Computer-aided drug screening method, system and equipment based on FTO and circNFATC3
By using computer-aided drug screening methods such as FTO and circNFATC3, targeted drugs were screened, which solved the problem of limited types of chemotherapy drugs for gastric cancer and their large toxic side effects. This achieved efficient and accurate drug screening and promoted the development of new drugs for the treatment of gastric cancer.
Patent Information
- Application Number
- CN202511820641.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-04
- Publication Date
- 2026-03-03
AI Technical Summary
Currently, there are few types of chemotherapy drugs for gastric cancer, and they have significant toxic side effects. The efficacy of traditional cytotoxic drugs has reached a bottleneck, research on molecularly targeted drugs is insufficient, and there is a lack of efficient and low-toxicity new drug screening methods.
A computer-aided drug screening method based on FTO and circNFATC3 was adopted to identify binding sites by acquiring protein or gene data, screen targeted drugs, and use computer simulation technology to screen small molecule compounds to verify their effectiveness in a gastric cancer model.
This provides an efficient, accurate, and rapid drug screening method to identify candidate drugs with potential therapeutic effects for the treatment of gastric cancer, reducing the blind spots in screening and improving research and development efficiency.
Smart Images

Figure CN121601081A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of computer-aided drug screening technology. Specifically, this invention relates to a computer-aided drug screening method, system, and device based on FTO and circNFATC3. Background Technology
[0002] Gastric cancer is a common malignant tumor originating from the epithelial cells of the gastric mucosa. It ranks fifth in incidence and fourth in mortality among malignant tumors worldwide. Advanced gastric cancer is difficult to cure through surgery or other means; the main treatment currently is combination chemotherapy. However, there are relatively few effective chemotherapy drugs, and they are prone to toxic side effects. Traditional cytotoxic drugs have reached a bottleneck in their effectiveness against gastric cancer. Molecularly targeted drugs, compared to traditional cytotoxic drugs, offer advantages such as lower toxicity and higher efficacy. Therefore, the development of novel molecularly targeted drugs has become a hot topic in gastric cancer research in recent years.
[0003] Computer-aided drug design (Computer Aided Drug Design (CADD) is based on computer computation and simulation technology. By learning from the prior knowledge contained in massive amounts of drug data, it can uncover the interaction relationships between target molecules and candidate drugs, and rapidly select drug-like active drug molecules from millions of molecules. This greatly reduces the blind spots in screening candidate drug molecules and improves research and development efficiency. Summary of the Invention
[0004] To overcome the shortcomings of the prior art, the present invention aims to provide a computer-aided drug screening method, system, and device based on FTO and circNFATC3.
[0005] To achieve the above objectives, the present invention adopts the following technical solution: The first aspect of this invention provides a computer-aided drug screening method based on FTO and circNFATC3.
[0006] Furthermore, the screening method includes: Obtain protein or gene data for FTO and circNFATC3; The binding sites of FTO and circNFATC3 were determined based on the protein or gene data of the two. Candidate drugs targeting the binding sites of both substances were obtained through computer-aided screening.
[0007] Furthermore, the computer-aided screening process is as follows: Screening of small molecule compounds based on the spatial structure of FTO and circNFATC3 binding sites; The selected small molecule compounds are molecularly docked with binding sites to obtain the score of the docked molecules; Candidate drugs are obtained by sorting them according to the scores.
[0008] Furthermore, the computer-aided screening process is as follows: The molecular structures of FTO protein and circNFATC3 gene were obtained and input into the pharmacophore module library for matching. Based on the interaction patterns with FTO and circNFATC3, all action sites were clustered to obtain pharmacophore models. The pharmacophore model is input into a molecular compound database for high-throughput screening to obtain candidate drugs.
[0009] Furthermore, the computer-aided screening process is as follows: first, obtain the molecular structure of the small molecule inhibitor that inhibits FTO and / or the molecular structure of the small molecule inhibitor that inhibits circNFATC3; then, screen for a small molecule library with similar structures based on the molecular structure of the small molecule inhibitor; then, perform molecular docking of the small molecule library with similar structures to the binding site to obtain the score of the docking molecules; finally, sort them to obtain candidate drugs.
[0010] Furthermore, the method for determining the binding sites of both FTO and circNFATC3 includes: Construct n truncated expression mutants of FTO, where n is a natural number greater than or equal to 1; Based on the n truncated expression mutants, RNA immunoprecipitation experiments were performed to obtain the key region of interaction between FTO and circNFATC3; The spatial structure of the key region where FTO and circNFATC3 interact is the binding site of both FTO and circNFATC3.
[0011] Furthermore, the candidate drugs include protein analogs, antibodies, and RNA drugs.
[0012] Furthermore, the candidate drug is a candidate drug for treating gastric cancer.
[0013] Furthermore, the screening method also includes: Obtain animal models or gastric cancer cell models; The effectiveness of the candidate drugs was verified by treating the gastric cancer animal model or gastric cancer cell model with the selected candidate drugs.
[0014] Furthermore, the candidate drug inhibits the growth, proliferation, migration, and / or promotes apoptosis of gastric cancer cells.
[0015] A second aspect of the present invention provides a computer-aided drug screening system based on FTO and circNFATC3.
[0016] Furthermore, the system includes: Data acquisition unit: Acquires protein or gene data for FTO and circNFATC3; Binding site determination unit: Determines the binding sites of FTO and circNFATC3 based on the protein or gene data of the two. Candidate drug screening unit: Candidate drugs targeting the binding sites of the two are obtained through computer-aided screening.
[0017] A third aspect of the present invention provides an apparatus.
[0018] Furthermore, the device includes a memory and a processor, the memory being used to store program instructions; the processor being used to invoke the program instructions, and when the program instructions are executed, to implement the computer-aided drug screening method based on FTO and circNFATC3 as described in the first aspect of the present invention.
[0019] A fourth aspect of the present invention provides a computer-readable storage medium.
[0020] Furthermore, it stores a computer program that, when executed by a processor, implements the computer-aided drug screening method based on FTO and circNFATC3 as described in the first aspect of the present invention.
[0021] The fifth aspect of the present invention is a computer program product, comprising a computer program that, when executed by a processor, implements the computer-aided drug screening method based on FTO and circNFATC3 described in the first aspect of the present invention.
[0022] The sixth aspect of the present invention provides any of the following applications: (1) Application of substances that inhibit the binding of FTO and circNFATC3 in the preparation of screening drugs for gastric cancer treatment; preferably, the substances that inhibit the binding of FTO and circNFATC3 include protein analogs, antibodies, and RNA drugs; (2) Application of FTO in regulating the expression level of circNFATC3; preferably, the FTO positively regulates the expression level of circNFATC3.
[0023] The seventh aspect of this invention is a method for regulating the expression level of circNFATC3 in cells.
[0024] Furthermore, the method includes administering FTO protein, an FTO promoter, or an FTO inhibitor to the cells.
[0025] Furthermore, the FTO protein and FTO promoter promote the expression level of circNFATC3.
[0026] Furthermore, the FTO inhibitor suppresses the expression level of circNFATC3.
[0027] Furthermore, the cells in question are gastric cancer cells.
[0028] Advantages and beneficial effects of the present invention: This invention is the first to provide a novel computer-aided drug screening method, system, and device based on FTO and circNFATC3, as well as a computer-readable storage medium and program product. This invention provides an efficient, accurate, and rapid screening method for the development of new drugs for the treatment of gastric cancer, and has broad application prospects in the field of new drug screening for the treatment of gastric cancer. Attached Figure Description
[0029] Figure 1 A flowchart illustrating a computer-aided drug screening method based on FTO and circNFATC3 provided for an embodiment of the present invention; Figure 2 A schematic diagram of a computer-aided drug screening system based on FTO and circNFATC3 provided for an embodiment of the present invention; Figure 3 A schematic diagram of a computer device provided by the present invention; Figure 4 A graph showing the results of circNFATC3 promoting gastric cancer progression; Figure 5 The graph shows the results of circNFATC3 inhibiting the progression of gastric cancer. Figure 6 This is a graph showing the prediction results from bioinformatics analysis. Figure 7 Image showing the IHC results of FTO in gastric cancer tissue and adjacent normal tissue; Figure 8 The figure shows the effect of FTO overexpression on circNFATC3 expression levels and its impact on gastric cancer cells; among them... Figure 8 A and B show the effects of FTO overexpression on the expression levels of circNFATC3 and miR-23b-3p, respectively. Figure 8 C, D, and E show the effects of FTO overexpression on the MTT assay, proliferation assay, and invasion assay of gastric cancer cells, respectively. Figure 9 The figure shows the effect of inhibiting FTO on circNFATC3 expression level and its effect on gastric cancer cells; among them, Figure 9A and B show the effect of inhibiting FTO on the expression levels of circNFATC3 and miR-23b-3p, respectively. Figure 9 C, D, and E show the effects of FTO inhibition on the MTT assay, proliferation assay, and invasion assay of gastric cancer cells, respectively. Figure 10 The image shows the results of the RIP experiment. Figure 11 The image shows the results of the MeRIP experiment. Detailed Implementation
[0030] To enable those skilled in the art to better understand the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings.
[0031] In some of the processes described in the specification, claims, and accompanying drawings of this invention, multiple operations appearing in a specific order are included. However, it should be clearly understood that these operations may not be executed in the order they appear herein, or may be executed in parallel. The operation numbers, such as 101, 102, etc., are merely used to distinguish different operations and do not represent any execution order. Furthermore, these processes may include more or fewer operations, and these operations may be executed sequentially or in parallel. It should be noted that the descriptions such as "first," "second," etc., in this document are used to distinguish different messages, devices, modules, etc., and do not represent a sequential order, nor do they limit "first" and "second" to different types.
[0032] Unless otherwise specified in the following examples, the conditions should be performed under standard conditions or conditions recommended by the manufacturer. Reagents or instruments whose manufacturers are not specified are all commercially available products.
[0033] Figure 1 The flowchart illustrates a computer-aided drug screening method based on FTO and circNFATC3 provided in this embodiment of the invention. Specifically, the screening method includes the following steps: 101: Obtain protein or gene data for FTO and circNFATC3; In some implementations, the FTO corresponds to Gene ID 79068 in NCBI, and its detailed information (including sequence information, etc.) can be obtained at https: / / www.ncbi.nlm.nih.gov / gene / .
[0034] In some implementations, the circNFATC3 corresponds to the circRNA ID hsa_circ_0039930 in circBase, and its detailed information (including sequence information, etc.) can be obtained from the official circBase website (http: / / circbase.org / ).
[0035] In this invention, the inventors have demonstrated for the first time that FTO promotes the progression of gastric cancer by positively regulating the expression level of circNFATC3, and that inhibiting FTO can inhibit the expression level of circNFATC3 and thus inhibit the progression of gastric cancer. That is, this application is the first to discover that FTO can regulate circNFATC3, and this has been confirmed through scientific experiments. Based on this, this application provides a computer-aided drug screening method based on FTO and circNFATC3 for the field.
[0036] 102: Determine the binding sites of FTO and circNFATC3 based on the protein or gene data of the two. In some embodiments, the binding sites of FTO and circNFATC3 in the FTO and circNFATC3 complex may be determined by nucleic acid-protein docking or any other prior art known to be able to determine the interaction sites between nucleic acids and proteins.
[0037] In some embodiments, nucleic acid-protein docking refers to a computational simulation process that uses specific algorithms and procedures to dock the structures of proteins and nucleic acids (such as DNA or RNA) together. This process can be used to study the interactions between proteins and nucleic acids, as well as their potential biological functions.
[0038] In protein-nucleic acid docking, software such as NAflex is commonly used for computational simulation. NAflex is a software specifically developed for nucleic acid structure prediction and design, capable of accurate modeling and docking of DNA or RNA molecules. NAflex employs a fragment-based scoring method, enabling fast and accurate docking. It considers various complex interactions, such as hydrogen bonds, ionic bonds, and hydrophobic interactions, and can precisely adjust the side-chain conformation during docking. The basic algorithm of NAflex consists of two stages. The first stage is a low-precision stage, which mainly searches for a coarse match between the protein and nucleic acid. The second stage is a high-precision stage, which considers all side-chain conformations and calculates more accurate interaction energies. In the low-precision stage, NAflex randomly translates and rotates the nucleic acid molecule and performs a certain number of rigid body movements before calculating the interaction energy. After outputting the lowest conformation, it enters the high-precision stage. In the high-precision stage, the program performs further optimization and adjustments to achieve more accurate docking.
[0039] In some embodiments, the method for determining the binding sites of both FTO and circNFATC3 includes: Construct n truncated expression mutants of FTO, where n is a natural number greater than or equal to 1; Based on the n truncated expression mutants, RNA immunoprecipitation experiments were performed to obtain the key region of interaction between FTO and circNFATC3; The spatial structure of the key region where FTO and circNFATC3 interact is the binding site of both FTO and circNFATC3.
[0040] 103: Candidate drugs targeting the binding sites of both were obtained through computer-aided screening.
[0041] In some embodiments, the computer-aided screening process is as follows: Screening of small molecule compounds based on the spatial structure of FTO and circNFATC3 binding sites; The selected small molecule compounds are molecularly docked with binding sites to obtain the score of the docked molecules; Candidate drugs are obtained by sorting them according to the scores.
[0042] In some embodiments, the computer-aided screening process is as follows: The molecular structures of FTO protein and circNFATC3 gene were obtained and input into the pharmacophore module library for matching. Based on the interaction patterns with FTO and circNFATC3, all action sites were clustered to obtain pharmacophore models. The pharmacophore model is input into a molecular compound database for high-throughput screening to obtain candidate drugs.
[0043] In other embodiments, the computer-aided screening process is as follows: first, obtain the molecular structure of the small molecule inhibitor that inhibits FTO and / or the molecular structure of the small molecule inhibitor that inhibits circNFATC3; then, screen for a small molecule library with similar structures based on the molecular structure of the small molecule inhibitor; then, perform molecular docking of the small molecule library with similar structures to the binding site to obtain the score of the docking molecules; and finally, sort them to obtain candidate drugs.
[0044] In some embodiments, the small molecule compounds include, but are not limited to: inorganic small molecule compounds, protein analogs, nucleic acid analogs, peptides, antibodies, siRNA, shRNA, dsRNA, microRNA, or antisense nucleic acids.
[0045] It should be noted that the present invention does not impose any particular limitation on the specific type of small molecule compound. Any small molecule compound that may be used in the computer-aided drug screening method provided by the present invention and may produce the corresponding effect falls within the protection scope of the present invention.
[0046] In some embodiments, during the molecular docking process, affinity refers to the tightness of the binding between the molecule and the acceptor. High affinity means a more stable binding, while low affinity indicates a less stable binding. Affinity is typically obtained through calculations, such as by calculating the binding free energy (ΔG) or the binding constant (Kd).
[0047] In some embodiments, during the molecular docking process, affinity depends on the interactions between the molecule and the receptor, including hydrogen bonds, van der Waals forces, electrostatic interactions, etc. These interactions collectively determine the binding mode between the molecule and the receptor, thus affecting affinity. To assess affinity, scoring systems or methods are typically used to quantify the interactions between the molecule and the receptor. These scoring methods are based on different algorithms and physical models and can reflect the binding energy, interaction type, and affinity between the molecule and the receptor.
[0048] In some embodiments, the mode of screening drugs using computer-aided drug screening technology may include any one or more of the following modes, depending on the type of small molecule compound (inorganic small molecule compound, protein analog, nucleic acid analog, peptide, antibody, siRNA, shRNA, dsRNA, microRNA, or antisense nucleic acid, etc.): protein Small molecule docking, protein Protein docking, protein Nucleic acid testing docking.
[0049] Specifically, the protein Small molecule docking refers to the computational simulation process of docking the structures of proteins and small molecules (such as drug molecules) together using specific algorithms and programs. This process can be used to study the interactions between proteins and small molecules, as well as their potential biological functions. Software such as DOCK is typically used for computational simulation. DOCK is a highly automated drug design software capable of docking small molecule ligands with biomolecular receptors. It employs a fragment-based scoring method, enabling fast and accurate docking. The basic algorithm of DOCK software consists of two stages. The first stage is a low-precision stage, which mainly searches for a coarse match between the small molecule ligand and the biomolecular receptor. The second stage is a high-precision stage, which considers all side chain conformations and calculates more precise interaction energies. In the low-precision stage, DOCK software randomly translates and rotates the small molecule ligand and performs a certain number of rigid body movements before calculating the interaction energy. After outputting the lowest conformation, it enters the high-precision stage. In the high-precision stage, the program performs further optimization and adjustments to achieve more accurate docking.
[0050] Specifically, the protein Protein docking is a computational simulation process that uses specific algorithms and programs to dock the structures of two proteins together. This process can be used to study protein-protein interactions and potential biological functions. RosettaDock is a commonly used protein docking technique. RosettaDock is a protein docking software that uses a fragment-based scoring method to achieve fast and accurate protein docking. The software can precisely adjust the side-chain conformation during docking and considers various complex interactions, such as hydrogen bonds, ionic bonds, and hydrophobic interactions. RosettaDock's basic algorithm consists of two stages. The first stage is a low-precision stage, which mainly searches for the degree of skeletal shape compatibility between two proteins. The second stage is a high-precision stage, which considers all side-chain conformations and calculates more precise interaction energies. In the low-precision stage, the program randomly translates and rotates a component of a protein molecule and performs a certain number of rigid body movements, then calculates the interaction energy. After outputting the lowest conformation, it enters the high-precision stage. In the high-precision stage, the program performs 50 MCMPCCcycles: rearranging the conformations and minimizing the interaction energy, using this as the initial starting conformation.
[0051] Specifically, the protein Nucleic acid docking refers to the computational simulation process of connecting the structures of proteins and nucleic acids (such as DNA or RNA) using specific algorithms and procedures. This process can be used to study the interactions between proteins and nucleic acids, as well as their potential biological functions. Computational simulations are typically performed using software such as NAflex. NAflex is a software specifically developed for nucleic acid structure prediction and design, capable of accurately modeling and docking DNA or RNA molecules. NAflex employs a fragment-based scoring method, enabling fast and accurate docking. It considers various complex interactions, such as hydrogen bonds, ionic bonds, and hydrophobic interactions, and can precisely adjust the side-chain conformations during docking. The basic algorithm of NAflex consists of two stages. The first stage is a low-precision stage, which mainly searches for a coarse match between the protein and nucleic acid. The second stage is a high-precision stage, which considers all side-chain conformations and calculates more precise interaction energies. In the low-precision stage, NAflex randomly translates and rotates the nucleic acid molecule and performs a certain number of rigid body movements before calculating the interaction energy. After outputting the lowest conformation, it enters the high-precision stage. In the high-precision stage, the program will undergo further optimization and adjustments to achieve more accurate docking.
[0052] In some embodiments, computer-aided drug screening is a technique that uses computer-aided drug design methods to screen drugs. It can help researchers quickly screen a large number of small molecule compounds for candidate drugs that have strong binding affinity to target proteins and potential pharmacological effects.
[0053] In one embodiment, molecular docking is a method for drug design based on the characteristics of the receptor and the interaction between the receptor and the drug molecule. It primarily studies intermolecular interactions (such as ligand-receptor interactions) and is a theoretical simulation method that predicts their binding modes and affinities. This method is widely used in the early stages of drug development to help researchers quickly screen compounds with potential efficacy. Molecular docking methods mainly focus on spatial matching and energy matching. Spatial matching refers to the geometric complementarity between the drug molecule and the receptor protein, while energy matching refers to the minimization of the interaction between the drug molecule and the receptor protein. For geometric matching calculations, methods such as grid computing and fragment growth are commonly used, while energy calculations use methods such as simulated annealing and genetic algorithms. Based on the degree and method of simplification, molecular docking methods can be divided into rigid docking, semi-flexible docking, and flexible docking. In rigid docking, the conformation of the molecules involved in docking does not change during the calculation process; only the spatial position and orientation of the molecules are altered. Semi-flexible docking allows for partial conformational changes during the calculation. Flexible docking allows for even more conformational changes.
[0054] In one embodiment, the molecular libraries used in drug virtual screening primarily include the following: ZINC: containing over 250 million commercially available compounds for small molecule virtual screening; PubChem: containing bioactive substances for small molecule virtual screening; DrugBank: containing drugs and small molecules for drug design and discovery; ChEMBL: containing small molecules for drug discovery and chemical genomics research; ChemDB: containing a large number of known small molecules for chemical genomics research and drug discovery; HMDB: containing a large number of known small molecules for chemical genomics research and drug discovery; BindingDB: containing a large number of known small molecules for chemical genomics research and drug discovery; and SMPDB: containing a large number of known small molecules for chemical genomics research and drug discovery. In addition, there are some commercial databases such as ChemDiv, Enamine, Lifechemicals, Specs, Chembridge, Maybridge, Microsource, and Vitas. Databases such as M and Interbioscreen are also frequently used for virtual drug screening.
[0055] In some embodiments, the filtering method further includes: Obtain animal models or gastric cancer cell models; The effectiveness of the candidate drugs was verified by treating the gastric cancer animal model or gastric cancer cell model with the selected candidate drugs.
[0056] In one embodiment, the candidate drug inhibits the growth, proliferation, migration, and / or promotes apoptosis of gastric cancer cells.
[0057] In some embodiments, the animal model is not particularly limited and can be constructed using conventional construction methods well known to those skilled in the art. The animals include, but are not limited to, mice, rats, guinea pigs, rabbits, pigs, chickens, pigeons, monkeys, and dogs.
[0058] In one specific embodiment, this invention demonstrated that circNFATC3 promotes gastric cancer progression, and knockdown of circNFATC3 inhibits gastric cancer progression. To investigate the effect of circNFATC3 on gastric cancer tumors in vivo, we established xenograft tumor models using AGS cells (gastric cancer cell line, purchased from Beijing Fubo Biotechnology Co., Ltd.) with either overexpression of circNFATC3 (LV5-circNFATC3) or non-overexpression of circNFATC3 (LV5-GFP). AGS cells were cultured in DuPont modified Eagle medium supplemented with 10% heat-inactivated bovine serum and antibiotics (100 U / mL penicillin and 100 U / mL streptomycin) at 37°C in an incubator with 5% CO2 and 95% humidity. Lentiviral-mediated circNFATC3 mimics / inhibitors were provided by Shanghai Jima Pharmaceutical Technology Co., Ltd. The tumor model was constructed as follows: BALB / c nude mice (male, 4-5 weeks old) were purchased from Shanghai Slack Laboratory Animal Company. The mice were randomly divided into two groups (n=8 in each group). The experimental group mice were subcutaneously injected with 200 μL of sterile PBS (containing 1×10⁻⁶ ppm) in the ventral region. 6 (AGS cells overexpressing circNFATC3), control mice were subcutaneously injected with 200 μL of sterile PBS (containing 1×10⁻⁶ cells) in the ventral region. 6 (AGS cells that did not overexpress circNFATC3). All animals were euthanized after 4 weeks, tumors were collected, and the final tumor weight was recorded. All animal experiments were conducted in accordance with the regulations of the Animal Ethics Committee of Beijing Aerospace Center Hospital (No.: 2021-AMHTG-002).
[0059] The results showed that the gastric cancer tumor volume and weight in the circNFATC3 overexpression group were larger than those in the control group (tumor cells transduced only by the vector). Figure 4 Simultaneously, we used HGC-27 cells with or without circNFATC3 deletion (LV5-sg circNFATC3 and LV5-GFP, the sequence of sg circNFATC3 is TTGTGAAGCACATCTTCAT, HGC-27 cells were purchased from Beijing Fubo Biotechnology Co., Ltd.) to construct xenograft tumor models and monitored tumor growth in vivo. Compared with the LV5-GFP group, the circNFATC3 deletion (si-circNFATC3) group had smaller tumor volume and lower weight. Figure 5 These results indicate that the expression level of circNFATC3 is closely related to the progression of gastric cancer.
[0060] Furthermore, to investigate the mechanism by which circNFATC3 promotes the progression of gastric cancer cells, we used bioinformatics analysis to predict the target genes regulating circNFATC3, among which FTO was identified as a key target. Figure 6 Therefore, we hypothesize that FTO can regulate circNFATC3 and thus influence the progression of gastric cancer.
[0061] Furthermore, this invention investigated the role of FTO in gastric cancer. Specifically, a human gastric cancer tumor tissue microarray (batch number: HStm-Ade060CS-01) was obtained from Shanghai Ouyi Biomedical Technology Co., Ltd. This dataset contained 28 gastric cancer tissue samples, with an equal number of adjacent normal tissue samples. Table 1 describes the relevant pathological parameters of gastric cancer tissue and adjacent normal tissue. This study has been approved by the Ethics Committee of Beijing Aerospace Center Hospital (No.: 2021-AMHTG-002). Immunohistochemistry of gastric cancer tissue and adjacent normal tissue showed that FTO expression in gastric cancer tissue was significantly higher than in adjacent normal tissue. Figure 7 ).
[0062] Table 1 Patient clinicopathological information
[0063] Furthermore, this invention utilizes qRT-PCR to demonstrate that FTO can indeed regulate circNFATC3 expression. Specifically, through qRT-PCR... PCR technology (circNFATC3 forward primer AAACTGAAGGTA GCCGAGGG, reverse primer CCAAAATGAGCTGGTAAAGGCC) was used to transfect AGS cells with low circNFATC3 expression using an FTO overexpression vector. The results showed that, compared with the control group, the expression level of circNFATC3 was significantly increased after transfection with the FTO overexpression vector. Figure 8 A). Furthermore, increased FTO expression significantly enhanced cell proliferation ( Figure 8 C) Settlement formation ( Figure 8 D) and invasiveness ( Figure 8 E).
[0064] Similarly, FTO-targeting siRNA (sense strand sequence: CAGGAACCUUGGAUU AUAUTT, antisense strand sequence: AUAUAAUCCAAGGUUCCUGTT) was transfected into HGC-27 cells with high circNFATC3 expression. The results showed that inhibiting FTO significantly reduced circNFATC3 expression. Figure 9 A). Simultaneously, inhibiting FTO hindered the proliferation of gastric cancer cells ( Figure 9 C) Settlement formation ( Figure 9 D) and invasiveness ( Figure 9 The results for the E group were significantly different from those for the LV5-CAG-GFP group.
[0065] To further demonstrate that FTO can regulate circNFATC3 expression, we performed RIP (RNA-binding protein immunoprecipitation) experiments in gastric cancer AGS and HGC-27 cells. The results showed that in the FTO-overexpressing group, the expression level of circNFATC3 in the immune complexes enriched with FTO antibody was significantly increased. Figure 10 Studies have reported that FTO can affect mRNA stability and translation efficiency by regulating the m6Am level of mRNA. Therefore, we further detected the enrichment of anti-m6A on circNFATC3 using meRIP. The results showed that in the FTO overexpression group, the enrichment of anti-m6A on circNFATC3 was significantly reduced, while the inhibition of FTO significantly increased the enrichment of anti-m6A on circNFATC3. Figure 11 This further demonstrates that FTO enhances the stability of the circNFATC3 transcript by reducing the level of m6A modification on the circNFATC3 transcript, leading to the upregulation of circNFATC3 expression.
[0066] In conclusion, the above results confirm that FTO can directly regulate circNFATC3 and thus participate in the progression of gastric cancer.
[0067] Figure 2 This is a schematic diagram of a computer-aided drug screening system based on FTO and circNFATC3 provided in an embodiment of the present invention. Specifically, the system includes: 201 Data Acquisition Unit: Acquire protein or gene data for FTO and circNFATC3; 202 Binding Site Determination Unit: Determines the binding sites of FTO and circNFATC3 based on the protein or gene data of the two; 203 Candidate Drug Screening Unit: Candidate drugs targeting the binding sites of both are obtained through computer-aided screening.
[0068] In some embodiments, the method for determining the binding sites of both FTO and circNFATC3 includes: Construct n truncated expression mutants of FTO, where n is a natural number greater than or equal to 1; Based on the n truncated expression mutants, RNA immunoprecipitation experiments were performed to obtain the key region of interaction between FTO and circNFATC3; The spatial structure of the key region where FTO and circNFATC3 interact is the binding site of both FTO and circNFATC3.
[0069] In some embodiments, the computer-aided screening process is as follows: The molecular structures of FTO protein and circNFATC3 gene were obtained and input into the pharmacophore module library for matching. Based on the interaction patterns with FTO and circNFATC3, all action sites were clustered to obtain pharmacophore models. The pharmacophore model is input into a molecular compound database for high-throughput screening to obtain candidate drugs.
[0070] In other embodiments, the computer-aided screening process is as follows: first, obtain the molecular structure of the small molecule inhibitor that inhibits FTO and / or the molecular structure of the small molecule inhibitor that inhibits circNFATC3; then, screen for a small molecule library with similar structures based on the molecular structure of the small molecule inhibitor; then, perform molecular docking of the small molecule library with similar structures to the binding site to obtain the score of the docking molecules; and finally, sort them to obtain candidate drugs.
[0071] In some embodiments, the system further includes a drug efficacy verification unit for obtaining a gastric cancer animal model or a gastric cancer cell model; and for treating the gastric cancer animal model or gastric cancer cell model with the screened candidate drug to verify the efficacy of the candidate drug.
[0072] Figure 3 This is a schematic diagram of the computer device provided in this embodiment. Specifically, the computer device includes: 301 is a memory and 302 is a processor, wherein the memory is used to store program instructions; the processor is used to call the program instructions, and when the program instructions are executed, the computer-aided drug screening method based on FTO and circNFATC3 described in this invention is implemented.
[0073] In some embodiments, the computer device may further include an input device and an output device.
[0074] In some embodiments, the memory, processor, input device, and output device may be connected via a bus or other means. Figure 3 The diagram illustrates a bus-connected configuration as an example; the memory stores program instructions, and the processor invokes these instructions. When the program instructions are executed, they are used to implement the methods described above. In some embodiments, the memory can be understood as any device for storing the program, and the processor can be understood as a device for using the program.
[0075] This invention also provides a computer-readable storage medium storing a computer program that, when executed by a processor, implements the computer-aided drug screening method based on FTO and circNFATC3 as described above.
[0076] Those skilled in the art will clearly understand that, for the sake of convenience and brevity, the specific working processes of the systems, devices, and units described above can be referred to the corresponding processes in the foregoing method embodiments, and will not be repeated here.
[0077] In the several embodiments provided in this application, it should be understood that the disclosed systems, apparatuses, and methods can be implemented in other ways. For example, the apparatus embodiments described above are merely illustrative; for instance, the division of units is only a logical functional division, and in actual implementation, there may be other division methods. For example, multiple units or components may be combined or integrated into another system, or some features may be ignored or not executed. Furthermore, the coupling or direct coupling or communication connection shown or discussed may be indirect coupling or communication connection through some interfaces, apparatuses, or units, and may be electrical, mechanical, or other forms.
[0078] The units described as separate components may or may not be physically separate. The components shown as units may or may not be physical units; that is, they may be located in one place or distributed across multiple network units. Some or all of the units can be selected to achieve the purpose of this embodiment according to actual needs.
[0079] Furthermore, the functional units in the various embodiments of the present invention can be integrated into one processing unit, or each unit can exist physically separately, or two or more units can be integrated into one unit. The integrated units described above can be implemented in hardware or as software functional units. The present invention does not impose any particular limitation on the specific implementation forms.
[0080] Those skilled in the art will understand that all or part of the steps in the various methods of the above embodiments can be implemented by a program instructing related hardware. This program can be stored in a computer-readable storage medium, which may include: read-only memory (ROM), random access memory (RAM), a magnetic disk, or an optical disk, etc. The computer device provided by the present invention has been described in detail above. For those skilled in the art, based on the ideas of the embodiments of the present invention, there will be changes in specific implementation methods and application scope. Therefore, the content of this specification should not be construed as a limitation of the present invention.
Claims
1. A computer-aided drug screening method based on FTO and circNFATC3, characterized in that, The screening method includes: Obtain protein or gene data for FTO and circNFATC3; The binding sites of FTO and circNFATC3 were determined based on the protein or gene data of the two. Candidate drugs targeting the binding sites of both substances were obtained through computer-aided screening.
2. The screening method according to claim 1, characterized in that, The computer-aided screening process is as follows: Screening of small molecule compounds based on the spatial structure of FTO and circNFATC3 binding sites; The selected small molecule compounds are molecularly docked with binding sites to obtain the score of the docked molecules; Candidate drugs are obtained by sorting them according to the scores; Preferably, the computer-aided screening process is as follows: The molecular structures of FTO protein and circNFATC3 gene were obtained and input into the pharmacophore module library for matching. Based on the interaction patterns with FTO and circNFATC3, all action sites were clustered to obtain pharmacophore models. The pharmacophore model is input into a molecular compound database for high-throughput screening to obtain candidate drugs; Preferably, the computer-aided screening process is as follows: first, obtain the molecular structure of the small molecule inhibitor that inhibits FTO and / or the molecular structure of the small molecule inhibitor that inhibits circNFATC3; then, screen for a small molecule library with similar structures based on the molecular structure of the small molecule inhibitor; then, perform molecular docking of the small molecule library with similar structures to the binding site to obtain the score of the docking molecules; and finally, sort them to obtain candidate drugs.
3. The screening method according to claim 1 or 2, characterized in that, The method for determining the binding sites of both FTO and circNFATC3 includes: Construct n truncated expression mutants of FTO, where n is a natural number greater than or equal to 1; Based on the n truncated expression mutants, RNA immunoprecipitation experiments were performed to obtain the key region of interaction between FTO and circNFATC3; The spatial structure of the key region where FTO and circNFATC3 interact is the binding site of both FTO and circNFATC3.
4. The screening method according to claim 1, characterized in that, The candidate drugs include protein analogs, antibodies, and RNA drugs; Preferably, the candidate drug is a candidate drug for treating gastric cancer; Preferably, the screening method further includes: Obtain animal models or gastric cancer cell models; The effectiveness of the candidate drugs was verified by treating the gastric cancer animal model or gastric cancer cell model with the candidate drugs obtained from the screening. Preferably, the candidate drug inhibits the growth, proliferation, migration and / or promotes apoptosis of gastric cancer cells.
5. A computer-aided drug screening system based on FTO and circNFATC3, characterized in that, The system includes: Data acquisition unit: Acquires protein or gene data for FTO and circNFATC3; Binding site determination unit: Determines the binding sites of FTO and circNFATC3 based on the protein or gene data of the two. Candidate drug screening unit: Candidate drugs targeting the binding sites of the two are obtained through computer-aided screening.
6. A device, characterized in that, The device includes a memory and a processor, the memory being used to store program instructions; the processor being used to invoke the program instructions, and when the program instructions are executed, to implement the computer-aided drug screening method based on FTO and circNFATC3 as described in any one of claims 1-4.
7. A computer-readable storage medium, characterized in that, It stores a computer program that, when executed by a processor, implements the computer-aided drug screening method based on FTO and circNFATC3 as described in any one of claims 1-4.
8. A computer program product, comprising a computer program, characterized in that, When executed by a processor, the computer program implements the computer-aided drug screening method based on FTO and circNFATC3 as described in any one of claims 1-4.
9. Any of the following applications: (1) Application of substances that inhibit the binding of FTO and circNFATC3 in the preparation of screening drugs for gastric cancer treatment; preferably, the substances that inhibit the binding of FTO and circNFATC3 include protein analogs, antibodies, and RNA drugs; (2) Application of FTO in regulating the expression level of circNFATC3; preferably, the FTO positively regulates the expression level of circNFATC3.
10. A method for regulating the expression level of circNFATC3 in cells, characterized in that, The method includes administering FTO protein, an FTO promoter, or an FTO inhibitor to the cells; Preferably, the FTO protein and the FTO promoter promote the expression level of circNFATC3; Preferably, the FTO inhibitor inhibits the expression level of circNFATC3; Preferably, the cells are gastric cancer cells.