Rapid NGS detection kit for lung cancer and colon cancer
By designing an NGS detection kit containing multiple gene primers and combining PCR and NGS technologies, the problems of complex procedures and low sensitivity of existing NGS technologies have been solved, enabling rapid and accurate detection of gene mutations, which is suitable for the diagnosis and treatment of lung cancer and colon cancer.
Patent Information
- Application Number
- CN202311867743.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2023-12-27
- Publication Date
- 2026-03-03
AI Technical Summary
Existing NGS technology is complex, difficult to operate, has low sensitivity, and insufficient data analysis accuracy when detecting gene mutations, making it difficult to effectively detect low-frequency mutations.
A rapid NGS detection kit for lung and colon cancer has been designed, containing primers and an NGS linker targeting multiple genes. It can detect multiple genes at once using PCR and NGS technologies. The primer set is in the same reaction space and does not interfere with each other. The combination of PCR and NGS sequencing technologies improves detection efficiency and sensitivity.
It enables rapid, highly sensitive, and highly specific gene mutation detection, shortens detection time, and improves detection efficiency and accuracy. It is applicable to various lung cancer and colon cancer tissue samples, and provides comprehensive and quantifiable detection results to support clinical diagnosis and treatment decisions.
Smart Images

Figure CN121592772A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of lung cancer and colon cancer detection technology, specifically to a rapid NGS detection kit for lung cancer and colon cancer. Background Technology
[0002] NGS (Non-Geometry) is a high-throughput gene sequencing technology that can simultaneously detect sequence variations in multiple genes in a single experiment. However, existing NGS technologies have several limitations in detecting gene mutations. First, NGS experiments are complex and difficult to perform, requiring a high level of skill from the researchers. Second, existing NGS methods have low sensitivity when detecting low-frequency mutations, making them prone to missed detections. Furthermore, the accuracy of existing NGS data analysis methods in identifying gene mutations needs improvement.
[0003] Therefore, there is an urgent need for a kit that can perform simultaneous detection of multiple genes by combining primers for multiple genes in one reaction space for detection without interference. Summary of the Invention
[0004] To address the problems of existing technologies, this invention provides a rapid NGS detection kit for lung and colon cancer.
[0005] To solve the above-mentioned technical problems, the present invention is achieved through the following technical solution: a rapid NGS detection kit for lung and colon cancer, wherein the detection kit contains the following genes, primers, and NGS linker:
[0006] Gene: BRAF; Mutation location: V600;
[0007] Forward primer: ACTCTTCATAATGCTTGCTCTGA;
[0008] Reverse primer (primer + NGS linker):
[0009] TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGACTCTTCATAATGCTTGCTCTGA;
[0010] Primer volume: 1.2;
[0011] Gene: BRAF; Mutation location: V600;
[0012] Forward primer: CTGTTCAAACTGATGGGACCC;
[0013] Reverse primer (primer + NGS linker):
[0014] GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCTGTTCAAACTGATGGGACCC;
[0015] Primer volume: 1.2;
[0016] Gene: EGFR; Mutation location: G719A / C / S;
[0017] Forward primer: GTGGAGCCTCTTACACCCAG;
[0018] Reverse primer (primer + NGS linker):
[0019] TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGGAGCCTCTTACACCCAG;
[0020] Primer volume: 0.8;
[0021] Gene: EGFR; Mutation location: G719A / C / S;
[0022] Forward primer: ACCTTATACACCGTGCCGAA;
[0023] Reverse primer (primer + NGS linker):
[0024] GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGACCTTATACACCGTGCCGAA;
[0025] Primer volume: 0.8;
[0026] Gene: EGFR; Mutation location:
[0027] Del9 / 12 / 15 / 18 / 21 / 24;
[0028] Forward primer: CGTCTTCCTTCTCTCTCTGTCA;
[0029] Reverse primer (primer + NGS linker):
[0030] TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCGTCTTCCTTCTCTCCTGTCA;
[0031] Primer volume: 1.3;
[0032] Gene: EGFR; Mutation location:
[0033] Del9 / 12 / 15 / 18 / 21 / 24;
[0034] Forward primer: CCCACACAGCAAAGCAGAAA;
[0035] Reverse primer (primer + NGS linker):
[0036] GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCCCACACAGCAAAGCAGAAA;
[0037] Primer volume: 1.3;
[0038] Gene: EGFR; Mutation location: T790M / S768I / INS;
[0039] Forward primer: CTGACGTGCCTCTCCCTC;
[0040] Reverse primer (primer + NGS linker):
[0041] TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCTGACGTGCCTCTCCCTC;
[0042] Primer volume: 1;
[0043] Gene: EGFR; Mutation location: T790M / S768I / INS;
[0044] Forward primer: TGTCTTTGTGTTCCCGGACA;
[0045] Reverse primer (primer + NGS linker):
[0046] GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTGTCTTTGTGTTCCCGGACA;
[0047] Primer volume: 1;
[0048] Gene: EGFR; Mutation location: L858R / L861Q;
[0049] Forward primer: TTCTTTCTCTTCCGCACCCA;
[0050] Reverse primer (primer + NGS linker):
[0051] GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTTCTTTCTCTTCCGCACCCA;
[0052] Primer volume: 1;
[0053] Forward primer: GGCCTTGTACTGCAGAGACA;
[0054] Reverse primer (primer + NGS linker):
[0055] GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGCCTTGTACTGCAGAGACA;
[0056] Primer volume: 1;
[0057] Gene: KRAS; Mutation location: G12 / 13;
[0058] Forward primer: GGCCTGCTGAAAATGACTGA;
[0059] Reverse primer (primer + NGS linker):
[0060] TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGGCCTGCTGAAAATGACTGA;
[0061] Primer volume: 0.8;
[0062] Gene: KRAS; Mutation location: G12 / 13;
[0063] Forward primer: TAGCTGTATCGTCAAGGCAC;
[0064] Reverse primer (primer + NGS linker):
[0065] GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTAGCTGTATCGTCAAGGCAC;
[0066] Primer volume: 0.8;
[0067] Gene: KRAS; Mutation location: A59 / Q61;
[0068] Forward primer: TCCAGACTGTGTTTCTCCCT;
[0069] Reverse primer (primer + NGS linker):
[0070] TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTCCAGACTGTGTTCCTCCCT;
[0071] Primer volume: 1;
[0072] Gene: KRAS; Mutation location: A59 / Q61;
[0073] Forward primer: TGGTCCCTCATTGCACTGTA;
[0074] Reverse primer (primer + NGS linker):
[0075] GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTGGTCCCTCATTGCACTGTA;
[0076] Primer volume: 1;
[0077] Gene: KRAS; Mutation location: K117-A145;
[0078] Forward primer: GGACTCTGAAGATGTACCTATGG;
[0079] Reverse primer (primer + NGS linker):
[0080] TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGGACTCTGAAGATGTACCTATGG;
[0081] Primer volume: 2;
[0082] Gene: KRAS; Mutation location: K117-A145;
[0083] Forward primer: TCAGTGTTACTTACCTGTCTTGT;
[0084] Reverse primer (primer + NGS linker):
[0085] GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTCAGTGTTACTTACCTGTCTTGT;
[0086] Primer volume: 2;
[0087] Gene: KRAS; Mutation location: G12 / 13;
[0088] Forward primer: CAAACTGGTGGTGGTTGGAG;
[0089] Reverse primer (primer + NGS linker):
[0090] TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCAAACTGGTGGTGGTTGGAG;
[0091] Primer volume: 1.2;
[0092] Gene: KRAS; Mutation location: G12 / 13;
[0093] Forward primer: CTGGATTGTCAGTGCGCTTT;
[0094] Reverse primer (primer + NGS linker):
[0095] GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCTGGATTGTCAGTGCGCTTT;
[0096] Primer volume: 1.2;
[0097] Primer volume: 2;
[0098] Gene: KRAS; Mutation location: K117-A145;
[0099] Forward primer: TCAGTGTTACTTACCTGTCTTGT;
[0100] Reverse primer (primer + NGS linker):
[0101] GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTCAGTGTTACTTACCTGTCTTGT;
[0102] Primer volume: 2;
[0103] Gene: KRAS; Mutation location: G12 / 13;
[0104] Forward primer: CAAACTGGTGGTGGTTGGAG;
[0105] Reverse primer (primer + NGS linker):
[0106] TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCAAACTGGTGGTGGTTGGAG;
[0107] Primer volume: 1.2;
[0108] Gene: KRAS; Mutation location: G12 / 13;
[0109] Forward primer: CTGGATTGTCAGTGCGCTTT;
[0110] Reverse primer (primer + NGS linker):
[0111] GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCTGGATTGTCAGTGCGCTTT;
[0112] Primer volume: 1.2;
[0113] Gene: KRAS; Mutation location: A59-Q61;
[0114] Forward primer: CCTTACCCTCCACACCCC;
[0115] Reverse primer (primer + NGS linker):
[0116] TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTTACCCTCCACACCCC;
[0117] Primer volume: 0.7;
[0118] Gene: KRAS; Mutation location: k117-A146;
[0119] Forward primer: CCTATGGTGCTAGTGGGAAAC;
[0120] Reverse primer (primer + NGS linker):
[0121] TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTATGGTGCTAGTGGGAAAC;
[0122] Primer volume: 1;
[0123] Gene: KRAS mutation location: k117-A146;
[0124] Forward primer: AAGCTGTACCATACCTGTCTG;
[0125] Reverse primer (primer + NGS linker):
[0126] GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGAAGCTGTACCATACCTGTCTG;
[0127] Primer volume: 1;
[0128] Gene: EGFR; Mutation location: s492;
[0129] Forward primer: GGAGATAAGTGATGGAGATGTGA;
[0130] Reverse primer (primer + NGS linker):
[0131] TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGGAGATAAGTGATGGAGATGTGA;
[0132] Primer volume: 1.4;
[0133] Gene: EGFR; Mutation location: s492;
[0134] Forward primer: TGCAGCTGTTTTCACCTCTG;
[0135] Reverse primer (primer + NGS linker):
[0136] GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTGCAGCTGTTTTCACCTCTG;
[0137] Primer volume: 1.4.
[0138] Preferably, the detection kit is used for next-generation sequencing detection of genes contained in lung cancer, colorectal cancer, etc., and can achieve rapid, efficient and accurate NGS detection.
[0139] A rapid NGS detection kit for lung and colon cancer, with the following specific detection process: Step 1, PCR1
[0140] process:
[0141] A. 6.25 μL Qiagen 4x MM and 4 μL primer mixture (7.5 pM);
[0142] B. Add 10-500 ng of DNA;
[0143] C. Add ddH2O to a total reaction volume of 25 μL;
[0144] D. Briefly centrifuge to mix thoroughly;
[0145] PCR1 procedure:
[0146] Initial denaturation: 95℃ for 15 minutes; extension amplification: 97℃ for 30 seconds; 16 cycles; then, 58℃ for 1 minute and 72℃ for 30 seconds; termination: 72℃ for 5 minutes;
[0147] Step 2, dilution:
[0148] Take 2 μL of PCR 1 product and dilute it with 198 μL of ddH2O;
[0149] Step 3, PCR 2 (barcode)
[0150] Primers
[0151] CAAGCAGAGAGGCATACGAGAT (barcode)GTCTCGTGGCTCGG
[0152] AATGATACGGCGACCACCGAGATCTACAC [Barcode]
[0153] TCGTCGGCAGCGTC;
[0154] process:
[0155] A. 6.25μL Qiagen 4x MM;
[0156] B.1ul barcode primer mixture (7.5pM);
[0157] C.5ul diluted PCR1 product;
[0158] D. Add ddH2O to a total reaction volume of 25 μL, and briefly centrifuge to mix thoroughly;
[0159] PCR2 procedure:
[0160] Initial denaturation: 95℃ for 15 minutes; extension amplification: 97℃ for 30 seconds, 4 cycles, then 58℃ for 1 minute and 72℃ for 30 seconds, then 97℃ for 30 seconds, 16 cycles, then 68℃ for 30 seconds and 72℃ for 30 seconds; termination: 72℃ for 5 minutes;
[0161] Step four, purification.
[0162] Purification was performed according to standard procedures, followed by NGS detection.
[0163] The beneficial effects of this invention are as follows:
[0164] 1. The rapid NGS detection kit for lung and colon cancer of this invention has beneficial effects such as speed, high sensitivity, high specificity, comprehensive detection, convenience, wide applicability, and quantifiable results. It provides clinicians and patients with a rapid, accurate, and effective detection method, aiding in the diagnosis and treatment decisions for lung and colon cancer. This kit covers primer pairs targeting multiple mutation sites of genes related to lung and colon cancer, enabling comprehensive detection of these gene mutations. This helps doctors gain a more comprehensive understanding of the patient's condition, providing more information for developing treatment plans, thereby improving detection efficiency and reducing detection costs.
[0165] 2. This invention enables the simultaneous detection of 14 genes, allowing primers for multiple genes to be grouped in the same reaction space without interference. Combining PCR and NGS technologies, it can rapidly detect gene mutations in lung and colon cancer within a short time, significantly shortening detection time and improving diagnostic efficiency. Furthermore, primer pairs designed for multiple gene mutation sites and NGS sequencing of PCR products enhance detection sensitivity. This means that even small amounts of mutated DNA can be accurately detected.
[0166] 3. The specific design of the primer pairs enables this kit to accurately identify target DNA fragments and distinguish them from normal gene sequences. This helps avoid false positive results, improves detection accuracy, and the kit is suitable for testing various types of lung cancer and colon cancer tissue samples, including but not limited to surgically removed tissue, biopsy samples, and cytological samples. This makes the kit widely applicable and can meet diverse clinical needs. Attached Figure Description
[0167] Figure 1 This is a schematic diagram of the overall operation process of the present invention. Detailed Implementation
[0168] Example 1: A rapid NGS detection kit for lung and colon cancer, using primer pairs and an NGS linker in the kit to detect lung cancer tissue samples.
[0169] Sample collection and DNA extraction: We collected tumor tissue samples from a lung cancer patient.
[0170] Step 1, PCR1
[0171] process:
[0172] A. 6.25 μL Qiagen UPC Multiplex Master mix (cat: 206742) and 4 μL primer mixture (7.5 pM);
[0173] B. Add 10-500 ng of DNA;
[0174] C. Add ddH2O to a total reaction volume of 25 μL;
[0175] D. Briefly centrifuge to mix thoroughly;
[0176] PCR1 procedure:
[0177] Initial denaturation: 95℃ for 15 minutes; extension amplification: 97℃ for 30 seconds; 16 cycles; then, 58℃ for 1 minute and 72℃ for 30 seconds; termination: 72℃ for 5 minutes;
[0178] Step 2, dilution:
[0179] Take 2 μL of PCR 1 product and dilute it with 198 μL of ddH2O;
[0180] Step 3, PCR 2 (barcode)
[0181] Primers
[0182] CAAGCAGAGAGGCATACGAGAT (barcode)GTCTCGTGGCTCGG
[0183] AATGATACGGCGACCACCGAGATCTACAC (barcode)TCGTCGGCAGCGTC;
[0184] process:
[0185] A.6.25μL Qiagen UPC Multiplex Master mix (cat: 206742);
[0186] B.1ul barcode primer mixture (7.5pM);
[0187] C.5ul diluted PCR1 product;
[0188] D. Add ddH2O to a total reaction volume of 25 μL, and briefly centrifuge to mix thoroughly;
[0189] PCR2 procedure:
[0190] Initial denaturation: 95℃ for 15 minutes; extension amplification: 97℃ for 30 seconds, 4 cycles, then 58℃ for 1 minute and 72℃ for 30 seconds, then 97℃ for 30 seconds, 16 cycles, then 68℃ for 30 seconds and 72℃ for 30 seconds; termination: 72℃ for 5 minutes;
[0191] Step four, purification.
[0192] Purification was performed according to the standard procedure for Agencourt AMPure XP (cat: 10136224) procotol, followed by NGS detection.
[0193] Primer design and PCR amplification: PCR reactions were designed using the primer pairs and NGS linker provided in the kit. In the PCR reaction, we used appropriate amounts of template DNA, primer pairs, and the NGS linker, as well as other necessary PCR reagents. Through the PCR reaction, we successfully amplified the target DNA fragment.
[0194] NGS sequencing: The amplified DNA fragments are sequenced using an NGS sequencer. During the sequencing process, the NGSlinker successfully attaches the DNA fragments to the surface of the sequencer and performs multiple cycles of sequencing to obtain the sequence information for each DNA fragment.
[0195] Data Analysis: Through in-depth analysis of the sequencing data, we discovered a mutation in the EGFR gene in this sample. Based on the specificity of the primer pairs, we identified the sequence of the target DNA fragment and compared its differences with the normal gene sequence. We found that the sample contained a mutation in the EGFR gene, specifically a mutation at the S492 site.
[0196] Interpretation of Results: Based on the data analysis, we can conclude that the lung cancer tissue sample contains a mutation in the EGFR gene. Doctors can formulate appropriate treatment plans based on this result.
[0197] Example 2: A rapid NGS detection kit for lung and colon cancer, using primer pairs and NGS linker in the kit to detect colon cancer tissue samples.
[0198] Sample collection and DNA extraction: We collected tumor tissue samples from a colon cancer patient.
[0199] Step 1, PCR1
[0200] process:
[0201] A. 6.25 μL Qiagen UPC Multiplex Master mix (cat: 206742) and 4 μL primer mixture (7.5 pM);
[0202] B. Add 10-500 ng of DNA;
[0203] C. Add ddH2O to a total reaction volume of 25 μL;
[0204] D. Briefly centrifuge to mix thoroughly;
[0205] PCR1 procedure:
[0206] Initial denaturation: 95℃ for 15 minutes; extension amplification: 97℃ for 30 seconds; 16 cycles; then, 58℃ for 1 minute and 72℃ for 30 seconds; termination: 72℃ for 5 minutes;
[0207] Step 2, Dilution: Take 2 μL of PCR 1 product and dilute it with 198 μL of ddH2O;
[0208] Step 3, PCR 2 (barcode)
[0209] Primers
[0210] CAAGCAGAGAGGCATACGAGAT (barcode)GTCTCGTGGCTCGG
[0211] AATGATACGGCGACCACCGAGATCTACAC [Barcode] TCGTCGGCAGCGTC;
[0212] process:
[0213] A.6.25μL Qiagen UPC Multiplex Master mix (cat: 206742);
[0214] B.1ul barcode primer mixture (7.5pM);
[0215] C.5ul diluted PCR1 product;
[0216] D. Add ddH2O to a total reaction volume of 25 μL, and briefly centrifuge to mix thoroughly;
[0217] PCR2 procedure:
[0218] Initial denaturation: 95℃ for 15 minutes; extension amplification: 97℃ for 30 seconds, 4 cycles, then 58℃ for 1 minute and 72℃ for 30 seconds, then 97℃ for 30 seconds, 16 cycles, then 68℃ for 30 seconds and 72℃ for 30 seconds; termination: 72℃ for 5 minutes;
[0219] Step four, purification.
[0220] Purification was performed according to the standard procedure for Agencourt AMPure XP (cat: 10136224) procotol, followed by NGS detection.
[0221] Primer design and PCR amplification: PCR reactions were designed using the primer pairs and NGS linker provided in the kit. In the PCR reaction, we used appropriate amounts of template DNA, primer pairs, and the NGS linker, as well as other necessary PCR reagents. Through the PCR reaction, we successfully amplified the target DNA fragment.
[0222] NGS sequencing: The amplified DNA fragments are sequenced using an NGS sequencer. During the sequencing process, the NGSlinker successfully attaches the DNA fragments to the surface of the sequencer and performs multiple cycles of sequencing to obtain the sequence information for each DNA fragment.
[0223] Data Analysis: Through in-depth analysis of the sequencing data, we discovered a mutation in the KRAS gene in this sample. Based on the specificity of the primer pairs, we identified the sequence of the target DNA fragment and compared it with the normal gene sequence. We found a mutation in the KRAS gene, specifically a mutation at the A59-Q61 site.
[0224] Interpretation of Results: Based on the data analysis, we can conclude that the colon cancer tissue sample contains a mutation in the KRAS gene. Doctors can use this result to develop an appropriate treatment plan.
[0225] In summary, the present invention has the following working principle: In use, compared with the traditional NGS method which measures one gene at a time, this method can measure 14 genes in one test. The cost and time are equivalent to the original detection time and cost of one gene. Primers that can produce results quickly are selected from many primers through many experiments. In many experiments, primers for multiple genes are grouped in one reaction space without interference, which can produce reliable results, greatly improving detection efficiency and reducing detection costs. This completes the overall workflow of the device.
Claims
1. A rapid NGS detection kit for lung and colon cancer, characterized in that: The detection kit contains the following genes, primers, and NGS linker: Gene: BRAF; Mutation location: V600; Forward primer: ACTCTTCATAATGCTTGCTCTGA; Reverse primer (primer + NGS linker): TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGACTCTTCATAATGCTTGCTCTGA; Primer volume: 1.2; Gene: BRAF; Mutation location: V600; Forward primer: CTGTTCAAACTGATGGGACCC; Reverse primer (primer + NGS linker): GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCTGTTCAAACTGATGGGACCC; Primer volume: 1.2; Gene: EGFR; Mutation location: G719A / C / S; Forward primer: GTGGAGCCTCTTACACCCAG; Reverse primer (primer + NGS linker): TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGGAGCCTCTTACACCCAG; Primer volume: 0.8; Gene: EGFR; Mutation location: G719A / C / S; Forward primer: ACCTTATACACCGTGCCGAA; Reverse primer (primer + NGS linker): GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGACCTTATACACCGTGCCGAA; Primer volume: 0.8; Gene: EGFR; Mutation location: Del9 / 12 / 15 / 18 / 21 / 24; Forward primer: CGTCTTCCTTCTCTCTCTGTCA; Reverse primer (primer + NGS linker): TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCGTCTTCCTTCTCTCCTGTCA; Primer volume: 1.3; Gene: EGFR; Mutation location: Del9 / 12 / 15 / 18 / 21 / 24; Forward primer: CCCACACAGCAAAGCAGAAA; Reverse primer (primer + NGS linker): GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCCCACACAGCAAAGCAGAAA; Primer volume: 1.3; Gene: EGFR; Mutation location: T790M / S768I / INS; Forward primer: CTGACGTGCCTCTCCCTC; Reverse primer (primer + NGS linker): TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCTGACGTGCCTCTCCCTC; Primer volume: 1; Gene: EGFR; Mutation location: T790M / S768I / INS; Forward primer: TGTCTTTGTGTTCCCGGACA; Reverse primer (primer + NGS linker): GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTGTCTTTGTGTTCCCGGACA; Primer volume: 1; Gene: EGFR; Mutation location: L858R / L861Q; Forward primer: TTCTTTCTCTTCCGCACCCA; Reverse primer (primer + NGS linker): GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTTCTTTCTCTTCCGCACCCA; Primer volume: 1; Gene: IDH1; Mutation location: R132; Forward primer: GGCTTGTGAGTGGATGGGTA; Reverse primer (primer + NGS linker): TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGGCTTGTGAGTGGATGGGTA; Primer volume: 0.8; Gene: IDH1; Mutation location: R132; Forward primer: AGTTGGAAATTTCTGGGCCA; Reverse primer (primer + NGS linker): GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGAGTTGGAAATTTCTGGGCCA; Primer volume: 0.8; Gene: IDH2; Mutation location: R172; Forward primer: GACCAAGCCCATCACCATTG; Reverse primer (primer + NGS linker): TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGACCAAGCCCATCACCATTG; Primer volume: 1; Gene: IDH2; Mutation location: R172; Forward primer: GGCCTTGTACTGCAGAGACA; Reverse primer (primer + NGS linker): GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGCCTTGTACTGCAGAGACA; Primer volume: 1; Gene: KRAS; Mutation location: G12 / 13; Forward primer: GGCCTGCTGAAAATGACTGA; Reverse primer (primer + NGS linker): TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGGCCTGCTGAAAATGACTGA; Primer volume: 0.8; Gene: KRAS; Mutation location: G12 / 13; Forward primer: TAGCTGTATCGTCAAGGCAC; Reverse primer (primer + NGS linker): GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTAGCTGTATCGTCAAGGCAC; Primer volume: 0.8; Gene: KRAS; Mutation location: A59 / Q61; Forward primer: TCCAGACTGTGTTTCTCCCT; Reverse primer (primer + NGS linker): TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTCCAGACTGTGTTCCTCCCT; Primer volume: 1; Gene: KRAS; Mutation location: A59 / Q61; Forward primer: TGGTCCCTCATTGCACTGTA; Reverse primer (primer + NGS linker): GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTGGTCCCTCATTGCACTGTA; Primer volume: 1; Gene: KRAS; Mutation location: K117-A145; Forward primer: GGACTCTGAAGATGTACCTATGG; Reverse primer (primer + NGSlinker): TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGGACTCTGAAGATGTACCTATGG; Primer volume: 2; Gene: KRAS; Mutation location: K117-A145; Forward primer: TCAGTGTTACTTACCTGTCTTGT; Reverse primer (primer + NGS linker): GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTCAGTGTTACTTACCTGTCTTGT; Primer volume: 2; Gene: KRAS; Mutation location: G12 / 13; Forward primer: CAAACTGGTGGTGGTTGGAG; Reverse primer (primer + NGS linker): TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCAAACTGGTGGTGGTTGGAG; Primer volume: 1.2; Gene: KRAS; Mutation location: G12 / 13; Forward primer: CTGGATTGTCAGTGCGCTTT; Reverse primer (primer + NGS linker): GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGCTGGATTGTCAGTGCGCTTT; Primer volume: 1.2; Gene: KRAS; Mutation location: A59-Q61; Forward primer: CCTTACCCTCCACACCCC; Reverse primer (primer + NGS linker): TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTTACCCTCCACACCCC; Primer volume: 0.7; Gene: KRAS; Mutation location: k117-A146; Forward primer: CCTATGGTGCTAGTGGGAAAC; Reverse primer (primer + NGS linker): TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTATGGTGCTAGTGGGAAAC; Primer volume: 1; Gene: KRAS; Mutation location: k117-A146; Forward primer: AAGCTGTACCATACCTGTCTG; Reverse primer (primer + NGS linker): GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGAAGCTGTACCATACCTGTCTG; Primer volume: 1; Gene: EGFR; Mutation location: s492; Forward primer: GGAGATAAGTGATGGAGATGTGA; Reverse primer (primer + NGS linker): TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGGAGATAAGTGATGGAGATGTGA; Primer volume: 1.4; Gene: EGFR; Mutation location: s492; Forward primer: TGCAGCTGTTTTCACCTCTG; Reverse primer (primer + NGS linker): GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTGCAGCTGTTTTCACCTCTG; Primer volume: 1.
4.
2. The specific detection process of the rapid NGS detection kit for lung and colon cancer according to claim 1 is as follows: Step 1, PCR1 process: A. 6.25 μL Qiagen 4x MM and 4 μL primer mixture (7.5 pM); B. Add 10-500 ng of DNA; C. Add ddH2O to a total reaction volume of 25 μL; D. Briefly centrifuge to mix thoroughly; PCR1 procedure: Initial denaturation: 95℃ for 15 minutes; extension amplification: 97℃ for 30 seconds; 16 cycles; then, 58℃ for 1 minute and 72℃ for 30 seconds; termination: 72℃ for 5 minutes; Step 2, dilution: Take 2 μL of PCR 1 product and dilute it with 198 μL of ddH2O; Step 3, PCR 2 (barcode) Primers CAAGCAGAGAGGCATACGAGAT (barcode)GTCTCGTGGCTCGG AATGATACGGCGACCACCGAGATCTACAC [Barcode] TCGTCGGCAGCGTC; process: A. 6.25μL Qiagen 4x MM; B.1ul barcode primer mixture (7.5pM); C.5ul diluted PCR1 product; D. Add ddH2O to a total reaction volume of 25 μL, and briefly centrifuge to mix thoroughly; PCR2 procedure: Initial denaturation: 95℃ for 15 minutes; extension amplification: 97℃ for 30 seconds, 4 cycles, then 58℃ for 1 minute and 72℃ for 30 seconds, then 97℃ for 30 seconds, 16 cycles, then 68℃ for 30 seconds and 72℃ for 30 seconds; termination: 72℃ for 5 minutes; Step four, purification. Purification was performed according to standard procedures, followed by NGS detection.
3. The rapid NGS detection kit for lung and colon cancer according to claim 1, characterized in that: The test kit is used for lung cancer, colorectal cancer, and other cancers that require next-generation sequencing of the genes it contains.