An optimized lactoferricin peptide, its method of preparation and use in the preparation of anti-inflammatory and antioxidant damage formulations
By optimizing the amino acid sequence of lactoferrin peptide and expressing it in Bacillus subtilis, the problems of high production cost and low bioactivity of lactoferrin peptide were solved, achieving highly efficient anti-inflammatory and antioxidant effects, making it suitable for the preparation of formulations that combat inflammation and oxidative damage.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- OCEAN UNIV OF CHINA
- Filing Date
- 2026-02-02
- Publication Date
- 2026-05-19
AI Technical Summary
Existing methods for extracting lactoferrin are costly and pose safety risks, making large-scale application difficult. Furthermore, there is a lack of highly bioactive lactoferrin peptides with anti-inflammatory and antioxidant properties on the market.
By optimizing the amino acid sequence of lactoferrin peptide through single-point and multi-point mutations and expressing it in Bacillus subtilis, the inducible expression of lactoferrin peptide using an inducible promoter can reduce production costs and improve bioactivity.
It significantly reduces the production cost of lactoferrin peptides, improves their anti-inflammatory and antioxidant activities, can effectively alleviate alcohol-induced hepatocellular damage, promote liver function recovery, and enhance the body's immunity, making it suitable for preparing anti-inflammatory and antioxidant formulations.
Smart Images

Figure CN121609785B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology, specifically relating to an optimized lactoferrin peptide, its preparation method, and its application in the preparation of anti-inflammatory and antioxidant formulations. Background Technology
[0002] Lactoferrin (LF) is a non-heme iron-binding glycoprotein primarily produced by the mammary epithelial cells of mammals (such as humans, goats, cows, and dogs). It is most abundant in breast milk. LF possesses antibacterial properties and enhances infant immunity, and can be added as a food fortifier to infant formula and milk-based beverages, finding wide application in the food and health supplement industries.
[0003] Currently, commercially available LF (hydrolyzed LF) is mainly extracted from milk, but only 1g of LF can be extracted from 14kg of milk, resulting in high costs. Regarding reports on heterologous recombinant expression of LF, for example, human HLF was expressed in Pichia pastoris using the vector pPIC9K. Methanol induction significantly improved the expression level of recombinant HLF during high-density fermentation. However, methanol is a toxic substance, posing certain safety risks and preventing its large-scale safe application. Bacillus subtilis is a food-grade strain with excellent characteristics such as clear genetic information, rapid growth, and no endotoxins, and is widely used in the industrial production of various chemical products and recombinant proteins. Summary of the Invention
[0004] The purpose of this invention is to provide an optimized lactoferrin peptide, its preparation method, and its application in the preparation of anti-inflammatory and antioxidant formulations. This invention involves analyzing lactoferrin B and then screening for single-point and multi-point mutations to obtain the encoding genes of three optimized lactoferrin peptides. These genes were then cloned into an inducible expression vector and successfully expressed in Bacillus subtilis. Screening and verification yielded three highly bioactive lactoferrin peptides. This invention significantly reduces the production cost of active lactoferrin peptides and promotes their application in anti-inflammatory, antioxidant, and immune-enhancing fields.
[0005] To achieve the above objectives, the present invention employs the following technical solution:
[0006] This invention provides an optimized lactoferrin peptide, wherein the lactoferrin peptide is lactoferrin peptide LF-1M, and the amino acid sequence of the lactoferrin peptide LF-1M is shown in SEQ ID NO: 3; the lactoferrin peptide LF-1M is obtained by changing the methionine at position 10 of the lactoferrin peptide with the amino acid sequence SEQ ID NO: 1 to leucine.
[0007] The present invention also provides the encoding gene of the lactoferrin peptide, the nucleotide sequence of which is shown in SEQ ID NO: 4.
[0008] The present invention also provides an optimized lactoferrin peptide, wherein the lactoferrin peptide is lactoferrin peptide LF-2M, and the amino acid sequence of the lactoferrin peptide LF-2M is shown in SEQ ID NO: 5; the lactoferrin peptide mutant LF-2M is obtained by changing the methionine at position 10 to leucine and the alanine at position 15 to tyrosine of the lactoferrin peptide with the amino acid sequence SEQ ID NO: 1.
[0009] The present invention also provides the encoding gene of the lactoferrin peptide, the nucleotide sequence of which is shown in SEQ ID NO: 6.
[0010] The present invention also provides an optimized lactoferrin peptide, wherein the lactoferrin peptide is lactoferrin peptide LF-3M, and the amino acid sequence of the lactoferrin peptide LF-3M is shown in SEQ ID NO: 7; the lactoferrin peptide mutant LF-3M is obtained by changing the methionine at position 10 to leucine, the alanine at position 15 to tyrosine, and the serine at position 17 to arginine in the lactoferrin peptide with the amino acid sequence SEQ ID NO: 1.
[0011] The present invention also provides the encoding gene of the lactoferrin peptide, the nucleotide sequence of which is shown in SEQ ID NO: 8.
[0012] The present invention also provides a recombinant expression vector containing the lactoferrin peptide encoding gene.
[0013] The present invention also provides genetically engineered bacteria containing the lactoferrin peptide encoding gene, wherein the genetically engineered bacteria are Pichia pastoris, Bacillus subtilis, and Escherichia coli.
[0014] The present invention also provides a method for preparing the lactoferrin peptide, the method comprising the following steps:
[0015] (1) The gene encoding the lactoferrin peptide was ligated to the BamHI and PstI sites of the expression vector pWB-PxylA to obtain a recombinant expression vector;
[0016] (2) Transform the recombinant expression vector into Bacillus subtilis, and obtain recombinant bacteria by screening positive clones for kanamycin resistance;
[0017] (3) The recombinant bacteria are inoculated into the fermentation medium and fermented in a fermenter. After centrifugation, a fermentation preparation containing lactoferrin peptide is obtained.
[0018] Furthermore, the fermentation medium is formulated as follows (by mass): 2-5% soybean meal, 3-5% corn starch, 1000 U / g neutral protease, 1000 U / g high-temperature amylase, 1-3% glucose, 0.1-0.5% ammonium sulfate, 0.01-0.1% magnesium sulfate, 0.01-0.1% calcium chloride, 0.2-0.8% potassium dihydrogen phosphate, 0.02-0.05% Tween 80, and 3-10% corn steep liquor. After fermentation for 10 hours, xylose is added to induce expression, and the final mass concentration of xylose is 0.5-1.0%.
[0019] The present invention also provides the use of the lactoferrin peptide mutant in the preparation of formulations with anti-inflammatory and antioxidant properties.
[0020] Furthermore, the lactoferrin peptides can effectively reduce alcohol-induced oxidative damage, fatty degeneration, and apoptosis of liver cells, promote liver function recovery, and enhance the body's immunity.
[0021] Furthermore, preparations containing the lactoferrin peptide can be added to milk powder and liver-protecting and hangover-relieving health products for the prevention, treatment, or adjuvant therapy of inflammatory infections and oxidative damage using antibiotics. They can also be used to prepare wound dressings, etc.
[0022] Compared with the prior art, the present invention has the following advantages:
[0023] The lactoferrin peptides provided in this invention are highly bioactive lactoferrin peptides obtained through extensive experimental screening, namely LF-1M (M10L), LF-2M (M10L, A15Y), and LF-3M (M10L, A15Y, and S17R). This invention involves mutating three amino acid sites of lactoferrin B. Compared to the original peptide, the optimized lactoferrin peptides can reduce elevated serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels by approximately 25% and 20%, respectively. The lactoferrin peptide mutants obtained in this invention exhibit better anti-inflammatory and antioxidant effects, providing an application technology solution for developing next-generation peptide drugs for the treatment of various inflammatory and oxidative stress-related diseases such as alcoholic liver disease, hepatitis, and acute lung injury.
[0024] This invention utilizes commercially available Bacillus subtilis WB600 as an expression host and successfully induces the expression of lactoferrin peptide using an inducible promoter, while simultaneously improving the stability and bioactivity of LF. Furthermore, the preparation method provided by this invention significantly reduces the production cost of active lactoferrin peptides, demonstrating promising market application prospects. Attached Figure Description
[0025] Figure 1The image shows the results of overlapping PCR amplification of lactoferrin peptides, where numbers 1-3 represent lactoferrin peptides LF-1M, LF-2M, and LF-3M, respectively.
[0026] Figure 2 SDS-PAGE of heterologous expression of lactoferrin peptides in Bacillus subtilis, where numbers 1-3 are lactoferrin peptides LF-1M, LF-2M, and LF-3M, respectively.
[0027] Figure 3 This is a diagram showing the effect of lactoferrin peptide on serum ALT / AST levels in mice.
[0028] Figure 4 This is a diagram showing the effect of lactoferrin peptide in this invention on the levels of pro-inflammatory factors TNF-α and IL-6 in mouse serum. Detailed Implementation
[0029] The following embodiments are merely preferred embodiments of the present invention and are not intended to limit the present invention in any way. Other variations and modifications may be made without departing from the technical solutions described in the claims. The protection and scope of the claims of the present invention are not limited to the examples provided.
[0030] Unless otherwise specified, the reagents and biological materials used in the following specific examples are commercially available.
[0031] 1. Strains and vectors
[0032] Bacillus subtilis 168, plasmid pWB980, and Escherichia coli BL21, plasmid pET-21a(+), were purchased from Invitrogen.
[0033] 2. Reagents and Culture Media
[0034] Plasmid extraction kit, fragment purification and recovery kit, restriction endonucleases, and protein markers (Blue Plus II Protein Marker (14-120 kDa)) were purchased from Nanjing Novizan Co., Ltd.; kanamycin and ampicillin were purchased from Sangon Biotech (Shanghai) Co., Ltd.; and the whole genome was synthesized by Shanghai Jierui Biotechnology Co., Ltd.
[0035] LB medium: 1% tryptone, 0.5% yeast extract, 1% NaCl.
[0036] Fermentation medium: soybean meal 2-5%, corn starch 3-5%, neutral protease 1000U / g, high-temperature amylase 1000U / g, glucose 3-5%, ammonium sulfate 0.1-0.5%, magnesium sulfate 0.01-0.1%, calcium chloride 0.01-0.1%, potassium dihydrogen phosphate 0.2-0.8%, Tween 80 0.02-0.05%, corn steep liquor 3-10%. (by mass).
[0037] 3. Measurement of indicators (MDA, GSH, SOD, CAT, ALT, AST)
[0038] The reagent kits from the Nanjing Institute of Biotechnology are used in strict accordance with the instructions.
[0039] 4. Transformation method of Bacillus subtilis
[0040] The preparation and transformation of competent cells were performed using a modified Spizizen method, detailed below:
[0041] Reagents:
[0042] (1)SPI-A Salts Solution: (500 mL Solution)
[0043] 0.4% (NH4)2SO4 2 g;
[0044] 2.8% K2HPO4×3H2O 14 g;
[0045] 1.2% KH2PO4 6 g;
[0046] 0.2% Trisodium Citrate Dihydrate 1 g;
[0047] Sterilize at 121℃ for 20 min.
[0048] (2)SPI-B Salts Solution: (500 mL Solution)
[0049] 0.04% MgSO4×7H2O 0.2 g;
[0050] Sterilize at 121℃ for 20 min.
[0051] (3) 100×CAYE Solution: (100 mL Solution)
[0052] 2% Casamino acid 2 g;
[0053] 10% Yeast Extract 10 g;
[0054] Sterilize at 121℃ for 20 min.
[0055] (4) SPI Medium: (20 mL)
[0056] 9.8 mL SPI-A Salts Solution;
[0057] 9.8 mL SPI-B Salts Solution;
[0058] 200 μL (1% V) Glucose (50% W, i.e., 125 g / 250 mL solution, sterilized at 115℃ for 20 min);
[0059] 200 μL (1% V) 100×CAYE.
[0060] (5) SPII Medium: (6 mL)
[0061] 5.88 mL SPI Medium;
[0062] 60 μL (1% V) 50 mM CaCl2 (100 mL: 5 mL of 1 mol / L CaCl2×2H2O (MW: 147.02) solution, diluted with water to 100 mL);
[0063] 60 μL (1% V) 250 mM MgCl2 (100 mL: 5.1 g MgCl2×6H2O (MW: 203.30) solution, diluted with water to 100 mL).
[0064] (6) 100×EGTA Solution: 10 mmol / L EGTA solution (add a small amount of NaOH to pH 8.0 when dissolving), filter to sterilize, and store at 4℃.
[0065] Conversion steps:
[0066] (1) The host bacteria were picked the night before and inoculated into 3 mL of LB liquid medium and cultured overnight at 37°C in a shaker at 200 rpm.
[0067] (2) On the morning of the second day, take 100 μL of bacterial culture from the overnight culture and inoculate it into 5 mL of SPI Medium prepared in a 50 mL centrifuge tube. Incubate at 37°C in a shaker. OD is measured after 3 h. 600When the culture reaches the end of the logarithmic phase (approximately 4.5-5 hours), quickly inoculate 200 μL into 2 mL of SPII Medium, adjust to 100 rpm, and incubate at 37°C in a shaker for 1.5 hours.
[0068] (3) Add 20 μL of 100×EGTA solution and incubate at 37℃ and 100 rpm for 10 min. Divide the solution into 500 μL per 1.5 mL centrifuge tube.
[0069] (4) Add an appropriate amount of plasmid or ligation product to the tube, mix gently, and incubate at 37°C and 100 rpm for 1.5 h.
[0070] (5) Collect the bacterial cells by centrifugation at 4000 rpm, discard part of the supernatant, leave about 200 μL and gently resuspend the bacterial cells by pipetting, spread them on LB solid medium plates containing 10 μg / mL kanamycin, and incubate overnight at 37°C.
[0071] Example 1: Gene optimization synthesis of lactoferrin peptide and construction of recombinant genetically engineered bacteria
[0072] This invention references the amino acid sequence of lactoferrin B: FKCRRWQWRMKKLGAPSITCVRRAF (SEQ ID NO: 1), which has a molecular weight of 3.13 kDa and contains 25 amino acids. The corresponding nucleotide sequence was obtained through base optimization, and the gene sequence was artificially synthesized. The nucleotide sequence encoding the gene is shown in SEQ ID NO: 2 and is suitable for expression in Bacillus subtilis hosts. The synthesized sequence also includes six His tags at the gene terminus for easy subsequent purification.
[0073] Subsequently, the synthesized lactoferrin peptide gene and its lactoferrin peptides LF-1M, LF-2M, and LF-3M were cloned into the BamH I and Pst I sites of the expression vector pWB-PxylA (pWB980 plasmid backbone, with the P43 promoter replaced by the xylose-inducible promoter PxylA), respectively. This was then transformed into Bacillus subtilis WB600 (commercially available), and recombinant bacteria were obtained on kanamycin (final concentration 20 μg / mL) resistant plates. After sequencing verification, the correct recombinant vector was extracted and purified, and then used for subsequent mutant construction.
[0074] Example 2: Construction and sequencing verification of lactoferrin peptide mutants
[0075] Primers were designed based on the lactoferrin peptide gene sequence obtained in Example 1, and single-site and multi-site mutations were performed. The primer design and mutants are shown in Table 1.
[0076] Obtaining the LF-1M mutant: Upstream fragment 1 was obtained by PCR amplification using primers PF1 and LF10R; downstream fragment 2 containing the mutation site was obtained by PCR amplification using primers LF10F and PR1; fragments 1 and 2 were mixed in equal proportions and amplified by overlap PCR using primers PF1 and PR1 to obtain the complete gene sequence. The approximately 459 bp complete gene fragment was detected by electrophoresis, purified, and recovered. It was then double-digested with enzymes, and the lactoferrin peptide mutant was ligated to the BamHI and PstI sites of the expression vector pWB-PxylA (pWB980 plasmid backbone, with the P43 promoter replaced by the xylose-inducible promoter PxylA). Following the Bacillus subtilis transformation formula established by Spizizen, the strain was transformed into Bacillus subtilis WB600. Positive clones were screened on kanamycin-resistant LB plates and sequenced to verify the recombinant bacteria.
[0077] Obtaining the LF-2M mutant: Upstream fragment 3 was obtained by PCR amplification using primers PF1 and LF15R; downstream fragment 4 containing the mutation site was obtained by PCR amplification using primers LF15F and PR1; fragments 3 and 4 were mixed in equal proportions and amplified by overlap PCR using primers PF1 and PR1 to obtain the complete gene sequence. The approximately 459 bp complete gene fragment was detected by electrophoresis, purified, and recovered. It was then double-digested with enzymes, and the lactoferrin peptide mutant was ligated to the BamHI and PstI sites of the expression vector pWB-PxylA (pWB980 plasmid backbone, with the P43 promoter replaced by the xylose-inducible promoter PxylA). Following the Bacillus subtilis transformation formula established by Spizizen, the strain was transformed into Bacillus subtilis WB600. Positive clones were screened on kanamycin-resistant LB plates and sequenced to verify the recombinant bacteria.
[0078] Obtaining the LF-3M mutant: Upstream fragment 5 was obtained by PCR amplification using primers PF1 and LF17R; downstream fragment 6 containing the mutation site was obtained by PCR amplification using primers LF17F and PR1; fragments 5 and 6 were mixed in equal proportions and amplified by overlap PCR using primers PF1 and PR1 to obtain the complete gene sequence. The approximately 459 bp complete gene fragment was detected by electrophoresis, purified, and recovered. It was then double-digested with enzymes, and the lactoferrin peptide mutant was ligated to the BamHI and PstI sites of the expression vector pWB-PxylA (pWB980 plasmid backbone, with the P43 promoter replaced by the xylose-inducible promoter PxylA). Following the Bacillus subtilis transformation formula established by Spizizen, the strain was transformed into Bacillus subtilis WB600. Positive clones were screened on kanamycin-resistant LB plates and sequenced to verify the recombinant bacteria.
[0079] SEQ ID No:3
[0080] FKCRRWQWRLKKLGAPSITCVRRAF
[0081] SEQ ID No:4
[0082] TTTAAATGTAGAAGATGGCAATGGAGATTGAAAAAACTGGGAGCCGTCAATTACATGTGTGAGAAGAGCGTTT
[0083] SEQ ID NO:5
[0084] FKCRRWQWRLKKLGYPSITCVRRAF
[0085] SEQ ID No:6
[0086] TTTAAATGTAGAAGATGGCAATGGAGATTGAAAAAACTGGGATACCCGTCAATTACATGTGTGAGAAGAGCGTTT
[0087] SEQ ID NO:7
[0088] FKCRRWQWRLKKLGYPRITCVRRAF
[0089] SEQ ID No:8
[0090] TTTAAATGTAGAAGATGGCAATGGAGATTGAAAAAACTGGGATACCCGCGTATTACATGTGTGAGAAGAGCGTTT
[0091] Table 1 Primer sequence listing
[0092]
[0093] Upstream / downstream fragment PCR: PCR upstream primer (10 pmol / µL) 2µL; PCR downstream primer (10 pmol / µL) 2µL; dNTP mixture 1µL; PCR Buffer 10µL; template DNA 0.5µL; DNA polymerase 1µL; add double-distilled water to a total volume of 50µL.
[0094] The PCR reaction conditions were as follows: 95℃ pre-denaturation for 3 min, 94℃ denaturation for 10 sec, 58℃ annealing for 30 sec, 72℃ extension for 20 sec, 30 cycles, 72℃, final extension for 10 min, and storage at 15℃.
[0095] The amplified upstream and downstream gene fragments were subjected to overlap PCR: equal amounts of diluted upstream and downstream fragments were added to the PCR system as templates; the overlap PCR amplification program was as follows: 95℃ pre-denaturation for 3 min, 94℃ denaturation for 10 sec, 68℃ annealing for 1 min, 30 cycles (primers PF1 and PR1 were added after 5 cycles), 72℃, extension for 10 min, storage at 15℃, and gel electrophoresis detection.
[0096] Example 3: Fermentation and preparation of optimized lactoferrin peptides LF-1M, LF-2M, and LF-3M in a fermenter
[0097] Genetically engineered bacteria expressing the optimized lactoferrin peptides LF-1M, LF-2M, and LF-3M from the above embodiments were streaked onto LB agar plates containing kanamycin resistance (final concentration of 20 μg / mL) and cultured at 37°C until single colonies grew. Single colonies with good growth were selected for fermentation.
[0098] Seed culture: LB liquid medium containing kanamycin resistance (final concentration 20 μg / mL);
[0099] Fermentation medium (without resistance): by mass ratio, soybean meal 2-5%, corn starch 3-5%, neutral protease 1000U / g, high-temperature amylase 1000U / g, glucose 1-3%, ammonium sulfate 0.1-0.5%, magnesium sulfate 0.01-0.1%, calcium chloride 0.01-0.1%, potassium dihydrogen phosphate 0.2-0.8%, Tween 80 0.02-0.05%, corn steep liquor 3-10%. After fermentation for 10 hours, add 0.5-1.0% (final concentration) xylose to induce expression.
[0100] Fermentation steps: Inoculate the recombinant bacteria into LB liquid medium and culture overnight at 37°C and 200 rpm with shaking; inoculate the overnight cultured seed culture into a 15L fermenter with a liquid volume of 8L.
[0101] Control conditions: 37℃, 300-600 rpm; dissolved oxygen 20%-60%; tank pressure 0.05 MPa; ventilation rate 0-8 h 0.6 m 3 / h; 8h until tank shut-off 0.8-0.9 m 3 / h. Fermentation continues until the spore formation rate, as observed under a microscope, exceeds 90%. The pH remains constant during fermentation. Bioactivity is measured or protein gel electrophoresis is performed to verify the expression of the target protein after 24 hours of fermentation, continuing until fermentation is complete (generally within 48 hours).
[0102] Expression detection:
[0103] After centrifugation at 5000 rpm for 5 min, the supernatant was obtained for application testing. The fermentation supernatant of lactoferrin peptide was filtered through a 0.22 µm filter and then subjected to affinity chromatography using a Ni-NTA column. Gradient elution was performed using binding buffer (20 mM sodium phosphate, 500 mM NaCl, pH 7.4) and elution buffer (containing 250 mM imidazole). The purified product was analyzed by SDS-PAGE protein gel chromatography, and the results are shown below. Figure 2 As shown, the molecular weight of lactoferrin peptide is approximately 3.2 kDa. The band size in the image matches the theoretical value, proving that the expression was successful.
[0104] Example 4: Therapeutic effect of optimized lactoferrin peptide on a mouse model of alcoholic liver disease
[0105] The three lactoferrin peptides from Example 3 were purified and then dissolved in sterile physiological saline. Silymarin was suspended in 0.5% sodium carboxymethyl cellulose.
[0106] Experimental design: Male mice, 8 weeks old, weighing 20-22 g, were selected, with 10 mice in each group, for a total of 70 mice (considering a 10% loss, 75 mice were actually purchased).
[0107] Husbandry conditions: SPF-grade animal room, constant temperature (22±2℃), constant humidity (50±10%), 12 / 12-hour light / dark cycle. Week 1: All mice were fed a control liquid diet to acclimatize to the environment; Weeks 2-8: Groups B, C, D, E, F, and G were fed an alcoholic liquid diet, while Group A was fed the control diet continuously; Weeks 4-8: Groups C, D, E, and F were treated with daily intraperitoneal injections of lactoferrin peptide, Group G was treated with daily gavage with silymarin, and Groups A and B were treated with daily intraperitoneal injections of physiological saline. Week 8: Mice were fasted for 12 hours, anesthetized, blood was collected, and euthanized.
[0108] Table 2 Experimental Groups
[0109]
[0110] Serum ALT / AST assay kits: Alanine aminotransferase (ALT) test kit, aspartate aminotransferase (AST) test kit (Nanjing Jiancheng Bioengineering Institute). Quality control: Each batch of tests includes quality control serum.
[0111] Table 3. Experimental results of lactoferrin peptide on a mouse model of alcoholic liver disease.
[0112]
[0113] (Note: Compared with the normal control group, P<0.01; # Compared with the model group, P<0.05; ## Compared with the model group, P<0.01)
[0114] Experimental results showed that the mouse model was successfully established. Compared with the normal control group, the serum ALT and AST levels in the model group mice were significantly increased (P<0.01), indicating that the alcoholic liver injury model was successfully established. All four lactoferrin peptide groups were able to reduce ALT / AST levels to some extent. Among them, the experimental effects of lactoferrin peptide groups LF-1M, LF-2M, and LF-3M were significantly better than those of lactoferrin B group, demonstrating that the optimized lactoferrin peptides improved their biological activity. Especially in the LF-3M group, ALT decreased by 24.8% and AST by 19.6%. Figure 3 As shown in the figure. Meanwhile, in the positive control group, silymarin also showed a significant protective effect, but slightly lower than the LF-3M mutant peptide group, and comparable to the LF-2M group.
[0115] Example 5: Effects of optimized lactoferrin peptides on serum levels of pro-inflammatory factors TNF-α and IL-6 in mice
[0116] Serum samples from mice in Example 4 were used to determine the concentrations of tumor necrosis factor-α (TNF-α) and interleukin-6 (IL-6) in the serum using ELISA. The assay method was strictly performed according to the kit instructions.
[0117] Table 4. Effects of lactoferrin peptide on serum levels of pro-inflammatory factors TNF-α and IL-6 in mice.
[0118]
[0119] (Note: Compared with the normal control group, P<0.01; # Compared with the model group, P<0.05; ## Compared with the model group, P<0.01)
[0120] Experimental results showed that the levels of key pro-inflammatory factors (TNF-α, IL-6) were significantly elevated in the model control group mice, indicating a severe inflammatory response. The LF mutant groups provided in this invention all reduced the levels of pro-inflammatory factors to varying degrees, especially the LF-3M group, where TNF-α decreased by 54.1% and IL-6 decreased by 52.6%. Figure 4 As shown.
[0121] Example 6: Effects of optimized lactoferrin peptides on hepatic oxidative stress indices in mice with alcoholic liver disease
[0122] This study aims to systematically evaluate the in vivo antioxidant efficacy of liver homogenate by measuring four key oxidative stress markers (MDA, GSH, SOD, CAT) in liver homogenate.
[0123] (1) Liver sample collection and preparation of 10% tissue homogenate
[0124] Sample collection: After the mice were euthanized, the livers were quickly removed, rinsed with pre-cooled physiological saline, and blotted dry with filter paper.
[0125] Accurate weighing: Quickly cut approximately 100 mg of right lobe liver tissue on ice, place it in a pre-chilled centrifuge tube, and weigh it accurately (record as W, unit: g).
[0126] Ice bath homogenization: Add pre-cooled physiological saline or specified buffer (e.g., 0.1 M PBS, pH 7.4) at a weight / volume ratio of 1:9. Homogenize thoroughly in an ice bath using an electric homogenizer (e.g., 10,000 rpm, 3 intermittent homogenizations, 10 seconds each, with a 30-second cooling interval).
[0127] Centrifugation: Centrifuge the homogenate at 4°C and 3000-4000 rpm for 10-15 minutes.
[0128] Supernatant collection: Carefully aspirate the supernatant, which is a 10% liver tissue homogenate. Use immediately for assay or aliquot and store at -80°C (avoid repeated freeze-thaw cycles).
[0129] (2) Methods / Principles for Determining Oxidative Stress Indicators
[0130] All assays were performed using kits from Nanjing Jiancheng Biotechnology Institute, and the procedures were strictly followed according to the instructions. Readings were taken using an ELISA reader or spectrophotometer.
[0131] Indicator 1: Determination of malondialdehyde (MDA) content (thiobarbituric acid method, TBA method)
[0132] Principle: MDA reacts with thiobarbituric acid under acidic and high-temperature conditions to form a red product with a maximum absorption peak at 532 nm.
[0133] Indicator 2: Determination of reduced glutathione (GSH) content (DTNB method)
[0134] Principle: GSH reacts with dithiodinitrobenzoic acid (DTNB) to produce yellow products TNB and GSSG, which have characteristic absorption at 412 nm.
[0135] Indicator 3: Superoxide dismutase (SOD) activity assay (WST-8 method)
[0136] Principle: SOD inhibits the superoxide anion radical-mediated reduction reaction of WST-8 dye. The inhibition rate is directly proportional to the SOD activity. WST-8 can react with superoxide anions (O2) catalyzed by xanthine oxidase (XO). -The reaction produces water-soluble formazan dye. Since SOD can catalyze the disproportionation of superoxide anions, this reaction step can be inhibited by SOD. Therefore, the activity of SOD is negatively correlated with the amount of formazan dye produced. Thus, the enzyme activity of SOD can be calculated by colorimetric analysis of the WST-8 product.
[0137] Indicator 4: Catalase (CAT) activity assay (ammonium molybdate method)
[0138] Principle: The reaction of catalase (CAT) decomposing H2O2 can be rapidly stopped by the addition of ammonium molybdate. The remaining H2O2 reacts with ammonium molybdate to form a yellow complex, which is measured at 405 nm. CAT activity is calculated based on the amount of H2O2 consumed.
[0139] Total protein concentration determination (Bradford method): The protein concentration of all liver homogenate supernatants was determined using the Coomassie Brilliant Blue protein assay kit to normalize all the above indicators to the unit of "protein per milligram" to ensure comparability.
[0140] Table 5. Effects of lactoferrin peptide on hepatic oxidative stress indices in mice with alcoholic liver disease.
[0141]
[0142] (Note: Compared with the normal control group, P<0.01; # Compared with the model group, P<0.05; ## Compared with the model group, P<0.01)
[0143] The experimental results showed that, compared with the normal control group, the liver MDA level in the model group mice was significantly increased (approximately 3.4 times), while the GSH content and the activities of SOD and CAT were significantly decreased (down to approximately 33%, 47%, and 44% of those in the control group, respectively). This indicates that 7 weeks of alcohol intake successfully induced severe hepatic oxidative stress, manifested as increased lipid peroxidation damage and depletion of the endogenous antioxidant defense system.
[0144] LF and its optimized lactoferrin peptides have good in vivo antioxidant stress effects, especially LF-3M, which has significant anti-inflammatory and antioxidant effects. It can significantly reduce alcohol-induced liver lipid peroxidation damage (reduce MDA) and restore the function of the endogenous antioxidant defense system (increase GSH, SOD, CAT), and is comparable to or better than the positive control drug.
[0145] The optimized lactoferrin peptide can reduce serum ALT / AST (improving liver damage) and improve liver oxidative stress indicators (MDA, GSH, SOD, CAT), while more effectively inhibiting systemic inflammatory factors (TNF-α, IL-6). The optimized lactoferrin peptide exerts dual core pharmacological effects of antioxidation and anti-inflammation through synergy.
[0146] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions claimed by the present invention.
Claims
1. An optimized lactoferrin peptide, characterized in that, The lactoferrin peptide is lactoferrin peptide LF-2M, and the amino acid sequence of lactoferrin peptide LF-2M is shown in SEQ ID NO:
5. Lactoferrin peptide LF-2M is obtained by changing methionine at position 10 to leucine and alanine at position 15 to tyrosine in lactoferrin peptide with amino acid sequence SEQ ID NO:
1.
2. The gene encoding the lactoferrin peptide according to claim 1, characterized in that, The nucleotide sequence of the gene encoding the lactoferrin peptide LF-2M is shown in SEQ ID NO:
6.
3. An optimized lactoferrin peptide, characterized in that, The lactoferrin peptide is lactoferrin peptide LF-3M, and the amino acid sequence of lactoferrin peptide LF-3M is shown in SEQ ID NO:
7. Lactoferrin peptide LF-3M is obtained by changing methionine at position 10 to leucine, alanine at position 15 to tyrosine, and serine at position 17 to arginine in lactoferrin peptide with amino acid sequence SEQ ID NO:
1.
4. The gene encoding the lactoferrin peptide according to claim 3, characterized in that, The nucleotide sequence of the gene encoding the lactoferrin peptide LF-3M is shown in SEQ ID NO:
8.
5. A recombinant expression vector or genetically engineered bacterium containing the gene encoding the lactoferrin peptide as described in claim 2 or 4, characterized in that... The genetically engineered bacteria are Pichia pastoris, Bacillus subtilis, or Escherichia coli.
6. The method for preparing lactoferrin peptide according to claim 1 or 3, characterized in that... The preparation method includes the following steps: (1) The gene encoding the lactoferrin peptide was ligated to the BamHI and PstI sites of the expression vector pWB-PxylA to obtain a recombinant expression vector; (2) Transform the recombinant expression vector into Bacillus subtilis, and obtain recombinant bacteria by screening positive clones for kanamycin resistance; (3) The recombinant bacteria are inoculated into the fermentation medium and fermented in a fermenter. After centrifugation, a fermentation supernatant containing lactoferrin peptide is obtained, and the lactoferrin peptide is purified from it.
7. The preparation method according to claim 6, characterized in that, The fermentation medium is formulated as follows (by mass): 2-5% soybean meal, 3-5% corn starch, 1000 U / g neutral protease, 1000 U / g high-temperature amylase, 1-3% glucose, 0.1-0.5% ammonium sulfate, 0.01-0.1% magnesium sulfate, 0.01-0.1% calcium chloride, 0.2-0.8% potassium dihydrogen phosphate, 0.02-0.05% Tween 80, and 3-10% corn steep liquor. After fermentation for 10 hours, xylose is added to induce expression. The final mass concentration of xylose is 0.5-1.0%.
8. The use of the lactoferrin peptide according to claim 1 or 3 in the preparation of medicaments for anti-inflammatory and antioxidant purposes.