Cell sorting method based on split probe collaborative hybridization method and application of cell sorting method

Abstract

The invention relates to a collaborative hybrid cell sorting method based on a split probe and application thereof, and particularly provides a composition for specifically marking cells, a compound with a detectable marker can be formed by the composition and target cells, and the target cells can be separated in a single step by sorting by using a proper method according to the type of the marker. The cells sorted by the method disclosed by the invention have the advantages of high purity, high recovery rate, high sorting speed and mild conditions, and the method is an efficient, accurate and lossless sorting method, is particularly suitable for separating specific cell populations from lymphocytes for cell therapy and the like, and has a wide application prospect.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more specifically to a cell sorting method based on a split-type probe co-hybridization method and its application. Background Technology

[0002] Immunological studies have revealed that different subsets of peripheral blood lymphocytes possess distinct leukocyte differentiation antigens (CDs) on their cell membrane surfaces. The expression characteristics of these CD antigens provide important biomarkers for distinguishing different types of lymphocyte subsets. Accurate sorting of lymphocyte subsets using these marker antigens plays a crucial role in the research and application of immune cells.

[0003] Taking CAR-T cell therapy as an example, its technical principle involves modifying T cells from the patient's peripheral blood in vitro to give them tumor-targeting properties, and then reinfusing these modified CAR-T cells into the patient's body to specifically kill tumor cells, thereby achieving the therapeutic goal. However, current CAR-T cell-based immunotherapy still suffers from side effects such as tumor recurrence, cytokine release syndrome, and immune effector cell-related neurotoxicity syndrome. Studies have found that CAR-T cells prepared from peripheral blood naive / central memory T cells (Tn / mem cells) have a higher cure rate and a lower incidence of side effects such as high-grade inflammatory cytokine release syndrome and immune effector cell-related neurotoxicity syndrome. Therefore, there is an urgent need in this field for precise sorting methods for Tn / mem cells.

[0004] Currently, the mainstream methods for sorting specific subsets of peripheral blood lymphocytes mainly include flow cytometry and magnetic bead sorting. Classical flow cytometry sorting uses fluorescent antibodies to simultaneously label multiple membrane proteins, specifically separating target cells in a single step from various mixed cell types based on their different fluorescent properties. However, the mechanical shearing forces generated during flow cytometry sorting can unavoidably reduce cell viability by approximately 50%, which not only hinders the proliferation activity of separated cells but also reduces the success rate of subsequent CAR-T virus infection. Furthermore, flow cytometry sorting is relatively slow, with a sorting speed of only 10... 9 Each cell requires 24 hours, making it unsuitable for the industrial production of cell therapy drugs.

[0005] Therefore, there is an urgent need in this field to develop a precise, non-destructive, and industrially applicable cell sorting method. Summary of the Invention

[0006] The purpose of this invention is to provide a method for co-hybridization based on split nucleic acid probes to achieve precise, non-destructive, and industrially applicable cell sorting.

[0007] In a first aspect of the invention, a composition for labeling target cells is provided, the composition comprising:

[0008] (1) The first bonding unit includes a branch probe 1 and a targeting element 1;

[0009] (2) A second bonding unit comprising a branch probe 2 and a targeting element 2; and

[0010] (3) A signal unit comprising a bridging probe and a detectable marker, wherein the bridging probe can be complementaryly paired with branch probe 1 and branch probe 2;

[0011] The targeting element 1 and the targeting element 2 target two different marker membrane proteins of the target cell, respectively.

[0012] In another preferred embodiment, when the cell carries two signature membrane proteins simultaneously, the first binding unit, the second binding unit, and the signaling unit form a stable complex with the cell.

[0013] In another preferred embodiment, the probe is a nucleic acid probe, including DNA and RNA, preferably DNA.

[0014] In another preferred embodiment, the bridging probe does not stably hybridize with either branch probe 1 or branch probe 2 alone.

[0015] In another preferred embodiment, the length of the branch probe is 5-20 nt, preferably 8-12 nt, and more preferably 10 nt.

[0016] In another preferred embodiment, the length of the bridging probe is 10-40 nt, preferably 16-24 nt, and more preferably 20 nt.

[0017] In another preferred embodiment, the bridging probe from the 5' end to the 3' end includes: a binding segment 2 and a binding segment 1.

[0018] In another preferred embodiment, the sequence of branch probe 1 is: CATCTAACCC (SEQ ID NO:1); the sequence of branch probe 2 is: CCCTTTCTAG (SEQ ID NO:2); and the sequence of bridging probe is: GGGTTAGATG CTAGAAAGGG (SEQ ID NO:3).

[0019] In another preferred embodiment, the sequence of branch probe 1 is: CTACATAACC (SEQ ID NO:4); the sequence of branch probe 2 is: CCCTTTCTCC (SEQ ID NO:5); and the sequence of bridging probe is: GGTTATGTAG GGAGAAAGGG (SEQ ID NO:6).

[0020] In another preferred embodiment, the sequence of branch probe 1 is: CATCTAGCCC (SEQ ID NO:7); the sequence of branch probe 2 is: ATCAACCCGT (SEQ ID NO:8); and the sequence of bridging probe is: GGGCTAGATG ACGGGTTGAT (SEQ ID NO:9).

[0021] In another preferred embodiment, the sequence of branch probe 1 is: GGGGTAGAAG (SEQ ID NO:10); the sequence of branch probe 2 is: GGTTGATGGG (SEQ ID NO:11); and the sequence of bridging probe is: CTTCTACCCC CCCATCAACC (SEQ ID NO:12).

[0022] In another preferred embodiment, the first bonding unit has a structure as shown in Formula I:

[0023] P1-L-T1(I)

[0024] In the formula,

[0025] P1 represents branch probe 1, which is complementary to the binding segment 1 of the bridging probe;

[0026] L indicates no or no connector.

[0027] T1 represents target element 1.

[0028] In another preferred embodiment, the second bonding unit has a structure as shown in Formula II:

[0029] T2-L-P2(II)

[0030] In the formula,

[0031] T2 represents target element 2.

[0032] L indicates no or no connector.

[0033] P2 represents probe sequence 2, which is complementary to the binding segment 2 of the bridging probe.

[0034] In another preferred embodiment, the complementary pairing includes reverse complementary pairing.

[0035] In another preferred embodiment, the connector is a Poly A sequence.

[0036] In another preferred embodiment, the length of the Poly A sequence is 10-20 nt, preferably 12-18 nt, and more preferably 15 nt.

[0037] In another preferred embodiment, the bridging probe is optionally connected to a detectable marker via a connector.

[0038] In another preferred embodiment, the signal unit has the following structure: bridging probe - connector - detectable marker.

[0039] In another preferred embodiment, the connector is a Poly A connector.

[0040] In another preferred embodiment, the length of the Poly A sequence is 10-20 nt, preferably 12-18 nt, and more preferably 15 nt.

[0041] In another preferred embodiment, the targeting element targets a signature membrane protein of the target cell.

[0042] In another preferred embodiment, the marker membrane protein combination is a combination of proteins that are specifically expressed or highly expressed on the target cells.

[0043] In another preferred embodiment, the targeting element is selected from the group consisting of antibodies, nucleic acid aptamers, peptides, and small chemical molecule embryos.

[0044] In another preferred embodiment, the detectable label is selected from the group consisting of biotin and its derivatives, fluorescent groups, protein tags, or combinations thereof.

[0045] In another preferred embodiment, the protein tag is selected from the group consisting of His, FLAG, HA, and Myc.

[0046] In another preferred embodiment, target cells can be sorted and / or detected by a detectable marker in the complex.

[0047] In another preferred embodiment, when the target cell has three marker membrane proteins A, B, and C, the composition comprises:

[0048] (1) The first binding unit includes a targeting element 1 coupled to the branch probe 1-1;

[0049] (2) The second binding unit includes a targeting element 2 coupled to branch probe 1-2 and branch probe 2-1;

[0050] (3) The third binding unit includes a targeting element 3 coupled to the branch probe 2-2;

[0051] (4) Bridge unit I, which includes a bridge probe 1 of branch probe 3-1, wherein the bridge probe 1 can be complementaryly paired with both branch probe 1-1 and branch probe 1-2 at the same time.

[0052] (5) Bridging unit II, comprising bridging probe 2 of branch probe 3-2, wherein bridging probe 2 is complementary to both branch probe 2-1 and branch probe 2-2; and

[0053] (6) Signal unit, comprising a bridging probe 3 with a detectable mark, the bridging probe 3 being complementary to both branch probe 3-1 and branch probe 3-2;

[0054] When the target cell binds to the first binding unit, the second binding unit, and the third binding unit simultaneously, the signaling unit forms a complex with the target cell through the binding units.

[0055] In another preferred embodiment, the structures of the various portions of the composition (from the 5' end to the 3' end) are shown below, where P represents a branch probe, L represents no or no connector, T represents a targeting element, and Q represents a bridging probe:

[0056] (1) The structure of the first bonding unit is: P 1-1 -L-T1;

[0057] (2) The structure of the second bonding unit is: P 2-1 -L-T2-LP 1-2 ;

[0058] (3) The structure of the third bonding unit is: T3-LP 2-2 ;

[0059] (4) The structure of bridging unit I is: Q1-LP 3-1 ;where Q1 and P 1-1 and P 1-2 Complementary pairing;

[0060] (5) The structure of bridging unit II is: P 3-2 -L-Q2; where Q2 and P 2-1 and P 2-2 Complementary pairing;

[0061] (6) The structure of the signal unit is: Q3; Q3 and P 3-1 and P 3-2 Complementary pairing.

[0062] In another preferred embodiment, branch probe 1-1, branch probe 1-2 and bridging probe 1 hybridize without hybridizing with other probes.

[0063] In another preferred embodiment, branch probe 2-1, branch probe 2-2 and bridging probe 2 hybridize without hybridizing with other probes.

[0064] In another preferred embodiment, branch probe 3-1, branch probe 3-2 and bridging probe 3 hybridize without hybridizing with other probes.

[0065] In another preferred embodiment, targeting elements 1, 2 and 3 target membrane proteins A, B and C, respectively.

[0066] In another preferred embodiment, the branch probe P 1-1 The sequence is: CTACATAACC (SEQ ID NO:4); branch probe P 1-2 The sequence of the bridging probe Q1 is: CCCTTTCTCC (SEQ ID NO:5); the sequence of the bridging probe Q1 is: GGTTATGTAG GGAGAAAGGG (SEQ ID NO:6).

[0067] In another preferred embodiment, the branch probe P 2-1 The sequence is: CATCTAGCCC (SEQ ID NO:7); branch probe P 2-2 The sequence of the bridging probe Q2 is: ATCAACCCGT (SEQ ID NO:8); the sequence of the bridging probe Q2 is: GGGCTAGATG ACGGGTTGAT (SEQ ID NO:9).

[0068] In another preferred embodiment, the branch probe P 3-1 The sequence of probe 1 is: GGGGTAGAAG (SEQ ID NO:10); the sequence of branch probe 2 is: P 3-2 The sequence of the bridging probe Q3 is: GGTTGATGGG (SEQ ID NO:11); the sequence of the bridging probe Q3 is: CTTCTACCCCCCCATCAACC (SEQ ID NO:12).

[0069] In another preferred embodiment, L is a PolyA sequence of length 10-20 nt, preferably 12-18 nt, and more preferably 15 nt.

[0070] In another preferred embodiment, the sequence of L is AAAAA AAAAA AAAAA (SEQ ID NO:32).

[0071] In another preferred embodiment, when the target cells have marker membrane proteins A and C but do not contain membrane protein B, the composition comprises:

[0072] (1) The first binding unit includes a targeting element 1 coupled to the branch probe I;

[0073] (2) The second binding unit includes a targeting element 2 coupled to the branch probe II;

[0074] (3) The third binding unit includes a targeting element 3 coupled to the branch probe III;

[0075] (4) Blocking unit, including bridging probe 1, which can be complementaryly paired with branch probe II and branch probe III at the same time;

[0076] (5) Signal unit, comprising a bridging probe 2 with a detectable marker, the bridging probe 2 being complementary to both branch probe I and branch probe III.

[0077] In another preferred embodiment, targeting elements 1, 2, and 3 target membrane proteins A, B, and C, respectively. When proteins A, B, and C are present in the cell, the blocking unit can form a stable complex with branch probe II of the second binding unit and branch probe III of the third binding unit, preventing the signaling unit from forming a stable complex with branch probe I of the first binding unit and branch probe III of the third binding unit, thus enabling the cell to carry a detectable label. When only proteins A and C are present in the cell, the signaling unit forms a stable complex with branch probe I of the first binding unit and branch probe III of the third binding unit, enabling the cell to carry a detectable label.

[0078] In another preferred embodiment, the sequence of branch probe I is CCCCTAATCA (SEQ ID NO:13), the sequence of branch probe II is CCCAACCTAT (SEQ ID NO:14), the sequence of branch probe III is CCCTCAATC (SEQ ID NO:15), the sequence of bridging probe 1 is GATTGAGGGG ATAGGTTGGG (SEQ ID NO:16), and the sequence of bridging probe 2 is TGATTAGGGG ATAGGTTGGG (SEQ ID NO:17).

[0079] In another preferred embodiment, the composition further comprises a solvent or a buffer solution.

[0080] In another preferred embodiment, the buffer is a D-PBS buffer containing bovine serum albumin (BSA).

[0081] In a second aspect of the invention, a method for cell sorting is provided, the method comprising the steps of:

[0082] S1. Provide a composition as described in the first aspect of the present invention, and co-incubate it with a population of cells to be sorted, so that the composition forms a complex with the target cells;

[0083] S2. Remove the composition that does not form a complex with the cells;

[0084] S3. Separate the complex with the detectable marker to isolate the target cells from the cell population to be sorted.

[0085] In another preferred embodiment, in step S1, the cell population to be sorted is derived from peripheral blood, body fluids, organs, or tissues.

[0086] In another preferred embodiment, the cell population to be sorted is lymphocytes.

[0087] In another preferred embodiment, the target cells are selected from the group consisting of: naive / central memory T cells (Tn / mem), CD4+, and other cells. + T cells, CD8 + T cells, B cells, regulatory T cells (Treg), helper T cells 17 (Th17), NK cells, and mesenchymal stem cells.

[0088] In another preferred embodiment, the combination of the target cell's signature membrane proteins is selected from the group consisting of: CD3 + CD62L high CD3 + CD45RA High CD3 + CD25 + CD19 + CD45 + CD16 + CD56 + .

[0089] In another preferred embodiment, step S1 includes: the cells to be sorted are first co-incubated with the binding unit in the composition, and then co-incubated with the signaling unit.

[0090] In another preferred embodiment, in step S2, the composition that has not formed a complex with the cells is removed by methods such as centrifugation.

[0091] In another preferred embodiment, in step S3, the separation method includes: magnetic bead separation, flow cytometry separation, buoyancy-activated cell separation (X-BACS), and affinity chromatography column.

[0092] In another preferred embodiment, when the detectable marker is biotin, streptavidin-coated magnetic beads are used for sorting in step S3.

[0093] In another preferred embodiment, when the detectable label is a fluorescent group, flow cytometry is used for sorting in step S3.

[0094] In a third aspect of the invention, a method for preparing a composition as described in the first aspect of the invention is provided, comprising the steps of:

[0095] (1) Design and synthesize branch probes and bridging probes, wherein the bridging probes can simultaneously pair complementaryly with two branch probes;

[0096] (2) Determine the combination of marker membrane proteins based on the type of target cells and provide corresponding targeting elements;

[0097] (3) Couple the branch probe to the target element to obtain the binding unit; connect the bridging probe to the detectable marker or the branch probe to obtain the signal unit or the bridging unit.

[0098] In another preferred embodiment, when the target cell has two marker membrane proteins, two targeting elements are provided for the two marker membrane proteins, namely targeting element 1 and targeting element 2; branch probe 1 is coupled to targeting element 1 to obtain a first binding unit; branch probe 2 is coupled to targeting element 2 to obtain a second binding unit; and a bridging probe is labeled with a detectable tag to obtain a signal unit.

[0099] In another preferred embodiment, when the target cell has three marker membrane proteins, three targeting elements for the three marker membrane proteins are provided, namely targeting element 1, targeting element 2, and targeting element 3; branch probe 1-1 is coupled to targeting element 1 to obtain a first binding unit; branch probe 1-2 and branch probe 2-1 are coupled to targeting element 2 to obtain a second binding unit; branch probe 2-2 is coupled to targeting element 3 to obtain a third binding unit; bridging probe 1 is coupled to branch probe 3-1 to obtain bridging unit I; bridging probe 2 is coupled to branch probe 3-2 to obtain bridging unit II; and bridging probe 3 is labeled with a detectable tag to obtain a signal unit.

[0100] In another preferred embodiment, the branch probe contains a Poly A connector between itself and the targeting element.

[0101] In another preferred embodiment, the branched probe with connectors is covalently coupled to the target element via an azide reaction.

[0102] In another preferred embodiment, the targeting element has a -DBCO group; the branched probe with a linker has a -N3 group.

[0103] In another preferred embodiment, the targeting element is coupled with n probes, where n is 1-20, preferably 1-10, and more preferably 1-5.

[0104] In a fourth aspect of the invention, the use of the composition as described in the first aspect of the invention is provided for preparing a targeting agent for specifically targeting and labeling target cells.

[0105] In another preferred embodiment, when the composition comprises the target cells:

[0106] (1) The first bonding unit includes a branch probe 1 and a targeting element 1;

[0107] (2) A second bonding unit comprising a branch probe 2 and a targeting element 2; and

[0108] (3) Signal unit, comprising a bridging probe with a detectable marker, the bridging probe being complementary to branch probe 1 and branch probe 2.

[0109] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Attached Figure Description

[0110] Figure 1 The diagram shows a flowchart of the dual-input AND-gate sorting method based on a splitting probe of the present invention for sorting Tn / mem cells.

[0111] Figure 2 The comparison of the effects of the three sorting methods in Example 1 is shown. (A) Comparison of cell purity of the three methods; (B) Comparison of cell recovery efficiency (yield) between Method 1 and Method 2; (C) Analysis of lymphocyte subset ratios before and after PBMC sorting.

[0112] Figure 3 The invention demonstrates a comparison of cell proliferation activity obtained by the method of the present invention and the flow cytometry sorting method.

[0113] Figure 4 The invention demonstrates a comparison of cytokine secretion in cells obtained by the method of the present invention and by flow cytometry sorting.

[0114] Figure 5 The signal output of the three-input AND gate sorting method on different cell membranes is shown.

[0115] Figure 6 The signal output of the three-input NOT gate sorting method on different cell membranes is shown. Detailed Implementation

[0116] Through extensive and in-depth research, the inventors have developed a cooperative hybridization sorting method based on splitting probes. This method integrates information from two or three membrane proteins, outputs a single signal, and combines it with sorting methods such as magnetic beads to separate target cells in a single step. Specifically, this invention provides a composition for specifically labeling cells, consisting of complementary recognition probes and targeting elements that target membrane proteins. This composition forms a complex with the target cell, thereby attaching a detectable label to the cell, which can then be used for subsequent cell sorting. The method of this invention can be used for efficient, precise, and non-destructive cell sorting.

[0117] Based on this, the present invention was completed.

[0118] Cell sorting

[0119] Lymphocyte sorting is of paramount importance in immunological research and cell therapy applications. For example, for CAR-T cell therapy, poorly differentiated T cells, especially naive T cells, memory stem T cells, and central memory T cells, are ideal sources of CAR-T cells. These T cells can survive long-term in vivo, reduce the incidence of severe cytokine release syndrome (CRS) and neurotoxicity, and demonstrate excellent therapeutic responses in adult patients with relapsed / refractory acute lymphoblastic leukemia. Therefore, efficient, precise, and non-invasive sorting of these T cell subsets from whole blood is crucial for producing highly therapeutically potent CAR-T cells.

[0120] However, sorting some lymphocytes is quite challenging, due to the complex cell types in peripheral blood and the presence of multiple sorting membrane protein markers in some lymphocytes. Currently used methods such as magnetic bead sorting and flow cytometry have drawbacks including cumbersome sorting steps, low efficiency, poor cell purity, and significant cell damage.

[0121] Taking naive / middle memory T cells (Tn / mem cells) as an example, the hallmark feature of their surface membrane proteins is the expression of CD3 and high expression of CD62L, i.e., CD3 + CD62L high During the sorting process, they are easily affected by effector T cells (CD3). + CD62L low Contamination of cells. If flow cytometry is used to sort Tn / mem cells, it will cause cell damage and reduce cell viability; if magnetic bead sorting is used, the sorting of Tn / mem cells involves multiple cell labeling, magnetic bead removal and cell washing because Tn / mem cells have multiple sorting membrane protein markers, making the sorting process cumbersome.

[0122] Similar situations exist for other types of lymphocyte sorting. For example, lymphocytes that use two marker membrane proteins as markers include CD3. + CD45RA High (CD45RA-highly expressed T cells), CD3 + CD25 + (Regulatory T cells), CD19 + CD45 + (B cells), CD16 + CD56 + (NK cells), etc., but not limited to these.

[0123] In addition, cells that use three signature membrane proteins as markers include: CEM cells (TC01) + Sgc8 + Sgc4f + CD45RA + CD62L+ CD95 + (Memory stem T cells), mesenchymal stem cells (CD105) + CD73 + CD90 + (etc., but not limited to these.)

[0124] Cell labeling methods based on splitting probes

[0125] This invention provides a cell labeling method based on a split-type probe, which can integrate information from multiple membrane proteins and label cells, and the labeling has strong specificity.

[0126] Specifically, for target cells possessing two marker membrane proteins, the following composition is used to label the cells:

[0127] (1) The first binding unit includes a targeting element 1 coupled to the branch probe 1;

[0128] (2) A second binding unit comprising a targeting element 2 coupled to the branch probe 2; and

[0129] (3) Signal unit, comprising a bridging probe with a detectable mark, the bridging probe being complementary to both branch probe 1 and branch probe 2.

[0130] As used herein, the term "split probe" refers to the combination of branch probe 1, branch probe 2, and bridging probe described above. The bridging probe hybridizes with branch probe 1 and branch probe 2 only when both are present, forming a stable ternary complex through base stacking forces; when only branch probe 1 or branch probe 2 is present, the bridging probe cannot form a stable complex with them.

[0131] Targeting elements 1 and 2 target two signature membrane proteins of the target cell, respectively. After coupling the probes to the targeting elements and incubating them with the cells, the target cell surface simultaneously bears both branched probe 1 and branched probe 2. Upon further incubation with the signaling unit, the bridging probes complementaryly pair with both branched probe 1 and branched probe 2, forming stable complexes with the target cells. This results in the cells carrying a marker for subsequent detection and / or sorting. For other cells with only branched probe 1 or branched probe 2 on their surface, the bridging probes cannot form stable complexes and detach upon room temperature incubation, thus leaving the cells unmarked. The bridging probes that do not form complexes can be easily removed, ensuring that only the target cells bear the detectable marker.

[0132] The targeting element is a component with high specificity and high affinity for the marker membrane protein of the target cell, such as an antibody or a nucleic acid aptamer, but not limited thereto. In this invention, the type of antibody is not limited, as long as it can bind to the marker membrane protein of the target cell with high specificity and high affinity. For example, the antibodies described in this invention may include IgG type antibodies, single-chain antibodies (scFv), single-domain antibodies (VHH), Fab type antibodies, etc. As used herein, the term "nucleic acid aptamer," also known as "aptamer," refers to a sequence obtained by screening single-chain oligonucleotides (DNA or RNA) through exponential enrichment ligand systematic evolution technology (SELEX) that can specifically bind to a specific target molecule and has high affinity. In this invention, the type and specific sequence of the nucleic acid aptamer are not limited.

[0133] In this invention, the length of branch probe 1 or branch probe 2 is 15-40 nt, preferably 20-30 nt, more preferably 25 nt; the length of the bridging probe is 25-50 nt, preferably 30-40 nt, more preferably 35 nt. Branch probe 1 and / or branch probe 2 have regions complementary to the bridging probe and a Poly A sequence region; the bridging probe has two binding regions complementary to branch probe 1 and branch probe 2 respectively, and a Poly A sequence region, and the two binding regions do not overlap.

[0134] In one exemplary embodiment, the sequence of branch probe 1 is: CATCTAACCC (SEQ ID NO:1); the sequence of branch probe 2 is: CCCTTTCTAG (SEQ ID NO:2); and the sequence of bridging probe is: GGGTTAGATGCTAGAAAGGG (SEQ ID NO:3).

[0135] In one exemplary embodiment, the sequence of branch probe 1 is: CTACATAACC (SEQ ID NO:4); the sequence of branch probe 2 is: CCCTTTCTCC (SEQ ID NO:5); and the sequence of bridging probe is: GGTTATGTAGGGAGAAAGGG (SEQ ID NO:6).

[0136] In one exemplary embodiment, the sequence of branch probe 1 is: CATCTAGCCC (SEQ ID NO:7); the sequence of branch probe 2 is: ATCAACCCGT (SEQ ID NO:8); and the sequence of bridging probe is: GGGCTAGATGACGGGTTGAT (SEQ ID NO:9).

[0137] In one exemplary embodiment, the sequence of branch probe 1 is: GGGGTAGAAG (SEQ ID NO:10); the sequence of branch probe 2 is: GGTTGATGGG (SEQ ID NO:11); and the sequence of bridging probe is: CTTCTACCCCCCCATCAACC (SEQ ID NO:12).

[0138] The bridging probe is coupled to a detectable label via an optional linker. The type of detectable label is not limited; different types of labels can be used depending on subsequent detection and / or sorting needs, including but not limited to biotin (preferably desulfurized biotin) and fluorescent groups. For example, when biotin is used as the detectable label, subsequent sorting can be performed using magnetic beads with streptavidin; when a fluorescent group is used as the detectable label, subsequent detection or sorting can be performed using flow cytometry.

[0139] Dual-input AND gate sorting method based on split-type probe

[0140] This invention provides a method for sorting cells carrying two marker membrane proteins based on a splitting probe. Using the labeling composition described above, target cells that simultaneously express two marker membrane proteins can be labeled with high specificity and precision. Based on the labels, an appropriate method can be selected to separate the target cells.

[0141] Because this method is used to sort cells that simultaneously carry two marker membrane proteins, it is also called the "dual-input AND gate" sorting method. The method specifically includes the following steps:

[0142] S1. Provide a composition as described above comprising a first binding unit, a second binding unit, and a signaling unit, and co-incubate it with a population of cells to be sorted, so that the composition forms a complex with the target cells;

[0143] S2. Remove the composition that has not formed a complex with the cells; for example, it can be removed by conventional methods in the art such as centrifugation and elution;

[0144] S3. Separate the complex with the detectable marker to isolate the target cells from the cell population to be sorted.

[0145] In a preferred embodiment, the incubation sequence in step S1 is as follows: the cells to be sorted are first co-incubated with the binding units in the composition to remove unbound binding unit molecules, and then co-incubated with the signaling units. The incubation time is conventionally selected or determined by those skilled in the art; for example, the co-incubation time with the binding units is 15-60 min, preferably 30 min; the co-incubation time with the signaling units is 15-60 min, preferably 30 min. After incubation, only cells carrying both marker membrane proteins can form stable complexes with the binding units and signaling units, and these complexes have detectable markers located in the bridging units.

[0146] Depending on the type of detectable marker in the composition, the separation / sorting method in step S3 can be selected accordingly. For example, when the detectable marker is biotin, streptavidin-coated magnetic beads are used for sorting in step S3; when the detectable marker is a fluorescent group, flow cytometry is used for sorting in step S3.

[0147] For example, using CD3 as the marker + CD62L high Taking the sorting process of naive / central memory T cells (Tn / mem) as an example, the "dual-input AND gate" sorting method of the present invention is explained in detail. First, CD3 antibody is coupled with branch probe 1 to form a first binding unit; CD62L antibody is coupled with branch probe 2 to form a second binding unit; a bridging probe is linked with dethiobiotin to obtain a signal unit. Then, the first and second binding units are co-incubated with the cell population to be sorted to remove unbound molecules; the signal unit is then added for incubation, and then unbound molecules are removed. Subsequently, the cells are incubated with streptavidin magnetic beads, and the target cells are separated using a magnetic bead separation technique conforming to GMP standards. Finally, the separated target cells are placed in a culture medium containing 2% biotin to dissociate the magnetic beads and obtain the target Tn / mem cells.

[0148] Three-input AND gate sorting method based on split-type probe

[0149] This invention also provides a method for sorting cells carrying three marker membrane proteins based on a splitting probe, also known as a "three-input AND gate" sorting method. The composition used for cell labeling in this method includes:

[0150] (1) The first binding unit includes a targeting element 1 coupled to the branch probe 1-1;

[0151] (2) The second binding unit includes a targeting element 2 coupled to branch probe 1-2 and branch probe 2-1;

[0152] (3) The third binding unit includes a targeting element 3 coupled to the branch probe 2-2;

[0153] (4) Bridge unit I, which includes a bridge probe 1 of branch probe 3-1, wherein the bridge probe 1 can be complementaryly paired with both branch probe 1-1 and branch probe 1-2 at the same time.

[0154] (5) Bridging unit II, comprising bridging probe 2 of branch probe 3-2, wherein bridging probe 2 is complementary to both branch probe 2-1 and branch probe 2-2; and

[0155] (6) Signal unit, comprising a bridging probe 3 with a detectable mark, the bridging probe 3 being complementary to both branch probe 3-1 and branch probe 3-2;

[0156] When the target cell binds to the first binding unit, the second binding unit, and the third binding unit simultaneously, the signaling unit forms a complex with the target cell through the binding units.

[0157] For example, the structures of the various portions of the composition (from the 5' end to the 3' end) are shown below, where P represents a branch probe, L represents no or no connector, T represents a targeting element, and Q represents a bridging probe:

[0158] (1) The structure of the first bonding unit is: P 1-1 -L-T1;

[0159] (2) The structure of the second bonding unit is: P 2-1 -L-T2-LP 1-2 ;

[0160] (3) The structure of the third bonding unit is: T3-LP 2-2 ;

[0161] (4) The structure of bridging unit I is: Q1-LP 3-1 ;where Q1 and P 1-1 and P 1-2 Complementary pairing;

[0162] (5) The structure of bridging unit II is: P 3-2 -L-Q2; where Q2 and P 2-1 and P 2-2 Complementary pairing;

[0163] (6) The structure of the signal unit is: Q3; Q3 and P 3-1 and P 3-2 Complementary pairing.

[0164] For cells carrying three marker membrane proteins A, B, and C, the above-described combination can be used for labeling. Targeting elements 1, 2, and 3 target membrane proteins A, B, and C, respectively. When proteins A and B are present in the cell, bridging unit I forms a complex with the first and second binding units and the cell. When proteins B and C are present, bridging unit II forms a complex with the second and third binding units and the cell. When proteins A, B, and C are present, the signaling unit forms a complex with bridging units I and II, thus attaching a detectable label to the cell. Subsequent detection and / or sorting methods for the target cells are as described above.

[0165] In a preferred embodiment, T1 is aptamer Sgc4f, with the nucleotide sequence GGGATCACTTATAACGAGTGCGGATGCAAACGCCAGACAGGGGGACAGG AGATAAGTGATCCC (SEQ ID NO:18). T2 is aptamer TC01, with the nucleotide sequence CCCACCAAACACAGATGCAACCTGACTTCTAACGTCATTTGGTGGG (SEQ ID NO:19). T3 is aptamer Sgc8, with the nucleotide sequence CCCACCTGCTGCGCCGCCGGGAAAATACTGTACGGGTGGG (SEQ ID NO:20).

[0166] In a preferred embodiment, the sequence of the first binding unit is shown in SEQ ID NO:24; the sequence of the second binding unit is shown in SEQ ID NO:25; the sequence of the third binding unit is shown in SEQ ID NO:26; the sequence of bridging unit I is shown in SEQ ID NO:27; the sequence of bridging unit II is shown in SEQ ID NO:28; and the sequence of the signal unit is shown in SEQ ID NO:12.

[0167] NOT gate sorting method based on split-type probe

[0168] This invention also provides a NOT gate version of the split-probe cohybridization method for excluding cells expressing specific negative membrane protein markers; that is, when a negative signal is present, the blocking probe prevents the signal output of subsequent signaling units. The composition used for cell labeling in this method includes:

[0169] (1) The first binding unit includes a targeting element 1 coupled to the branch probe I;

[0170] (2) The second binding unit includes a targeting element 2 coupled to the branch probe II;

[0171] (3) The third binding unit includes a targeting element 3 coupled to the branch probe III;

[0172] (4) Blocking unit, including bridging probe 1, which can be complementaryly paired with branch probe II and branch probe III at the same time;

[0173] (5) Signal unit, comprising a bridging probe 2 with a detectable marker, the bridging probe 2 being complementary to both branch probe I and branch probe III.

[0174] In another preferred embodiment, targeting elements 1, 2, and 3 target membrane proteins A, B, and C, respectively. When proteins A, B, and C are present in the cell, the blocking unit can form a stable complex with branch probe II of the second binding unit and branch probe III of the third binding unit, preventing the signaling unit from forming a stable complex with branch probe I of the first binding unit and branch probe III of the third binding unit, thus enabling the cell to carry a detectable label. When only proteins A and C are present in the cell, the signaling unit forms a stable complex with branch probe I of the first binding unit and branch probe III of the third binding unit, enabling the cell to carry a detectable label.

[0175] For cells carrying three marker membrane proteins A and C but not membrane protein B, the above combination can be used for labeling. Targeting elements 1, 2, and 3 target membrane proteins A, B, and C, respectively. When cells simultaneously contain proteins A, B, and C, the blocking unit forms a stable complex with the first and second binding units and the cell itself, preventing the signaling unit from forming a stable complex with the first and third binding units, thus preventing the cell from acquiring a detectable label. When cells contain only proteins A and C, the signaling unit forms a stable complex with the first and third binding units, enabling the cell to acquire a detectable label. Subsequent detection and / or sorting methods for the target cells are as described above.

[0176] In a preferred embodiment, the sequence of the first binding unit is shown in SEQ ID NO:29; the sequence of the second binding unit is shown in SEQ ID NO:30; the sequence of the third binding unit is shown in SEQ ID NO:31; the sequence of the blocking unit is shown in SEQ ID NO:16; and the sequence of the signaling unit is shown in SEQ ID NO:17.

[0177] application

[0178] The method of the present invention can be used to isolate multi-target cells, i.e. cells carrying two or three marker membrane proteins, from a population of cells to be sorted.

[0179] In this invention, the cell population to be sorted is not limited in origin, and may be derived from peripheral blood, body fluids, organs, or tissues. In one embodiment, the cell population to be sorted is lymphocytes. In another embodiment, the cell population to be sorted is tumor cells.

[0180] The dual-input AND gate sorting method of this invention can be used to sort cells carrying two marker membrane proteins, including but not limited to: naive / central memory T cells (Tn / mem) and CD4+. + T cells, CD8 + T cells, B cells, regulatory T cells (Tregs), helper T cells 17 (Th17), and NK cells. Among these, the hallmark membrane protein combination of naive / central memory T cells (Tn / mem) is CD3. + CD62L high .

[0181] The "three-input AND gate" sorting method of the present invention can be used to sort cells bearing three marker membrane proteins, including but not limited to: CEM cells (TC01). + Sgc8 + Sgc4f + ) or memory stem T cells (CD45RA) + CD62L + CD95 + ).

[0182] The sorting method of this invention enables efficient, precise, and non-destructive sorting of specific cell subsets in peripheral blood, making it particularly suitable for cell therapy, such as the preparation of CAR-T cells. Taking the sorting of naive / memory T cells (Tn / mem) in peripheral blood as an example, multiple clinical trials have shown that these T cells possess high plasticity, strong cytotoxicity, and in vivo proliferation potential, making them ideal materials for preparing potent CAR-T cells. The method of this invention enables highly efficient sorting of Tn / mem cells for the production of high-potency CAR-T cell products.

[0183] The main advantages of this invention include:

[0184] (1) The sorting method of the present invention has high precision and high recovery efficiency, with the purity of recovered cells reaching over 90%, and the recovery efficiency is comparable to that of gold standard flow cytometry sorting, while the purity of direct magnetic bead sorting in clinical trials is only about 40%.

[0185] (2) Compared with the gold standard flow cytometry sorting, the sorting method of the present invention can perform high-throughput, rapid (within 4 hours) cell sorting, and the reaction conditions are mild and do not damage cells, making it suitable for industrial-scale production of cell therapy drugs.

[0186] (3) The sorting method of the present invention can achieve high signal-to-noise ratio sorting without signal amplification reaction;

[0187] (4) The sorting method of the present invention is a general sorting method. By replacing the target element, it is possible to sort multiple cell types and expand the types of cells that can be sorted.

[0188] (5) The preparation conditions and steps of the target element-probe coupling material used in the sorting method of the present invention are simple, easy to operate and modify, and have low cost, and have the prospect of industrial synthesis.

[0189] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. Unless otherwise stated, percentages and fractions are weight percentages and weight fractions.

[0190] Example 1: Comparison of methods for sorting Tn / mem cells

[0191] In this embodiment, taking the sorting of Tn / mem cells as an example, the three methods of the present invention—the dual-input AND gate + magnetic bead sorting method based on a splitting probe, the flow cytometry sorting method, and the two-step magnetic bead sorting method—are compared.

[0192] After obtaining peripheral blood from the patient, peripheral blood mononuclear cells (PBMCs) were extracted using Ficoll as the cells to be sorted in the following experiments. The target cells for sorting were Tn / mem cells.

[0193] Method 1: The dual-input AND gate + magnetic bead sorting method based on a split-type probe (AND gate) of the present invention.

[0194] A schematic diagram of the dual-input AND gate + magnetic bead sorting method based on a split-type probe of the present invention is shown below. Figure 1 The specific steps are as follows:

[0195] (1) Construction of antibody-cleavage probe conjugates:

[0196] DBCO-PEG4-NHS small molecule was used to label the primary amine of antibodies (αCD3 clone number Hit3a; αCD62L clone number HI30) with DBCO. The DBCO-modified antibody was then covalently linked to 5' or 3' azide-modified branched probes 1 and 2 (hereinafter referred to as probe A and probe D) via a Click reaction. After the ligation reaction, excess unligated split probes were filtered out using a 50 kDa ultrafiltration tube to obtain αCD3-A and αCD62L-D. The sequence of probe A with the linker is: CATCTAACCC AAAAAAAAAA AAAAA-N 3 (SEQ ID NO:21), D probe plus linker sequence: N 3 - AAAAA AAAAA AAAAACCCTTTCTAG (SEQ ID NO:22), and a pre-synthesized bridging probe (i.e., signal unit) modified with dethiobiotin and equipped with a linker: GGGTTAGATG CTAGAAAGGG AAAAA AAAAA AAAAA-Dsb (SEQ ID NO:23). The antibody was a commercially available antibody, and the nucleic acid probe was ordered from Sangon Biotech Co., Ltd.

[0197] (2) Cell labeling, magnetic bead incubation, and cell isolation based on a split-probe co-hybridization method:

[0198] 2×10 6 One PBMC was incubated with 1 μg / mL αCD3-A and 1 μg / mL αCD62L-D in D-PBS buffer containing 3% BSA on ice for 20 minutes. After centrifugation, the cells were washed three times with ice-cold D-PBS. Probes A and D, modified with dethiobiotin, were added and incubated with the cells on ice for 20 minutes. The cells were washed again with buffer, and then incubated with 200 μL of streptavidin magnetic beads (1 μm in diameter) to enrich the dethiobiotin-labeled cells. The labeled cells were then separated using a benchtop magnetic rack. The bead-bound cells were cultured normally in complete RPMI 1640 medium containing 20 mM biotin in an incubator for 4–6 hours, after which the cells detached from the magnetic beads.

[0199] Method 2: Flow Cytometry (FACS)

[0200] Flow cytometry is used as the gold standard method for cell sorting, serving as a control. The steps of flow cytometry sorting are as follows:

[0201] 5×10 from healthy donor whole blood 5After thorough incubation on ice with FITC-labeled anti-human CD3 antibody (clone UCHT1) and AF568-labeled anti-human CD62L antibody (clone EPR23565-109), each PBMC was thoroughly washed and then subjected to BD FACSMelody. TM The system sorted FITC and AF568 double-positive cells.

[0202] Method 3: Two-Step Magnetic Bead Sorting Method (MACS, Two-Step Method)

[0203] PBMCs were sequentially incubated with DSB-labeled αCD3 and streptavidin-coated magnetic beads. After separation using a magnetic rack, the cells were dissociated in complete RPMI 1640 medium supplemented with 20 mM biotin. The enriched cells were then subjected to a second round of separation with DSB-labeled αCD62L.

[0204] Example 2: Comparison of sorting results

[0205] The sorting effects of the three sorting methods in Example 1 are compared as follows:

[0206] (1) Purity and recovery efficiency of Tn / mem cells

[0207] Cells obtained from Method 1 and Method 3 were subjected to immunofluorescence staining (FITC-labeled CD3 antibody and AF568-labeled CD62L antibody), and the purity of the sorted cells was analyzed by flow cytometry. The cell recovery efficiency of cells sorted by Method 2 was automatically calculated by the cell sorter, and the purity was verified by reloading the recovered cells into the sorter.

[0208] The results are as follows Figure 2 As shown. Cell purity results indicate that the Tn / mem cells obtained by Method 1 achieved a purity of 91.6%, similar to the gold standard Method 2 (92.7%), while Method 3 had the lowest cell purity, at only 47.1%. Figure 2 A.

[0209] Cell counting results showed that the yield of Method 1 was 64.1%, which was not significantly different from the gold standard Method 2 (yield 68.6%). (See [link to relevant documentation]). Figure 2 B.

[0210] (2) Sorting bias

[0211] To verify whether the three sorting methods exhibit preference for specific cell subsets when sorting Tn / mem cells, flow cytometry was used to analyze lymphocyte phenotypes. The results showed that both methods effectively enriched poorly differentiated T cells, including naive T cells, memory stem T cells, and central memory T cells. Figure 2C). CD3 sorted by Method 1 + CD62L high The cells were completely identical in subpopulation proportions to those sorted by Method 2, indicating that the AND gate method of this invention did not introduce any bias during the sorting process. Figure 2 C).

[0212] (3) Cell proliferation activity

[0213] To verify that the method of this invention can be used for cell proliferation, Tn / mem cells sorted by this invention and flow cytometry were stimulated in vitro with CD3 / CD28 magnetic beads. Cell proliferation activity was compared between the two methods by CFSE proliferation dye staining analysis. Results are as follows: Figure 3 As shown, this method is similar to flow cytometry for obtaining cell proliferation activity.

[0214] (4) Cytokine secretion status of sorted cells

[0215] To verify the release of inflammatory factors in cells sorted using the method of this invention, the sorted cells were further stimulated with a lymphocyte stimulator, and the release of inflammatory factors was analyzed by intracellular staining. The results are as follows: Figure 4 As shown, the inflammatory factors released by this invention are comparable to those released by the gold standard.

[0216] Example 3: Three-input AND gate sorting method based on split-type probe

[0217] In this embodiment, a three-nucleotide aptamer recognition AND gate sorting method was designed to verify the three-input AND gate sorting method based on a splitting probe of the present invention. The cells to be separated are tumor cells CCRF-CEM(TC01). + Sgc8 + Sgc4f + Ramos (TC01) + Sgc8 - Sgc4f + ) and K562 (TC01) - Sgc8 - Sgc4f - )cell.

[0218] TC01, Sgc4f, and Sgc8 aptamers serve as signal inputs recognized by specific receptors on the cell membrane. All three aptamers contain branched probes from a split-type probe array, with TC01 containing two types of branched probes. When all three aptamers bind simultaneously to the cell membrane surface, branched probe 1-1 of Sgc4f and branched probe 1-2 of TC01 bind to bridging probe 1 in bridging unit I, while branched probe 2-1 of TC01 and branched probe 2-2 of Sgc8 bind to bridging probe 2 in bridging unit II. Furthermore, branched probe 3-1 in bridging unit I and branched probe 3-2 in bridging unit II bind to fluorescent signal output probes (i.e., bridging unit III), thereby outputting a fluorescent signal that can be detected by flow cytometry.

[0219] The experimental procedure is as follows: Aptamers with cleft probes, bridging probes, and signal output probes with fluorescent groups were synthesized and dissolved in a specific buffer solution. Cells were first incubated with the aptamers containing cleft probes for 30 min, centrifuged to remove excess unbound strands, then incubated with the bridging probes for 30 min, centrifuged to remove excess unbound strands, and finally incubated with the signal output probes modified with fluorescent groups for 30 min, centrifuged to remove excess unbound strands. Cell membrane fluorescence was analyzed by flow cytometry.

[0220] The sequences involved are as follows (where underlined sequences indicate branched probes or targeting elements):

[0221] The sequence of the aptamer Sgc4f coupled with the branching probe is as follows (from the 5' end to the 3' end): Branch probe 1-1 connector aptamer Sgc4f ):

[0222] CTACATAACC AAAAAAAAAAAAAAA GGGATCACTTATAACGAGTGCGGATGCAAACGCCAGACAGGGG GACAGGAGATAAGTGATCCC (SEQ ID NO:24);

[0223] The sequence of aptamer TC01 coupled with the branching probe is as follows (from the 5' end to the 3' end): Branch probe 2-1 connector TC01 connector Branch probe 1-2 ):

[0224] CATCTAGCCC AAAAAAAAAAAAAAA CCCACCAAACACAGATGCAACCTGACTTCTAACGTCATTTGGT GGG AAAAAAAAAAAAAAA CCCTTTCTCC (SEQ ID NO:25);

[0225] The sequence of the aptamer Sgc8 coupled with the branching probe is as follows (from the 5' end to the 3' end): aptamer Sgc8 connector point Support probe 2-2 ):

[0226] CCCACCTGCTGCGCCGCCGGGAAAATACTGTACGGTGGG AAAAAAAAAAAAAAA ATCAACCCGT (SEQ ID NO:26);

[0227] Bridging Unit I: The sequence after coupling bridging probe 1 and branch probe 3-1 is as follows (from the 5' end to the 3' end, in sequence as follows): Bridge probe 1 connector Branch probe 3-1 ):

[0228] GGTTATGTAG GGAGAAAGGG AAAAAAAAAAAAAAA GGTTGATGGG (SEQ ID NO:27);

[0229] The sequence after bridging probe 2 and branch probe are coupled is as follows (from 5' end to 3' end): Branch probe 3-2 connector Bridge probe 2 Bridge probe II:

[0230] GGGGTAGAAG AAAAAAAAAAAAAAA GGGCTAGATG ACGGGTTGAT (SEQ ID NO:28);

[0231] The sequence of the signal output probe (bridging probe 3) is as follows:

[0232] CTTTCACCCC CCCATCAACC (SEQ ID NO: 12).

[0233] The results are as follows Figure 5 As shown, for CCRF-CEM cells, the signal-to-noise ratio (SNR) of the signal output exceeded 17-fold, while the SNR of the other two cell lines, Ramos and K562, was less than 2. This indicates that successful labeling is only achieved when all three target receptors are highly expressed on the cell membrane.

[0234] Example 4: Three-input NOT gate sorting method based on split-type probe

[0235] In this embodiment, a NOT gate version of the cohybridization method based on cleft probes was constructed, which allows the exclusion of cells expressing specific negative membrane protein markers. As a proof-of-concept, the B cell receptor (BCR) was selected as the negative signal, the presence of which terminates cell labeling. To achieve this design, aptamers TC01, Sgc4f, and TD05 (highly specific to BCR) were labeled with cleft probes (TC01, Sgc4f, and TD05) to recognize the receptor and display the cleft probes on the cell membrane. When TC01, Sgc4f, and TD05 are simultaneously bound to the cell membrane, the blocking probe binds to branch probe II of Sgc4f and branch probe III of TD05 in the presence of TD05, forming a stable complex that blocks branch probe II of the Sgc4f aptamer. When a signal output probe is added, it cannot bind to branch probe II of Sgc4f, but only to branch probe I of the TC01 aptamer, thus failing to form a stable complex and effectively labeling the cell. When TD05 is absent from the cell membrane, and only TC01 and Sgc4f are present, the blocking probe can only bind to branch probe I of TC01, and this monovalent binding is not stable. When a signal output probe is added, it can simultaneously form a complex with branch probes I and II of TC01 and Sgc4f, forming a stable binding and thus outputting a stable signal.

[0236] The experimental procedure is as follows: Aptamers with cleft probes, bridging probes, and signal output probes with fluorescent groups were synthesized and dissolved in a specific buffer solution. Cells were first incubated with the aptamers containing cleft probes for 30 min, centrifuged to remove excess unbound strands, then incubated with the blocking probes for 30 min, centrifuged to remove excess unbound strands, and finally incubated with the signal output strands modified with fluorescent groups for 30 min, centrifuged to remove excess unbound strands. Cell membrane fluorescence was analyzed by flow cytometry.

[0237] The sequences for coupling aptamers to branching probes and bridging probes to branching probes are as follows:

[0238] The sequence after aptamer TC01 is coupled with branch probe I is as follows (from 5' end to 3' end as follows): Branch probe I connector TC01 ):

[0239] CCCCTAATCA AAAAAAAAAAAAAAA CCCACCAAACACAGATGCAACCTGACTTCTAACGTCATTTGGT GGG (SEQ ID NO:29)

[0240] The sequence of aptamer Sgc4f coupled with branch probe I is as follows (from 5' end to 3' end): aptamer Sgc4f connector Branch Probe II ):

[0241] GGGATCACTTATAACGAGTGCGGATGCAAACGCCAGACAGGGGGACAGGAGATAAGTGATCCC AAAAAAAAAAAAAAA CCCAACCTAT (SEQ ID NO:30)

[0242] The sequence of aptamer TD05 coupled with branch probe II is as follows (from 5' end to 3' end): Branch Probe III connector Fit TD05 ):

[0243] CCCCTCAATC AAAAAAAAAAAAAAA CCAACACCGTGGAGGATAGTTCGGTGGCTGTTCAGGGTCTCCT CCCGGTGTTGG (SEQ ID NO:31)

[0244] Blocking probe: GATTGAGGGG ATAGGTTGGG (SEQ ID NO:16)

[0245] Signal output probe: TGATTAGGGG ATAGGTTGGG (SEQ ID NO:17)

[0246] like Figure 6 As shown, CCRF-CEM can only bind TC01 and Sgc4f, so the NOT gate has a signal-to-noise ratio of more than 30 times in this cell; Ramos cells can bind three aptamers, TC01, Sgc4f and TD05, so there is no signal output on their cell membrane surface; K562 cells cannot bind the above three aptamers, so there is no signal output.

[0247] discuss

[0248] Among the cell sorting methods currently available in this field, the most commonly used are flow cytometry sorting (FACS) and magnetic bead sorting (MACS).

[0249] FACS (Fluid-Assisted Cell Sorting) is the gold standard for cell sorting due to its high accuracy and high recovery rate. However, FACS is relatively slow, with a sorting speed of only 10 cells per minute. 9 Each cell requires more than 24 hours, and FACS can damage the cells.

[0250] Compared to FACS, the traditional MACS method is a non-destructive sorting method. However, for target cells with multiple positive separation markers, the traditional MACS method requires multiple magnetic bead separations, making the operation cumbersome. Furthermore, mainly due to the very high affinity of the antibodies, non-target cells expressing low levels of the target protein may also accumulate, leading to reduced cell sorting purity (e.g., the Tn / mem cell sorting purity in umbilical cord blood samples was only 64.9%).

[0251] This invention provides a co-hybridization sorting method based on split-type probes. The method involves incubating a targeting element with a split-type probe in peripheral blood mononuclear cells, followed by the addition of a bridging probe modified with a detectable label that is complementary to both split-type probes, triggering a co-hybridization reaction. The key to this reaction is that the bridging probe can only stably bind to the cell membrane surface when it is complementary to two split-type probes simultaneously; it is unstable when binding to only one split-type probe and detaches after 5 minutes of incubation at room temperature. The targeting element with the split-type probe can be an antibody, nucleic acid aptamer, or peptide, used to recognize characteristic membrane proteins on the cell membrane. After incubation with the bridging probe, bridging probes binding only one split-type probe are removed by room temperature incubation and washing, while bridging probes binding two split-type probes are retained.

[0252] The method of this invention enables single signal output from target cells, and for cells with multiple targets, only a single separation is required to obtain the target cells. The cell purity and recovery rate obtained by the sorting method of this invention can reach the level of the gold standard FACS, and it can achieve high-throughput, rapid, and non-destructive sorting, making it particularly suitable for cell sorting and industrial applications in the field of cell therapy (such as CAR-T).

[0253] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims.

Claims

1. A composition for labeling a target cell, characterized by, The composition comprises: (1) a first binding unit comprising a branch probe 1 and a targeting element 1; (2) a second binding unit comprising a branch probe 2 and a targeting element 2; and (3) a signal unit comprising a bridge probe and a detectable label, the bridge probe being capable of complementary pairing with the branch probe 1 and the branch probe 2; The targeting element 1 and the targeting element 2 respectively target two different marker membrane proteins of a target cell. The bridge probe comprises, from 5' end to 3' end: a binding segment 2 and a binding segment 1; wherein the binding segment 1 is complementary to the branch probe 1, and the binding segment 2 is complementary to the branch probe 2.

2. The composition of claim 1, wherein The first binding unit has a structure as shown in Formula I:

3. The composition of claim 2, wherein P1-L-T1 (I) In the formula, P1 represents the branch probe 1, which is complementary to the binding segment 1 of the bridge probe; L represents nothing or a linker, T1 represents the targeting element 1; and / or The second binding unit has a structure as shown in Formula II: T2-L-P2 (II) In the formula, T2 represents the targeting element 2, L represents nothing or a linker, P2 represents a probe sequence 2, which is complementary to the binding segment 2 of the bridge probe. The signal unit has a structure of bridge probe-linker-detectable label. The sequence of the branch probe 1 is as shown in SEQ ID NO: 1: CATCTAACCC; the sequence of the branch probe 2 is as shown in SEQ ID NO: 2: CCCTTTCTAG; and the sequence of the bridge probe is as shown in SEQ ID NO: 3: GGGTTAGATG CTAGAAAGGG; 4. The composition of claim 2, wherein Or 5. The composition of claim 1, wherein The sequence of the branch probe 1 is as shown in SEQ ID NO: 4: CTACATAACC; the sequence of the branch probe 2 is as shown in SEQ ID NO: 5: CCCTTTCTCC; and the sequence of the bridge probe is as shown in SEQ ID NO: 6: GGTTATGTAG GGAGAAAGGG; Or The sequence of the branch probe 1 is as shown in SEQ ID NO: 7: CATCTAGCCC; the sequence of the branch probe 2 is as shown in SEQ ID NO: 8: ATCAACCCGT; and the sequence of the bridge probe is as shown in SEQ ID NO: 9: GGGCTAGATG ACGGGTTGAT; Or The sequence of the branch probe 1 is as shown in SEQ ID NO: 10: GGGGTAGAAG; the sequence of the branch probe 2 is as shown in SEQ ID NO: 11: GGTTGATGGG; and the sequence of the bridge probe is as shown in SEQ ID NO: 12: CTTCTACCCC CCCATCAACC. When the target cell has three marker membrane proteins A, B and C, the composition comprises: (1) a first binding unit comprising a targeting element 1 coupled to a branch probe 1-1; 6. The composition of claim 1, wherein (2) a second binding unit comprising a targeting element 2 coupled to a branch probe 1-2 and a branch probe 2-1; (3) a third binding unit comprising a targeting element 3 coupled to a branch probe 2-2; ​ ​ (4) Bridge unit I, comprising bridge probe 1 of branch probe 3-1, which can simultaneously complementarily pair with branch probe 1-1 and branch probe 1-2; (5) Bridge unit II, comprising bridge probe 2 of branch probe 3-2, which simultaneously complementarily pairs with branch probe 2-1 and branch probe 2-2; and (6) Signal unit, comprising bridge probe 3 with detectable label, which simultaneously complementarily pairs with branch probe 3-1 and branch probe 3-2; When the target cell is simultaneously bound by the first binding unit, the second binding unit and the third binding unit, the signal unit forms a complex with the target cell through the binding unit.

7. The composition of claim 1, wherein When the target cell has marker membrane proteins A and C, and does not contain membrane protein B, the composition comprises: (1) First binding unit, comprising targeting element 1 coupled with branch probe I; (2) Second binding unit, comprising targeting element 2 coupled with branch probe II; (3) Third binding unit, comprising targeting element 3 coupled with branch probe III; (4) Blocking unit, comprising bridge probe 1, which can simultaneously complementarily pair with branch probe II and branch probe III; (5) Signal unit, comprising bridge probe 2 with detectable label, which simultaneously complementarily pairs with branch probe I and branch probe III.

8. A method of cell sorting, characterized by, The method comprises the steps of: S1. Providing the composition according to any one of claims 1-7, incubating with the cell population to be sorted, so that the composition forms a complex with the target cell; S2. Removing the composition that does not form a complex with the cell; S3. Isolating the complex with detectable label, thereby separating the target cell from the cell population to be sorted.

9. A process for preparing the composition of claim 1, characterized in that, The method comprises the steps of: (1) Designing and synthesizing branch probes and bridge probes, wherein the bridge probe can simultaneously complementarily pair with two branch probes; (2) According to the type of target cell, determining the combination of marker membrane proteins, and providing the corresponding targeting element; (3) Coupling the branch probes with the targeting elements, respectively, to obtain the binding unit; and coupling the bridge probe with the detectable label or the branch probe to obtain the signal unit or the bridge unit.

10. Use of a composition according to claim 1, characterized in that, The method is used for preparing a targeting reagent for specifically targeting and labeling a target cell.

Images