strain described in the sixth aspect.

[0033] Eighthly, the present invention provides a method for producing melanin, the method comprising fermenting and culturing the melanin-producing engineered strain described in the seventh aspect, taking the culture for product separation and purification, and obtaining the melanin.

[0034] Optionally, the fermentation culture includes a method for producing melanin in a shake flask and a method for producing melanin in a fermenter.

[0035] Optionally, the specific steps of the method for producing melanin in shake flasks are as follows:

[0036] (1) Pick a single colony and inoculate it into LB medium, and incubate at 25~35℃ and 200~300 rpm for 12~16 h to obtain the primary seed culture;

[0037] (2) Inoculate 1-10% into NBS medium and incubate at 20-30℃ and 200-300 rpm until OD. 600 Add 0.1-0.3 mM IPTG to induce enzyme expression at approximately 0.6-0.8 (approximately 8-9 h), then continue culturing at 25-35℃ for 40-60 h to obtain melanin fermentation broth; during shake flask culture, control the pH at 6.5-6.8, and add 3-8 g / L glucose every 20-30 h.

[0038] Optionally, the specific steps of the method for producing melanin in the fermenter are as follows:

[0039] (1) Plate activation: streak the preserved strain on solid LB medium and then incubate in an incubator at 30~37℃ for 24 h.

[0040] (2) Primary seed culture: Take activated colonies from the plate, inoculate them into LB liquid medium, and culture at 30~37℃ and 200~300rpm for 12~16 h.

[0041] (3) Secondary seed culture: Inoculate the activated bacterial solution into the secondary seed culture medium at an inoculation rate of 5-10%, and culture at 30-37℃ and 200-300 rpm for 8-12 h;

[0042] (4) Transfer 200 mL of the secondary seed culture at an inoculum rate of 9-10% to a fermenter containing fermentation medium for the first stage of fermentation culture. The pH is controlled at 6.8-7.2, the temperature at 29-31℃, the initial aeration ratio at 1-2 vvm, the initial rotation speed at 200-300 rpm, dissolved oxygen-coordinated stirring, and the dissolved oxygen (DO) is controlled at 20-30%. Under these conditions, the OD is cultured. 600 When the temperature reaches 20-30°C, add 0.1-0.3 mM IPTG inducer;

[0043] (5) After 12-20 h, adjust the fermentation parameters to maintain dissolved oxygen (DO) at 45-55% and pH at 6.7-6.9. The residual sugar concentration in the fermentation system is controlled at 22-28 g / L (preferably 24-26 g / L, and more preferably 25 g / L) by adding glucose solution.

[0044] Compared with the prior art, the present invention has the following beneficial effects:

[0045] This invention designs a gene expression cassette with a specific structure that can respond to intracellular melanin. This cassette can be used to further construct a melanin biosensor with good specificity. After expression in melanin-producing strains, it can characterize intracellular melanin concentration. High-throughput screening of strains can be achieved using flow cytometry-activated cell sorting (FACS). Furthermore, adaptive laboratory evolution (ALE) is performed on melanin-producing strains, and high-throughput screening is conducted based on the designed sensor to obtain high-melanin-producing strains with a melanin yield of up to 29.04 g / L, providing an efficient and feasible solution for large-scale melanin production. Attached Figure Description

[0046] Figure 1 This is a schematic diagram illustrating the working principle of a gene expression cassette.

[0047] Figure 2 The image shows the melanin production and fluorescence results of BL21-09-peTMel in Example 2 of this invention.

[0048] Figure 3 The graph shows the product yield and fluorescence results of the strain that produces tyrosine and levodopa in Example 2 of this invention.

[0049] Figure 4 This is a diagram showing the passage growth results of BL21-09-peTMel in Example 3 of the present invention.

[0050] Figure 5This is a diagram of the FACS results from one round of screening in Embodiment 4 of the present invention.

[0051] Figure 6 This is a diagram showing the FACS results of the second round of screening in Embodiment 4 of the present invention.

[0052] Figure 7 This is a graph showing the fluorescence intensity results of different colonies in Example 4 of the present invention.

[0053] Figure 8 This is a diagram showing the fermentation results in Example 7 of the present invention. Detailed Implementation

[0054] The technical solution of the present invention will be further described below with reference to the accompanying drawings and specific embodiments. However, the following examples are merely simplified examples of the present invention and do not represent or limit the scope of protection of the present invention. The scope of protection of the present invention is determined by the claims.

[0055] Where specific techniques or conditions are not specified in the examples, they shall be performed in accordance with the techniques or conditions described in the literature in this field, or in accordance with the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased from legitimate channels.

[0056] In a typical embodiment of the present invention, a gene expression cassette is provided, which can be used as a high-throughput screening system for melanin-producing bacteria. The gene expression cassette includes at least a tyrosinase gene melC, a transcriptional repressor protein (TetR) gene tetR, a melanin-responsive promoter Ptet, and a reporter gene. The reporter gene is located downstream of the melanin-responsive promoter and is regulated by the promoter.

[0057] A schematic diagram of the working principle of the gene expression cassette of this invention is shown below. Figure 1 (Taking RFP as an example of a reporter gene) As shown, the present invention uses a melanin-responsive promoter. The normally active form of transcriptional repressor protein can bind to the melanin-responsive promoter Ptet, inhibiting the expression of its downstream reporter gene, resulting in the reporter gene not being expressed. However, when the intracellular melanin concentration increases, the intracellular melanin will bind to the tyrosinase protein, and the resulting complex will cause a conformational change in the transcriptional repressor protein. This conformational change inactivates the transcriptional repressor protein and causes it to detach from the melanin-responsive promoter Ptet, thereby releasing the repression, activating the expression of the promoter, activating the expression of downstream genes, and the reporter gene will be transcribed and translated along with the expression of the promoter, giving the bacteria the corresponding traits (such as enhanced fluorescence).

[0058] In one specific embodiment of the present invention, the reporter gene can be at least any fluorescent protein encoding gene, and more specifically, the fluorescent protein can be red fluorescent protein RFP.

[0059] In one specific embodiment of the present invention, the gene fragment in the gene expression cassette is first amplified. The Ptet promoter is amplified by PCR from the pTet plasmid, and two restriction enzyme sites, EcoRI and BamHI, are added. The tetR gene fragment, containing BamHI and XhoI restriction enzyme sites, is synthesized by PCR using plasmid pBR322 as a template. The melC gene fragment, containing XhoI and HindIII restriction enzyme sites, is amplified using the Streptomyces glaucescens genome as a template. The RFP gene fragment, containing HindIII restriction enzyme sites, is synthesized directly by a biotechnology company.

[0060] In another specific embodiment of the present invention, a recombinant expression vector is provided, which carries the above-mentioned gene expression cassette. It can serve as a melanin sensor, responding to melanin in a bacterial strain.

[0061] Specifically, the recombinant expression vector is obtained by linking the gene fragment of the above-mentioned gene expression cassette to an expression vector, and the expression vector can be any one or more of viral vectors, plasmids, bacteriophages, kinesisomes or artificial chromosomes.

[0062] More specifically, the recombinant expression vector can be a plasmid carrying the aforementioned gene expression cassette. In one specific embodiment of the present invention, the plasmid can be pET28a.

[0063] In another specific embodiment of the present invention, a cell is provided, the cell comprising the above-described recombinant expression vector or carrying the above-described gene expression cassette.

[0064] The cells can be prokaryotic cells or eukaryotic cells. In one specific embodiment of the present invention, the prokaryotic cells can be melanin-producing bacteria, and the bacteria can be Escherichia coli and its derivatives.

[0065] In another specific embodiment of the present invention, the application of the above-mentioned gene expression cassette, recombinant expression vector or cell in high-throughput screening of strains that produce melanin is provided.

[0066] In another specific embodiment of the present invention, a method for inducing gene mutation in a melanin-producing strain is provided, wherein the method induces spontaneous gene mutation in the strain through continuous subculturing.

[0067] In another specific embodiment of the present invention, a method for high-throughput screening of high-melanin-producing mutant strains is provided. The method includes screening high-melanin-producing strains using fluorescence sorting technology (FACS) based on the above-mentioned gene expression cassette, recombinant expression vector or cells.

[0068] More specifically, the fluorescence sorting method includes using flow cytometry to sort the strains to be screened based on the RFP fluorescence intensity.

[0069] The strain to be screened can be a melanin-producing strain with beneficial mutations obtained through adaptive laboratory evolution (ALE).

[0070] The culture medium components involved in the specific embodiments of the present invention are as follows:

[0071] LB (Luria Bertani) liquid medium: peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, sterilized at 121℃ for 20 min.

[0072] LB (Luria Bertani) solid medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, 15 g / L agar powder. Sterilize at 121℃ for 20 min. Cool the solid medium to about 50℃, add the required antibiotics, pour the plate, and let it solidify. Then, place it at 4℃ for later use.

[0073] ALE evolution medium: peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, glucose: 25, 50, 75, 100, 125, 150, 200 g / L; sterilize at 121℃ for 20 min.

[0074] Shake-flask test medium NBS: glucose 50 g / L, KH2PO4 3.5 g / L, K2HPO4·3H2O 6.5 g / L, (NH4)2HPO4 3.5 g / L, MgSO4 0.12 g / L, CaCl2 11 mg / L, thiamine hydrochloride 5 mg / L, FeCl3·6H2O 0.16 mg / L, CoCl2·6H2O 0.2 mg / L, CuSO4·5H2O 0.015 mg / L, Na2MoO4·2H2O 0.02 mg / L, ZnCl2 0.02 mg / L, H3BO3 0.005 mg / L; sterilized at 115℃ for 30 min.

[0075] Fermentation medium: glucose 50 g / L, yeast powder 10 g / L, K2HPO4·3H2O 7.5 g / L, MgSO4·7H2O 4 g / L, citric acid 4 g / L, ammonium sulfate 8 g / L, FeSO4·7H2O 0.002 g / L, phenylalanine 0.5 g / L, serine 0.5 g / L; sterilized at 115℃ for 30 min.

[0076] Trace elements (1000×): CoCl2·6H2O 0.4 g / L, MnSO4·H2O 0.45 g / L, CuSO4·5H2O 0.06 g / L, ZnSO4·7H2O 0.64 g / L, Na2SO4 2 g / L.

[0077] Feeding medium: glucose 750 g / L, MgSO4·7H2O 1 g / L, phenylalanine 3 g / L, tryptophan 3 g / L.

[0078] Unless otherwise specified, in the following examples and comparative examples, the method for transforming plasmids into the series of engineered Escherichia coli strains is electroporation. Electroporation includes the following steps: A suitable amount of plasmid (total amount not exceeding 2000 ng) is aspirated into competent cells and mixed thoroughly, then incubated at low temperature for approximately 8 min. Next, the competent cells are transferred to a pre-chilled electroporation cuvette, electroporated at 1.7 kV for approximately 4 ms, and after two electroporations, immediately added to pre-chilled LB medium, mixed thoroughly, and incubated at 46°C for 6 min. Finally, the cells are incubated at 30°C and 120 rpm in a shaker for 2 h. 100 μL of the bacterial culture is spread onto LB solid medium and incubated at 30°C for 24 h.

[0079] The method for preparing electrocompetent cells is as follows:

[0080] First, pick a single colony of suitable size from the plate and incubate it in 10 mL of LB liquid medium at 37°C and 220 rpm for about 12 h. Then, transfer it to 50 mL of LB liquid medium at a 1% inoculum rate and incubate it at 37°C and 220 rpm until OD reaches the target value. 600 When the concentration reaches approximately 0.5, place the solution on ice for about 25 minutes, then transfer the pre-chilled bacterial culture to a 50 mL pre-chilled centrifuge tube. Centrifuge at 4°C and 4000 rpm for 10 minutes, discard the supernatant, and add 10 mL of pre-chilled CaCl2 to resuspend the cells. Repeat this step four times. Finally, based on the residual bacterial volume, add an equal volume of appropriately pre-chilled 0.1 mol / L calcium chloride solution and 30% glycerol, and quickly aliquot into pre-chilled sterile EP tubes, 100 μL per tube. Store at -80°C after aliquoting.

[0081] The methods for flow cytometry analysis and sorting are as follows:

[0082] Flow cytometry analysis

[0083] Take an appropriate amount of seed culture, centrifuge and discard the supernatant. Wash the bacterial cells 3-4 times with phosphate buffered saline (PBS). Use PBS to precipitate the bacterial suspension at OD500. 600Dilute to approximately 0.15, and take 2 mL of bacterial culture into a BD Falcon flow cytometry tube. First, clean the system tubing with PBS solution, then sequentially inject and analyze the fluorescence intensity of bacteria at different generations. The analytical parameters were: emission wavelength 530 nm, excitation wavelength 488 nm, gate the target region, select channel FL1-H, adjust to appropriate threshold and voltage, and set the number of cells to be collected. Then, use BD CellQuest software to process the data and plot fluorescence intensity curves for different generations of bacteria.

[0084] Flow cytometry cell sorting

[0085] Flow cytometry cell sorting requires bacterial suspension OD 600 At approximately 0.15, set the channel voltages, fluorescence compensation values, pulse types, laser delay times, signal amplification types, and thresholds on the instrument. Configure the required sidescatter (SSC) and forward scatter (FSC) channels, setting the emission wavelength to 530±10 nm and the excitation wavelength to 488 nm. Collect cells at 10,000 cells per second at 70 psi. Circle the areas with high fluorescence intensity in the SSC / FSC plot and collect cells from these areas. After culturing, re-load the collected cells for analysis.

[0086] The collected cells were spread onto kanamycin-resistant seed plates and incubated at 37°C for 24 h. Transformants from the plates were picked and transferred to 24-well plates containing 3 mL of seed culture, and incubated at 37°C and 500 rpm for approximately 24 h. After incubation, the centrifuged cells were washed and resuspended with PBS, and the samples were diluted and added to 96-well plates. The fluorescence intensity per unit cell of different colonies was detected using a microplate reader.

[0087] The fluorescence intensity detection method is as follows:

[0088] Wash the centrifuged bacterial cells 2-3 times with PBS, and then use PBS to measure the OD of the bacterial suspension. 600 Dilute to approximately 0.5%, add 100 μL of solution to a 96-well plate, place the plate in a multi-functional microplate reader, set the emission wavelength to 590 / 9 nm and the excitation wavelength of the yellow fluorescent protein to 488 nm, and detect the fluorescence intensity per unit cell for different colonies. Unit cell fluorescence intensity: (sample fluorescence value – control fluorescence value) / (sample OD) 600 –Compare OD 600 ).

[0089] Methods for detecting and calculating melanin concentration during fermentation:

[0090] Centrifuge the fermentation broth at 12000 rpm for 3 min, dilute the supernatant appropriately, and measure the OD of the supernatant solution using a spectrophotometer. 400 Numerical value. The measured OD 400 Substitute numerical values ​​into OD 400 The melanin concentration in the fermentation broth can be calculated from the melanin concentration standard curve.

[0091] The primers used are shown in Table 1.

[0092] Table 1

[0093]

[0094] Example 1

[0095] This embodiment describes the construction of the genetically engineered bacterium BL21-09-peTMel.

[0096] The engineered bacterium BL21-09-peTMel uses Escherichia coli MEL-09 / pET28a-melC2-melC1 (BL21-09), which can produce 5.6 g / L melanin in shake flasks, as the starting bacterium. The Escherichia coli MEL-09 / pET28a-melC2-melC1 is derived from the patent: A genetically engineered bacterium that produces melanin and its construction method and application (application number: 202511607853.6), which was constructed by Nanjing Hegu Life Biotechnology Co., Ltd. Escherichia coli BL21-09 is based on wild-type Escherichia coli BL21(DE3). It knocks out lactate dehydrogenase ldhA, branching acid mutase and prebenzoic acid dehydratase bifunctional enzyme pheA, pyruvate kinase pykA, and anthranilate synthase subunit trpE to block competitive pathways, and DNA-binding transcription dual regulator tyrR to truncate competitive metabolic pathways. At the same time, it enhances shikimate dehydrogenase aroE, tyrosine transaminase tyrB, glucose transporter galP, transketolase tktA, phosphoenolpyruvate synthase ppsA, and 4-hydroxyphenylacetate 3-hydroxylase complex hpaBC to promote the synthesis of glucose to L-DOPA.

[0097] First, using the Ptet-OFF plasmid as a template, the Ptet fragment (SEQ ID NO.4) was amplified by PCR using Ptet-F / Ptet-R primers. Using plasmid pBR322 as a template, the tetR fragment (SEQ ID NO.2) was amplified by PCR using TetR-F / TetR-R primers. Using the Streptomyces glaucescens genome as a template, the melicC fragment (SEQ ID NO.1) was amplified by PCR using melicC-F / melC-R primers. The RFP gene (SEQ ID NO.3) was synthesized by a commissioned biotechnology company.

[0098] SEQ ID NO.1:

[0099] ATGACCGTTCGTAAGAACCAGGCTTCTCTGACTGCGGACGAAAAACGTCGTTTCGTTGCAGCTGTGTTGGAACTGAAACGTAGCGGTCGTTACGATGCATTCGTGACCACTCACAACGGTTTCATCATGTCCGATATGGACAACAGCGAACGTACCGGTCATCGTTCTCCGTCTTTCTTGCCGTGGCATCGTCGTTTCTTGCTGGACTTCGAACGTGCTCTTCAGTCTGTTGACGCAAGCGTTGCTCTGCCGTACTGGGACTGGACCGCAGATCGTACTGTTCGTGCTTCTCTGTGGGCACCAGACTTTCTGGGTGGTACTGGCCGTTCTTCTGATGGTCGTGTTATGGATGGTCCGTTTGCTGCTGGTGCTGGCAACTGGCCGCTGAACGTGCGTGTAGACGGTCGTACCTACCTGCGTCGTTCTTTGGCGGCTGGTGTTCGTGAACCGCCGACTCGTGCTGAAGTAGACTCCGTACTGGCACTGACCACCTACGATATGGCGCCGTGGAACTCTGCTTCTGACGGTTTCCGTAACCACCTGGAAGGTTGGCGTGGTGTGAACCTGCACAACCGTGTTCACGTGTGGGTTGGTGGTCAGATGGGCACCGGTGTATCTCCAAACGATCCGGTGTTCTGGCTGCACCATGCGTTCATCGACAAACTGTGGGCAGACTGGCAGCGTCGTCATCCGGGTGCAGGTTACGCGCCGACCGGTGGTACTCCAGATGTTGTTGATCTGAACGACACCATGAAACCGTGGAACGATGTTCGTCCGGCAGACCTGCTGGACCACACCAAATTCTACACCTTCGATGTTTAA。

[0100] SEQ ID NO.2:

[0101] ATGGCTAAGCTGGATCGGGAAGCCGTGGTTGGCACCGCACTGGAACTCCTCAACGAAGTTGGCGTCGATGGCCTGACGACGCGCAAGCTCGCCGACCGCCTTGGCGTTCAGCAACCGGCCCTTTACTGGCACTTCCGTAACAAACGCGCATTGCTCGACGCGTTGGCCGAAGCGATGCTGGCGCAGACGCACAGGCGCTCCTTGCCGGTGCAAGGCGAGGACTGGCGTGCGTTCCTGAAAGCGAACGCCCTCAGTTTCCGAAAGGCATTGCTCGCCTACCGCGATGGCGCGCGCATCCATGCCGGTACGCGACCAGCGCCTTCCCAATTTAGCGTGGCAGAGGCGCAAATTCGCTTCTTGTGCGATGCCGGGTTCTCTCCGAAGGACGCCCTTCGAGCGCTGGTGGCGATCAGCCACTACGTTGTGGGCTCCGCTCTGGAACATCAGGCGTCCGAACCAGACTTGACGGAACGCCAGGACGCCGCAATGCCACATGCGTCAACTCCGTCTGCTTTTCTGCAGGACGTTTTCGATGCGTTGAAGGGCGATGGACTGGATGCGGCCTTCGACTATGGCCTGGACTGTCTGATCGCAGGTCTCGAACAGAAACTGCTGACCGCGCAACGTCTTTGA。

[0102] SEQ ID NO.3:

[0103]

[0104] SEQ ID NO.4:

[0105] GATCTCTATCAGTGATAGAGAAAAGTGAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTGTTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAA。

[0106] The plasmid pET28a was digested with NdeI and HindIII restriction endonucleases to obtain the digested vector. The Ptet, tetR, melc, and RFP gene fragments were then digested with EcoRI + BamHI, BamHI + XhoI, XhoI + HindIII, and HindIII restriction endonucleases, respectively. These fragments were then sequentially ligated using T4 ligase and ligated to the digested vector to obtain the recombinant plasmid peTMel (melanin sensor). The successful ligation of the fragments was verified using Ptet-TetR and melc-RFP ligation primers.

[0107] The ligation product was transferred into BL21-09 competent cells via electroporation. The transformed product was plated on LB agar plates containing 50 μg / mL of the ligation solution and incubated at 37°C for 12–16 h. Single colonies were then picked and verified by PCR using Ptet-F and RFP-R primers. Sequencing by a biotechnology company confirmed the successful construction of the genetically engineered strain BL21-09-peTMel.

[0108] Example 2

[0109] This embodiment verifies the melanin response.

[0110] The bacterial strain BL21-09-peTMel was cultured in fermentation medium, and samples were taken every 12 hours to detect the fluorescence intensity of the cells. The results showed that as fermentation progressed, the melanin concentration increased, and the fluorescence intensity of the strain also increased accordingly. Figure 2 This indicates that the intensity of fluorescent protein expression in the melanin sensor is directly proportional to the melanin concentration.

[0111] To avoid interference from melanin precursors in subsequent screening experiments, we also verified the specificity of the melanin sensor. The recombinant plasmid peTMel was transformed into a tyrosine- and L-DOPA-producing strain. The tyrosine-producing strain MEL-08, using *E. coli* BL21(DE3) as the starting strain, was tested using ΔpheA::aroE, ΔptsG::galP, ΔldhA::tyrB, ΔtyrR, and ΔtyrA::tyrA. fbr ,ΔaroF::aroF fbr The L-DOPA-producing strain MEL-10 was obtained using *Escherichia coli* BL21(DE3) as the starting strain via ΔpheA::aroE, ΔptsG::galP, ΔldhA::tyrB, ΔtyrR, and ΔtyrA::tyrA. fbr ,ΔaroF::aroF fbrA series of modifications, including ΔpykA::ppsA, ΔtrpE::tktA, ΔpoxB::hpaBC, and ΔtrpR, were used to achieve a large accumulation of the melanin precursor L-DOPA. The aforementioned MEL-08 and MEL-10 strains are derived from the patent: "A Genetically Engineered Bacterium Producing Melanin and Its Construction Method and Application" (Application No.: 202511607853.6), constructed by Nanjing Hegu Life Biotechnology Co., Ltd. It was found that as fermentation proceeded, the fluorescence intensity of the bacterial cells did not increase and remained at a very low level. Figure 3 This indicates that the sensor has good specificity and can be used for subsequent fluorescence screening of high-melanin-producing strains.

[0112] Example 3

[0113] This embodiment establishes the conditions and processes for adaptive laboratory evolution.

[0114] First, the growth of strain BL21-09-peTMel under different glucose concentrations was investigated. The growth of the strain in LB medium is shown in Table 2.

[0115] Table 2

[0116]

[0117] As shown in Table 1, the growth of the strain was significantly inhibited with increasing sugar concentration. The maximum biomass OD of the strain was highest at 100 g / L glucose. 600 It is 11.75, compared to 25 g / L glucose (OD). 600 =26.47) decreased by 55.61%, indicating that 100 g / L glucose severely inhibited the growth of the strain. Therefore, subsequent studies selected 100 g / L of glucose to be added during the ALE process.

[0118] Subsequently, using BL21-09-peTMel as the starting strain, the strain was passaged in 100 g / L glucose seed medium. Every 24 hours, the strain was inoculated into fresh medium. After 30 days of evolution, the starting strain evolved approximately 2100 generations (E. coli divides approximately 72 times in 24 hours). During this period, the strain was preserved every 3 days (approximately 216 generations) for subsequent FACS high-throughput screening. The biomass of the strain during passage was as follows: Figure 3 As shown.

[0119] Depend on Figure 4It can be seen that the growth of the strain was inhibited when inoculated into a high-concentration glucose medium. After an adaptation period of about 600 generations in 8 days, the strain began to adapt to a glucose concentration of 100 g / L. However, starting from 24 days (1728 generations), the biomass of the strain began to decline. It is speculated that this may be due to excessive number of passages, which caused the proportion of harmful mutants in the strain to gradually increase. Therefore, the passage study was stopped after 2100 generations.

[0120] Example 4

[0121] This embodiment utilizes flow cytometry fluorescence sorting to screen target strains.

[0122] The strain used was a strain evolved from BL21-09-peTMel through ALE. The melanin produced by the strain can be characterized by fluorescence intensity. Therefore, high-throughput fluorescence screening (FACS) can be used to screen for evolved strains with high fluorescence intensity. High fluorescence intensity indicates high intracellular melanin content and the strain has the potential to produce high levels of melanin, which can be used for subsequent fermentation verification.

[0123] The FACS steps are as follows: First, the preserved evolutionary strains are activated and cultured according to the above-mentioned strain activation method. Then, the first sorting is performed according to the above-mentioned flow cytometry sorting method, and the strains with the top 5% fluorescence intensity are selected in the first screening. Figure 5 In the P4 region, the collected strains were spread onto seed plates containing kanamycin sulfate resistance and incubated at 37°C for 24 h. Colonies were then picked and cultured in 24-well plates, and the samples were loaded again for sorting. This time, the top 1% of strains in the P4 region were collected. Figure 6 The collected strain was then spread again onto a plate containing the antibiotic. Next, 30 single colonies grown from the plate were placed in 24-well plates for incubation. The fluorescence intensity of each colony was then detected using a microplate reader. The results are as follows: Figure 7 As shown in Table 3, the melanin production of 15 strains with high fluorescence intensity was subjected to a fourth round of screening in shake-flask horizontal fermentation. BL21-09-peTMel-ALE-1 represents single colony 1 marked on the screening plate, BL21-09-peTMel-ALE-2 represents single colony 2 marked on the screening plate, BL21-09-peTMel-ALE-3 represents single colony 3 marked on the screening plate, and so on.

[0124] Table 3

[0125]

[0126] As shown in Table 3, BL21-09-peTMel-ALE-10 had the best yield, and this strain was used as the fermentation strain for subsequent fermentation optimization in the fermenter.

[0127] Example 5

[0128] This embodiment provides a fermentation method for synthesizing melanin, which includes the following steps:

[0129] (1) Plate activation: Take the strain BL21-09-peTMel-ALE-10 stored at -80℃, melt it, streak it on solid LB medium, and then incubate it in a 37℃ incubator for 24 h.

[0130] (2) Primary seed culture: Use a sterile inoculation loop to pick up one loop of activated colonies from a plate and inoculate them into LB liquid medium. Incubate at 37°C and 200 rpm for 14 h.

[0131] (3) Secondary seed culture: The activated bacterial solution was inoculated into the secondary seed culture medium at a 5% inoculum. Cultured at 37℃ and 200 rpm for 10 h;

[0132] (4) Transfer 200 mL of the secondary seed culture at a 10% inoculum to a 5 L fermenter containing 2 L of fermentation medium for the first stage of fermentation. The pH is controlled at 7, the temperature at 30℃, the initial aeration ratio at 1.5 vvm, the initial rotation speed at 200 rpm, dissolved oxygen-coupled stirring, and dissolved oxygen (DO) controlled at 20%. Under these conditions, the OD is cultured... 600 When the temperature reaches 20-30°C, add 0.1 mM IPTG inducer.

[0133] (5) After 16 h, adjust the fermentation parameters to maintain dissolved oxygen (DO) at 50% and pH at 6.8. The residual sugar concentration in the fermentation system is controlled at approximately 25 g / L by adding glucose solution. Fermentation is completed after 48 h to obtain the melanin fermentation broth. The maximum biomass OD during fermentation was measured. 600 The value was 310, and the melanin production was 24.46 g / L.

[0134] Example 6

[0135] This embodiment provides a fermentation method for synthesizing melanin, which includes the following steps:

[0136] (1) Plate activation: Take the strain BL21-09-peTMel-ALE-10 stored at -80℃, melt it, streak it on solid LB medium, and then incubate it in a 37℃ incubator for 24 h.

[0137] (2) Primary seed culture: Use a sterile inoculation loop to pick up one loop of activated colonies from a plate and inoculate them into LB liquid medium. Incubate at 37°C and 200 rpm for 14 h.

[0138] (3) Secondary seed culture: The activated bacterial solution was inoculated into the secondary seed culture medium at a 5% inoculum rate. Cultured at 37℃ and 200 rpm for 10 h;

[0139] (4) Transfer 200 mL of the secondary seed culture at a 10% inoculum to a 5 L fermenter containing 2 L of fermentation medium for the first stage of fermentation. The pH was controlled at 7, the temperature at 30℃, the initial aeration ratio at 1.5 vvm, the initial rotation speed at 200 rpm, dissolved oxygen-coupled stirring, and dissolved oxygen (DO) controlled at 20%. Under these conditions, the OD was cultured... 600 When the temperature reaches 20-30°C, add 0.1 mM IPTG inducer.

[0140] (5) After 16 h, adjust the fermentation parameters to maintain dissolved oxygen (DO) at 50% and pH at 6.8. The residual sugar concentration in the fermentation system is controlled at approximately 20 g / L by adding glucose solution. Fermentation is completed after 48 h to obtain the melanin fermentation broth. The maximum biomass OD during fermentation was measured. 600 The value was 332, and the melanin production was 26.61 g / L.

[0141] Example 7

[0142] (1) Plate activation: Take the strain BL21-09-peTMel-ALE-10 stored at -80℃, melt it, streak it on solid LB medium, and then incubate it in a 37℃ incubator for 24 h.

[0143] (2) Primary seed culture: Use a sterile inoculation loop to pick up one loop of activated colonies from a plate and inoculate them into LB liquid medium. Incubate at 37°C and 200 rpm for 14 h.

[0144] (3) Secondary seed culture: The activated bacterial solution was inoculated into the secondary seed culture medium at a 5% inoculum rate. Cultured at 37℃ and 200 rpm for 10 h;

[0145] (4) Transfer 200 mL of the secondary seed culture at a 10% inoculum to a 5 L fermenter containing 2 L of fermentation medium for the first stage of fermentation. The pH was controlled at 7, the temperature at 30℃, the initial aeration ratio at 1.5 vvm, the initial rotation speed at 200 rpm, dissolved oxygen-coupled stirring, and dissolved oxygen (DO) controlled at 20%. Under these conditions, the OD was cultured... 600 When the temperature reaches 20-30°C, add 0.1 mM IPTG inducer.

[0146] (5) After 16 h, adjust the fermentation parameters to maintain dissolved oxygen (DO) at 50% and pH at 6.8. The residual sugar concentration in the fermentation system is controlled at approximately 15 g / L by adding glucose solution. Fermentation is terminated after 48 h. The results are as follows: Figure 8As shown, the maximum biomass OD during fermentation 600 The value was 442, and the melanin production was 29.04 g / L.

[0147] In summary, this invention designs a gene expression cassette with a specific structure that responds to intracellular melanin. This cassette can be further used to construct a melanin biosensor with good specificity. After expression in melanin-producing strains, intracellular melanin concentration can be characterized, enabling high-throughput screening of strains. Furthermore, ALE evolution was performed on the melanin-producing strains, and high-throughput screening was conducted based on the designed sensor to obtain high-melanin-producing strains. The strains, after being cultured in shake flasks and 5L fermenters, achieved melanin yields of 10.84 g / L and 29.04 g / L, respectively, representing increases of 93.57% and 60% compared to the starting strain BL21-09. The ALE evolution method used is environmentally friendly, non-toxic, and high-throughput, achieving efficient mutation of the strains. Simultaneously, the fluorescence screening (FACS) method offers high throughput and efficiency, significantly shortening the time required for traditional plate screening. This provides an efficient and feasible solution for large-scale melanin production.

[0148] The inventors declare that the above description is only a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily conceived by those skilled in the art within the scope of the technology disclosed in the present invention fall within the scope of protection and disclosure of the present invention.

Claims

1. A gene expression cassette, characterized in that, The gene expression cassette includes a regulatory gene, a melanin-responsive promoter, and a reporter gene, wherein the reporter gene is located downstream of the melanin-responsive promoter and is regulated by the melanin-responsive promoter; The regulatory genes include tyrosinase genes and transcriptional repressor protein genes.

2. The gene expression cassette according to claim 1, characterized in that, The melanin response promoter, transcriptional repressor protein gene, tyrosinase gene and reporter gene are sequentially linked, or the regulatory gene is expressed in a different gene expression cassette than the melanin response promoter and reporter gene. Optionally, the nucleic acid sequence of the tyrosinase gene includes the sequence shown in SEQ ID NO.1; Optionally, the nucleic acid sequence of the transcriptional repressor protein gene includes the sequence shown in SEQ ID NO.

2.

3. The gene expression cassette according to claim 1 or 2, characterized in that, The melanin-responsive promoter includes the Ptet promoter; The nucleic acid sequence of the Ptet promoter includes the sequence shown in SEQ ID NO.4; The reporter gene includes a fluorescent protein gene; The fluorescent protein gene includes a red fluorescent protein gene or a green fluorescent protein gene; The nucleic acid sequence of the red fluorescent protein gene includes the sequence shown in SEQ ID NO.

3.

4. A recombinant expression vector, characterized in that, The recombinant expression vector contains the gene expression cassette according to any one of claims 1-3.

5. A recombinant cell, characterized in that, The recombinant cells contain the gene expression cassette according to any one of claims 1-3 or the recombinant expression vector according to claim 4.

6. The use of the gene expression cassette according to any one of claims 1-3, the recombinant expression vector according to claim 4, or the recombinant cell according to claim 5 in screening strains that produce melanin.

7. A method for screening melanin-producing strains, characterized in that, The method includes expressing the gene expression cassette of any one of claims 1-3 in a melanin-producing strain, screening strains with high expression of the reporter gene based on the expression signal of the reporter gene, and obtaining a high-melanin-producing strain.

8. A method for preparing a melanin mutant strain, characterized in that, The preparation method involves continuous subculturing to induce spontaneous gene mutations in the melanin-producing strain. The glucose concentration in the culture medium used for continuous subculture is 90-110 g / L.

9. The method for preparing the melanin mutant strain according to claim 8, characterized in that, The preparation method further includes screening the mutated strain using the method for screening melanin-producing strains as described in claim 7.

10. A melanin-producing engineered strain, characterized in that, The melanin-producing engineered strain is obtained by the method for preparing the melanin mutant strain according to claim 8.

11. A method for producing melanin, characterized in that, The method includes fermenting the melanin-producing engineered strain according to claim 10, separating and purifying the culture, and obtaining the melanin.

Images