NK92 cell for expressing CD276 chimeric antigen receptor and SLC1A5 transporter and application of NK92 cell
By expressing the CD276 chimeric antigen receptor and SLC1A5 transporter in NK92 cells, the functional limitations of CAR-T and CAR-NK cell therapies due to nutritional deficiencies in the solid tumor microenvironment were resolved, resulting in stronger tumor targeting and metabolic adaptability, improved therapeutic efficacy, and reduced side effects.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-08
- Publication Date
- 2026-03-10
AI Technical Summary
Existing CAR-T and CAR-NK cell therapies have limited function in the solid tumor microenvironment due to nutritional deficiencies, resulting in unsatisfactory treatment effects and side effects such as cytokine release syndrome.
NK92 cells expressing CD276 chimeric antigen receptor and SLC1A5 transporter were constructed, and their ability to take up glutamine was enhanced through genetic engineering, thereby improving their metabolic adaptability and tumor targeting in the tumor microenvironment.
It significantly enhances the persistence, proliferation capacity, and anti-tumor efficacy of NK92 cells in the tumor microenvironment, reduces the risk of side effects, and is suitable for large-scale production and standardized application.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of biotechnology and immunotherapy, specifically relating to a genetically engineered natural killer (NK92) cell, particularly to a genetically engineered cell that co-expresses a chimeric antigen receptor (CAR) targeting CD276 (B7-H3) and solute carrier family 1 member 5 (SLC1A5, also known as ASCT2) in NK92 cells, and the application of this cell in the treatment of malignant tumors. Background Technology
[0002] Adoptive immunotherapy, particularly CAR-T cell therapy, has achieved revolutionary success in the treatment of hematological malignancies. However, CAR-T therapy has limitations such as serious side effects like cytokine release syndrome (CRS), poor efficacy against solid tumors, and high production costs. NK cell-based CAR therapy, as a promising alternative, has attracted widespread attention due to its higher safety profile (no severe CRS), ability to recognize and kill tumor cells through multiple mechanisms, and potential for allogeneic infusion. NK92 cells, an immortalized NK cell line, possess stable cytotoxicity and ease of genetic engineering, making them an ideal candidate for "off-the-shelf" cell therapy.
[0003] CD276 is a member of the B7 immunoglobulin superfamily. It is highly expressed in various solid tumors (such as glioblastoma, osteosarcoma, lung cancer, and breast cancer), but lowly expressed or not expressed in normal tissues. This expression pattern makes it an ideal target for immunotherapy. Developing CARs that target CD276 can guide effector cells to specifically recognize and eliminate CD276-positive tumor cells.
[0004] The tumor microenvironment (TME) is a major obstacle to the therapeutic efficacy of immunotherapy. The TME presents problems such as nutrient deprivation, hypoxia, and high concentrations of immunosuppressive factors. Glutamine, a key nutrient for cell proliferation and function, is consumed in large quantities by tumor cells within the TME. SLC1A5, a major glutamine transporter, is crucial for cellular metabolic adaptation and survival.
[0005] Traditional CAR-T or CAR-NK cells, upon entering the solid tumor microenvironment, often experience functional exhaustion and decreased proliferative capacity due to nutrient deprivation (such as glutamine), leading to unsatisfactory therapeutic effects. Current research largely focuses on optimizing the structure of CARs (such as co-stimulatory domains), while studies on modifying the metabolic adaptation of effector cells to enhance their survival and function in the harsh TME are relatively limited. Therefore, there is an urgent need for a novel immunocellular therapy that can simultaneously enhance tumor targeting and metabolic adaptation. Summary of the Invention
[0006] The purpose of this invention is to overcome the shortcomings of existing CAR immune cells (especially CAR-NK cells for solid tumors) which are easily limited in function due to metabolic stress in the tumor microenvironment, and to provide a novel genetically engineered NK92 cell. This cell can not only efficiently target CD276 positive tumor cells, but also enhance its adaptability to glutamine deficiency in the tumor microenvironment through metabolic engineering, thereby significantly improving its persistence, proliferative capacity and anti-tumor efficacy in vivo and in vitro.
[0007] To achieve the above objectives, the technical solution created by this invention is implemented as follows: The core of this invention lies in constructing a genetically engineered NK92 cell with dual gene modification (NK92 cells expressing CD276 chimeric antigen receptor and SLC1A5 transporter protein), namely CD276-CAR-SLC1A5-NK92 cells.
[0008] The genetically engineered NK92 cells are constructed based on the NK92 cell line by stably expressing the following two functional elements through genetic engineering technology, including the following aspects: 1. Anti-CD276 chimeric antigen receptor (CD276-CAR): This CAR molecule consists of an extracellular antigen-binding domain, a transmembrane domain, and an intracellular signaling domain.
[0009] Among them, a, extracellular antigen-binding domain: is a single-chain antibody fragment (scFv) that specifically binds to human CD276 antigen, which is derived from a known anti-CD276 monoclonal antibody.
[0010] b. Transmembrane region: Selected from the transmembrane domain of the CD8α molecule.
[0011] c. Intracellular signaling domain: contains two co-stimulatory signaling domains, CD3ζ and 4-1BB.
[0012] 2. Solute carrier family 1 member 5 (SLC1A5) protein: The SLC1A5 gene is a nucleotide sequence encoding the human SLC1A5 transporter protein, and its overexpression is intended to enhance the uptake of glutamine by NK92 cells.
[0013] Furthermore, based on a general inventive concept, the present invention also provides a method for preparing NK92 cells expressing the CD276 chimeric antigen receptor and the SLC1A5 transporter, comprising the following steps: (I) Construction of recombinant lentiviral expression vector (1) The coding sequence of the high-affinity single-chain antibody fragment scFv against human CD276 antigen, as well as the coding sequences of CD8α hinge region and transmembrane region, 4-1BB co-stimulatory domain and CD3ζ signal domain, were synthesized in vitro. These sequences were then linked together to assemble a complete CD276-CAR coding sequence. (2) The eGFP coding sequence for expressing green fluorescent protein was synthesized in vitro, and the coding sequence for human SLC1A5 was synthesized in vitro. (3) The sequence encoding CD276-CAR is linked to the eGFP sequence via the P2A peptide coding sequence, and the eGFP sequence and the SLC1A5 coding sequence are linked via the T2A peptide coding sequence. The sequence is then cloned into a lentiviral expression vector (i.e., a lentiviral transfer plasmid). A bicistronic expression unit is constructed using the P2A and T2A peptide coding sequences to achieve co-expression, ensuring high efficiency and stable co-expression during infection. This yields the recombinant lentiviral expression vector pCDH-EF1α-CAR-P2A-GFP-T2A-SLC1A5. (4) Transform the recombinant lentiviral expression vector from step (3) into competent Escherichia coli cells and perform resistance (ampicillin resistance) screening. After screening by bacterial PCR and sequencing verification, extract the recombinant lentiviral expression vector and store it for later use. (ii) Lentiviral Packaging (5) Virus packaging and virus particle preparation: HEK293T cells frozen at -80℃ were thawed in a 37℃ water bath, transferred to DMEM high glucose medium, centrifuged, supernatant removed, and the cells were resuspended in DMEM high glucose medium and cultured at 37℃ for 24~48h. When the cells grow to about 80%-90% confluence, they are passaged and expanded. Then, the expanded HEK293T cells in the logarithmic growth phase are seeded into DMEM high glucose complete medium and cultured at 37°C for 24 h to obtain the cultured host cells. Then, the recombinant lentiviral expression vector, packaging plasmid and buffer were mixed, and transfection reagent was added. The mixture was shaken and allowed to stand for 10 min. The transfection complex was then added to the cultured host cells. Six hours after transfection, the cells were separated from the culture medium. Antibiotic-free DMEM complete culture medium was added to the cells to change the medium. The culture supernatant was collected at 48 hours and 72 hours after the medium change, and the supernatant was combined, filtered to remove cell debris, and the viral supernatant was obtained. (III) Infected cells (6) Collect NK92 cells in the logarithmic growth phase, resuspend the cells in antibiotic-free NK-92 complete medium, adjust the cell density, and place the cell suspension in a 12-well plate. The lentivirus supernatant and polybrene storage solution obtained in step (5) are mixed with antibiotic-free NK-92 complete culture medium to obtain an infection mixture; the cell suspension is discarded, the culture medium is removed, and NK92 cells are resuspended in the infection mixture for infection. After centrifugation, the cells are cultured for 12-24 hours. The cell suspension is collected, centrifuged, and cultured in a different medium for 12-24 hours. After centrifugation and resuspension, infected cells (CD276-CAR-SLC1A5-NK92 in this invention) are obtained. (iv) Cell expansion (7) NK92 cell lines that stably express CD276-CAR and SLC1A5 were obtained by screening using flow cytometry (FACS), and the genetically engineered cells were expanded and cultured for functional verification and cryopreservation.
[0014] Specifically, in step (1), the encoding sequence of the scFv is as shown in SEQ ID No.1.
[0015] Specifically, in step (1), the CD276-CAR encoding sequence is shown in SEQ ID No.2.
[0016] Specifically, in step (2), the SLC1A5 encoding sequence is shown in SEQ ID No.3.
[0017] Specifically, in step (2), the eGFP coding sequence is: atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaag。
[0018] Specifically, in step (3), the coding sequence of P2A peptide is: ggaagcggagctactaacttcagcctgctgaagcaggctggagacgtggaggagaaccctggacct。
[0019] Specifically, in step (3), the coding sequence of T2A peptide is: GAGGGCAGAGGAAGTCTGCTAACATGCGGTGACGTCGAGGAGAATCCTGGACCT。
[0020] Specifically, in step (3), the lentiviral expression vector is pCDH-EF1a.
[0021] Specifically, in step (5), the passage ratio is 1:3 during amplification.
[0022] Specifically, in step (5), during passage expansion, 24 hours before transfection, third-generation HEK293T cells in logarithmic growth phase are passaged at a density of 3.0 × 10⁻⁶ cells / year. 6 Cells were seeded at a density of 10 cells / 10 cm dish in DMEM high glucose complete medium.
[0023] Specifically, in step (5), the buffer is jetPRIME buffer, and the ratio of the amount of buffer to the recombinant lentiviral expression vector is 100L:1g; the packaging plasmids are psPAX2 and pMD2.G, and the mass ratio of the recombinant lentiviral expression vector to psPAX2 and pMD2.G is 4:3:1.
[0024] Specifically, in step (5), the transfection reagent is jetPRIME transfection reagent, the amount of transfection reagent added is 16μL, the volume of transfection reagent: total mass of DNA = 2L : 1g, or the volume ratio of buffer to transfection reagent is 33:1.
[0025] Specifically, in step (6), the cell density is adjusted to 1×10^6 cells / mL.
[0026] Specifically, in step (6), the polyaluminum storage solution is a sterile storage solution with a concentration of 1 mg / mL.
[0027] Specifically, in step (6), the volume ratio of lentivirus supernatant to polyaluminum storage solution is 1000:(1~2).
[0028] Specifically, in step (6), the total volume of the infection mixture is 2-3 mL.
[0029] Furthermore, based on a general inventive concept, the present invention also provides NK92 cells expressing CD276 chimeric antigen receptor and SLC1A5 transporter protein prepared using the above method, specifically, CD276-CAR-SLC1A5-NK92 cells or CD276-CAR-NK92 cells.
[0030] Furthermore, based on a general inventive concept, the present invention also provides the application of NK92 cells expressing CD276 chimeric antigen receptor and SLC1A5 transporter in the preparation of anti-esophageal squamous cell carcinoma drugs.
[0031] Furthermore, based on a general inventive concept, the present invention also provides the application of NK92 cells expressing CD276 chimeric antigen receptor and SLC1A5 transporter in the preparation of drugs to inhibit tumor growth in human xenograft models of esophageal cancer.
[0032] Compared with the prior art, the advantages of the present invention are: 1. Synergistic anti-tumor effect: The CD276-CAR described in this invention provides precise tumor targeting, while the overexpression of SLC1A5 enhances the anti-tumor ability of effector cells under metabolic stress. The combination of the two produces a synergistic anti-tumor effect of "1+1>2".
[0033] 2. Overcoming the limitations of the solid tumor microenvironment: Through metabolic engineering, the cells of this invention have a stronger adaptability to the glutamine-deficient tumor microenvironment, and can maintain longer survival, continuous proliferation and cytotoxic function, thereby more effectively infiltrating and clearing solid tumors.
[0034] 3. High safety and "off-the-shelf" potential: Based on the inherent safety advantages of NK92 cells, the cell therapy of this invention is expected to have a low risk of toxic side effects. At the same time, the NK92 cell line is easy to standardize, scale up, and quality control, making it very suitable for development into an "off-the-shelf" cell therapy product, reducing costs and improving accessibility.
[0035] 4. Clear Functional Validation: In vitro experiments demonstrated that CD276-CAR-SLC1A5-NK92 cells, compared to NK92 cells expressing only CD276-CAR, significantly enhanced the killing and proliferation abilities of CD276-positive tumor cells under glutamine restriction conditions. In vivo experiments also demonstrated that CD276-CAR-SLC1A5-NK92 cells exhibited stronger tumor-suppressive capabilities in tumor-bearing mouse models compared to NK92 cells expressing only CD276-CAR. Attached Figure Description
[0036] Figure 1 This is a schematic diagram of the structure of the recombinant expression vector of the present invention; Figure 2 This is a schematic diagram of the flow cytometry detection results; Figure 3 This is a schematic diagram of the in vitro functional verification results; Figure 4 The diagram shows the results of in vivo efficacy verification; the tumor volume change curves after injection of PBS, unmodified NK92 (CAR-EV-NK92), CD276-CAR-NK92, and CD276-CAR-SLC1A5-NK92 in a tumor-bearing mouse model; and the infiltration of NK92 cells in mouse peripheral blood and mouse tumor cells. Detailed Implementation
[0037] The present invention will be further described in detail below with reference to embodiments, but the embodiments of the present invention are not limited thereto. Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in this technical field. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as known to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein can be applied to the methods of the present invention.
[0038] Unless otherwise specified, the experimental methods in the following examples are generally performed under standard conditions, and the raw materials and reagents used are all commercially available products. Operations not specifically described in the following examples can be performed by referring to existing technologies and relevant product instructions; further details are omitted.
[0039] In the following examples, room temperature or normal temperature refers to 25±5℃.
[0040] Biomaterials, experimental reagents, culture media 1. Biomaterials: Escherichia coli competent cells Stabl3 (TransGen Biotech, CD521); human embryonic kidney cell line HEK293T cells; and esophageal cancer cell line KYSE150 cells were all purchased from the Shanghai Cell Bank of the Chinese Academy of Sciences.
[0041] 2. Vector plasmid: The packaging plasmids were pMD2.G (Addgene, #12259) and psPAX2 (Addgene, #12260).
[0042] 3. Culture medium: The culture medium and components used for HEK293T cells were: DMEM complete medium, which consisted of DMEM high glucose basal medium + 10% fetal bovine serum + 100 U / mL penicillin + 100 µg / mL streptomycin.
[0043] The culture medium and components used for the esophageal cancer cell line KYSE150 were: PRMI 1640 complete medium, which consisted of PRMI 1640 basal medium + 10% fetal bovine serum + 100 U / mL penicillin + 100 µg / mL streptomycin.
[0044] The culture medium and components used for NK92 cells were: a-MEM complete culture medium, which consisted of: a-MEM basal medium + 12.5% fetal bovine serum + 12.5% horse serum + 0.02mM folic acid + 0.2mM inositol + 0.1mM β-mercaptoethanol + 200 IU / ml IL-2 (added fresh each time).
[0045] Example 1 Construction of recombinant lentiviral expression vector 1. The coding sequence of the high-affinity single-chain antibody fragment scFv against human CD276 antigen was obtained by in vitro artificial synthesis (sequence reference: Chinese Patent CN118620844A and literature DOI: 10.1074 / jbc.M115.679852, the specific sequence is shown in SEQ ID NO.1). The coding sequences of CD8α hinge region and transmembrane region, 4-1BB co-stimulatory domain and CD3ζ signal domain were synthesized in vitro. These sequences were then ligated by PCR technology and assembled into a complete CD276-CAR coding sequence as shown in SEQ ID NO.2.
[0046] Specifically, the methods for obtaining the CD8α hinge region and transmembrane region, the 4-1BB co-stimulation domain and the CD3ζ signal domain are referenced in the following document: DOI: 10.1016 / j.tranon.2021.101138.
[0047] 2. The eGFP coding sequence for expressing green fluorescent protein was artificially synthesized in vitro (specific sequence:).
[0048] 3. The complete coding sequence of human SLC1A5 synthesized in vitro (the specific sequence is shown in SEQ ID NO.3, where the coding sequence of human SLC1A5 is from NCBI Gene ID: 6510).
[0049] 4. The CD276-CAR coding sequence and the eGFP sequence were linked by the P2A peptide coding sequence (P2A peptide coding sequence: ggaagcggagctactaacttcagcctgctgaagcaggctggagacgtggaggagaaccctggacct), and the eGFP sequence and the SLC1A5 coding sequence were linked by the T2A peptide coding sequence (T2A peptide coding sequence: GAGGGCAGAGGAAGTCTGCTAACATGCGGTGACGTCGAGGAGAATCCTGGACCT). This was then cloned downstream of the EF-1α promoter of the lentiviral transfer plasmid pCDH-EF1a to construct the recombinant plasmid pCDH-EF1α-CD276-CAR-P2A-eGFP-T2A-SLC1A5. The structure of the recombinant expression vector is shown below. Figure 1 As shown; The connection method between the sequences in this invention adopts conventional technical means in the prior art, and is not the inventive point of this invention, so it will not be described in detail;
[0050] Meanwhile, the control plasmid pCDH-EF1α-CD276-CAR was constructed using the same method described above.
[0051] 5. The constructed recombinant lentiviral expression plasmid pCDH-EF1α-CD276-CAR-P2A-GFP-T2A-SLC1A5 and the control plasmid pCDH-EF1α-CD276-CAR were transformed into E. coli competent cells Stable3, and ampicillin resistance was selected. The plasmid sequencing results were verified by bacterial PCR and sequencing. The recombinant lentiviral expression vector was extracted and stored for later use.
[0052] Example 2 Lentiviral Packaging and NK92 Cell Infection I. Cell resuscitation Remove the frozen HEK293T cells from the -80℃ freezer and immediately place them in a 37℃ water bath, gently shaking continuously until completely thawed within 1 minute. In a clean bench, transfer the cell suspension to a centrifuge tube containing 5 ml of DMEM high-glucose medium and gently pipette to mix. Centrifuge at 1000 rpm for 5 minutes. Discard the supernatant and transfer the cell suspension to a 60 mm culture dish, adding culture medium to a total volume of 5 mL. Gently shake the culture flask to distribute the cells evenly and incubate at 37℃ with 5% CO2.
[0053] II. Cell Passage and Expansion After culturing for 24 or 48 hours, when the cells reach approximately 80%-90% confluence in a 60 mm culture dish, they are passaged for expansion at a ratio of 1:3. HEK293T cells in the third generation logarithmic growth phase after resuscitation are harvested and, 24 hours before transfection, are injected with 3.0 × 10⁻⁶ cells. 6 Seed the cells at a density of 10 cells / 10cm dish, and finally add 10 mL of fresh DMEM high-glucose complete medium to the 10cm dish. Mix well and incubate at 37°C, 5% CO2 for 24 hours.
[0054] III. Virus Packaging and Virus Particle Preparation The recombinant plasmids pCDH-EF1α-CD276-CAR and pCDH-EF1α-CD276-CAR-P2A-GFP-T2A-SLC1A5 constructed in Example 1 were co-transfected with packaging plasmids (psPAX2, pMD2.G) into HEK293T cells, and then cultured in an incubator. The supernatant (viral supernatant) was collected. The specific steps are as follows: (1) Preparation of transfection complex (performed on the day of transfection): a. Take a sterile 1.5 mL EP tube and add 400 μL of jetPRIME buffer; b. Add 4 μg of plasmid pCDH-EF1α-CD276-CAR or 4 μg of plasmid pCDH-EF1α-CD276-CAR-P2A-GFP-T2A-SLC1A5, 3 μg of psPAX2, and 1 μg of pMD2.G to the buffer. Gently tap the tube wall with your finger to mix, do not vortex; c. Quickly add 16 μL of jetPRIME transfection reagent to the DNA / buffer mixture (transfection reagent volume: total DNA mass = 2 μL : 1 μg); d. Vortex immediately for 15 seconds, then let stand at room temperature for 10 minutes to allow the DNA-transfection reagent complex to fully form.
[0055] (2) Transfection (adding the complex to the cells): Add the well-established transfection complex dropwise and evenly to antibiotic-free DMEM complete medium in a 10cm culture dish. Gently shake the culture dish back and forth and side to side several times to mix it evenly. Place the culture dish back in a 37℃, 5% CO2 incubator for continued culture.
[0056] (3) Medium change (6-8 hours after transfection): Observe the cell status under a microscope 6 hours after transfection. At this time, a small number of cells may begin to round out. Carefully aspirate the old culture medium containing the transfection complex, avoiding aspirating cells that are not firmly attached. Add 10 mL of preheated, fresh, antibiotic-free DMEM complete culture medium.
[0057] (4) Virus collection: First collection: 48 hours after medium change, collect the supernatant containing lentivirus particles into a 15mL centrifuge tube using a sterile pipette. The virus supernatant can be temporarily stored in a 4°C refrigerator at this time. Second collection: 72 hours after medium change, collect the culture supernatant again and combine it with the supernatant collected 48 hours later. Filter the collected supernatant through a 0.45μm filter membrane to remove cell debris.
[0058] IV. Slow Viral Infection The lentivirus obtained in step 3 was used to infect NK92 cells in the logarithmic growth phase (reference for obtaining NK92 cells: Leukemia. 1994 Apr;8(4):652-8. PMID: 8152260), and polybrene was added to enhance the infection efficiency.
[0059] The preparations, reagents, and consumables for lentiviral infection of NK-92 cells are as follows: Cells: NK-92 cells in good growth condition with high viability (>90%), in the logarithmic growth phase.
[0060] Virus: Fresh lentivirus supernatant obtained in step 3.
[0061] NK-92-specific culture medium: α-MEM complete culture medium containing IL-2.
[0062] Polybrene: Sterile 1 mg / mL stock solution.
[0063] Consumables: Low-adsorption 12-well plate.
[0064] The specific steps for lentiviral infection of NK-92 cells are as follows: 1) Day 0: Collect NK-92 cells, centrifuge (300g, 5 minutes), and carefully discard the old culture medium. Resuspend the cells in antibiotic-free NK-92 complete medium and count the cells. Adjust the cell density to 1×10^6 cells / mL. Add 1 mL of cell suspension (approximately 1×10^6 cells per well) to each well of a 12-well plate.
[0065] 2) Day 1: The specific steps of infection are as follows: a. Preparation of infection mixture: Add the following reagents in sequence to a sterile centrifuge tube and mix well; Take 1 mL of the fresh lentivirus supernatant obtained in step 3, add 2 μL of polybrene storage solution, and make up to a total volume of 2 mL with antibiotic-free NK-92 complete culture medium.
[0066] b. Change the culture medium: Carefully aspirate the old culture medium from the 12-well plate (NK-92 is a suspension cell, so be careful not to aspirate the cells when aspirating. You can tilt the plate and let it stand for a while to allow the cells to settle to the bottom of one side before aspirating).
[0067] c. Add infection mixture: Immediately add 2 mL of the prepared infection mixture to each corresponding well.
[0068] d. Centrifugation infection: Seal the 12-well plate with sealing film, place it in a pre-equilibrated centrifuge, and centrifuge at 32°C and 800 g for 90 minutes.
[0069] e. Continue culturing: After centrifugation, very gently remove the plate and place it in a 37°C, 5% CO2 incubator for continued culturing.
[0070] 3) Day 2: Change medium / continue culture. 12 hours after infection, observe the cell state under a microscope, collect the cell suspension, centrifuge (300g, 5 minutes), and carefully aspirate the supernatant containing the virus; resuspend the cells in NK-92 complete medium containing antibiotics and transfer them to a new culture plate / flask for continued culture.
[0071] V. Cell Expansion Forty-eight hours after infection, the cells were centrifuged and resuspended to obtain infected cells (CD276-CAR-NK92 and CD276-CAR-SLC1A5-NK92 in this invention), and the expression of GFP was detected by flow cytometry (FACS).
[0072] The specific steps for amplifying and culturing GFP-positive cells after flow cytometry sorting are as follows: 1) Receiving and preliminary processing of sorted cells Cell reception: Flow cytometry was used to collect the sorted GFP-positive cells into a sterile tube containing 5-fold double-strength antibiotics in NK-92 complete medium (containing IL-2). Immediately after cell collection, the collection tube was centrifuged at low speed (300g, 5 minutes), and the supernatant was carefully discarded.
[0073] 2) Resuscitation and Cultivation Resuspension and Seeding: Gently resuspend the cell pellet in prepared NK-92 complete medium (containing IL-2) with 5-fold double antibiotics. Seed the cell suspension into a 24-well plate and place the plate in an incubator at 37°C and 5% CO2. Observe cell morphology, clustering, and density changes under a microscope daily. Closely monitor changes in the color of the culture medium.
[0074] 3) Gradual expansion Initial medium change / passage: Perform the first operation when cell density increases significantly, the culture medium turns yellow, or cell clusters become larger. Gentle pipetting: Gently pipette the cell clusters to disperse them into smaller clumps or single cells. Centrifugation and medium change: Transfer the cell suspension to centrifuge tubes, centrifuge at 300g for 5 minutes, discard the supernatant, and resuspend in fresh NK-92 complete culture medium containing IL-2. Expanding culture: Seed the cells into larger culture spaces, from 24-well plates to 6-well plates, and finally to T25 flasks. Once the cells enter a stable logarithmic growth phase, maintain them according to standard NK-92 cell culture methods, passageing every 2-3 days, always keeping the cell density within the optimal growth range of 0.2-1 × 10^6 cells / mL.
[0075] 4) Verification and cryopreservation Purity Verification: After expanding to a certain quantity, a small portion of cells was taken for flow cytometry analysis to confirm that the GFP positivity rate was close to 100%. Cell Cryopreservation: When a sufficient number of validated high-purity CD276-CAR-SLC1A5-NK92 cells are available, they should be cryopreserved immediately to establish a cell bank for use in subsequent experiments. Cryopreservation Buffer: 90% FBS + 10% DMSO. After programmed cooling, the cells are stored in liquid nitrogen.
[0076] The results are as follows Figure 2As shown: 10 days after NK92 cell transduction, GFP expression was detected by flow cytometry.
[0077] Among them, 1. The meaning of the coordinate axes X-axis (FITC-A): Represents the intensity of GFP fluorescence signal, reflecting whether the cell expresses the target molecule (the stronger the fluorescence, the higher the expression level). Y-axis (SSC-A): Represents the intensity of side-scattered light, reflecting the granularity / internal complexity of the cell (the higher the value, the more organelles and granules there are in the cell, and the more complex the structure).
[0078] 2. Comparative Analysis of the Three Images This set of figures shows the GFP expression positivity rate in NK92 cells after transfection with CD276-CAR and CD276-CAR-SLC1A5: Figure 2 The left and middle images show uninfected NK92 cells as a negative control. Figure 2 The figure in the middle shows that the positive rate of GFP expression in NK92 cells infected with CD276-CAR was 97.2%. Figure 2 The right-middle figure shows that the positive rate of GFP expression in NK92 cells infected with CD276-CAR-SLC1A5 is 89.9%.
[0079] 3. Experimental Conclusions These results indicate that GFP is highly expressed in CD276-CAR-NK92 and CD276-CAR-SLC1A5-NK92, and the background interference of the negative control (Comp-FITC-A) is extremely low, making the experimental results reliable.
[0080] Example 3: In vitro functional verification Cell killing assay: Infected cells obtained in Example 2 were used as target cells, specifically CD276-overexpressing tumor cells (KYSE150). These cells were co-cultured with effector cells (i.e., NK92-infected cells obtained in Example 2) at different effector-target ratios (e.g., 1:1, 5:1, 10:1) according to varying cell numbers. After 4-6 hours, the specific killing rate was detected by flow cytometry.
[0081] Co-cultivation steps (cultivation conditions) Plate preparation: According to the experimental design, add the appropriate volumes of effector cell suspension and target cell suspension to each well of a 96-well circular plate. Ensure that the final culture volume of each well is consistent (total 200 μL), and make up any shortfall with culture medium.
[0082] Plate laying scheme (final volume per well: 200 μL): 10:1 group: 100 μL effector cells (1 x 10^7 / mL) + 100 μL target cells (1 x 10^6 / mL); 5:1 group: 50 μL effector cells (1 x 10^7 / mL) + 100 μL target cells (1 x 10^6 / mL) + 50 μL culture medium; 1:1 group: 10 μL effector cells (1 x 10^7 / mL) + 100 μL target cells (1 x 10^6 / mL) + 90 μL culture medium; Target cell spontaneous death group: 100 μL target cells (1 x 10^5 / mL) + 100 μL culture medium; Effector cell spontaneous death group: 100 μL effector cells (5 x 10^5 / mL) + 100 μL culture medium; Co-culture: Place the 96-well plate in an incubator at 37°C and 5% CO2 for co-culture. Incubation time: 4 hours.
[0083] After co-culture, remove the 96-well plate from the incubator. Centrifuge (300g, 5 minutes), carefully aspirate 100 μL of supernatant for later use, reserving approximately 100 μL for resuspending the cells. Add 0.5 μL of PI (propidium iodide), a fluorescent dye that can distinguish between live and dead cells, and incubate at room temperature in the dark for 5 minutes. After incubation, perform flow cytometry analysis.
[0084] Cytokine secretion assay: The supernatant of the co-culture was used to detect the secretion levels of cytokines such as IFN-γ and TNF-α using an ELISA kit to assess the activation level of effector cells.
[0085] Experimental results: Figure 3 The left-middle image shows a flow cytometry experiment to detect cytotoxicity (killing efficiency); The horizontal axis represents the effector-to-target ratio (the ratio of NK92 cells to KYSE150 tumor cells, 1:1, 5:1, 10:1), and the vertical axis represents cytotoxicity (%).
[0086] Results analysis: Cytotoxicity significantly increased in all CAR-NK92 groups with increasing effector-to-target ratio. Compared with the CAR-EV group, the CD276-CAR and CD276-CAR-SLC1A5 groups showed significantly higher cytotoxicity at all effector-to-target ratios, and the CD726-CAR-SLC1A5 group exhibited higher cytotoxicity than the CD276-CAR group. This indicates that CAR modification targeting CD276 (after SLC1A5 modification) significantly enhances the killing ability of NK cells against KYSE150 tumor cells.
[0087] Figure 3 The image in the middle shows an ELISA kit used to detect IFN-γ secretion. The horizontal axis represents the grouping, and the vertical axis represents the IFN-γ concentration (ng / ml).
[0088] Results analysis: Compared with the CAR-EV group, the IFN-γ secretion levels in the CD276-CAR group and the CD276-CAR-SLC1A5 group were significantly increased, with the CD276-CAR-SLC1A5 group exhibiting the highest IFN-γ secretion level. IFN-γ is an important anti-tumor cytokine, and its increased secretion suggests that the targeted modified CAR-NK92 cells can exert a stronger immune effect by enhancing IFN-γ secretion.
[0089] Figure 3 The image in the middle right shows an ELISA kit used to detect TNF-α secretion. The horizontal axis represents the group, and the vertical axis represents the TNF-α concentration (pg / ml).
[0090] Results analysis: Compared with the CAR-EV group, the TNF-α secretion levels in the CD276-CAR group and the CD276-CAR-SLC1A5 group were significantly increased, and the TNF-α secretion level in the CD276-CAR-SLC1A5 group was much higher than that in the CD276-CAR group. TNF-α has the effects of directly killing tumor cells and regulating immunity, and its significant increase in secretion further proves that CD726-CAR-SLC1A5 modified NK cells can enhance the anti-tumor immune response through high TNF-α secretion.
[0091] Overall Conclusion: These three sets of experiments consistently demonstrated, from the perspectives of "cell-killing ability and key cytokine secretion," that CD276-targeted CAR-NK92 cells (especially those modified with SLC1A5) possess stronger anti-tumor activity—significantly enhancing the killing efficiency against KYSE150 tumor cells and strengthening the immune response through high secretion of cytokines such as IFN-γ and TNF-α. These results provide in vitro functional evidence for the application of CD276-CAR-NK92 cells (and the SLC1A5 modification strategy) in tumor immunotherapy.
[0092] Example 4: In vivo efficacy verification A CD276-positive human tumor xenograft model was established in NSG mice (subcutaneous transplantation of KYSE150 cells). The establishment method is described in the literature DOI: 10.4049 / jimmunol.174.10.6477, DOI:10.1002 / 1097-0142(19920115)69:2<277::aid-cncr2820690202>3.0.co;2-c, DOI: 10.1016 / j.stem.2021.04.011.
[0093] When the tumor grows to approximately 50 mm 3 Mice were randomly divided into four groups: PBS control group, unmodified NK92 group, CD276-CAR-NK92 group, and CD276-CAR-SLC1A5-NK92 group, and the corresponding cells were injected via tail vein.
[0094] Tumor volume was measured twice weekly, and mouse weight and survival status were recorded. After the experiment, tumor tissue and peripheral blood cells from mice were collected for flow cytometry analysis to detect NK cell infiltration (anti-human CD56 antibody staining).
[0095] Experimental results: The CD276-CAR-SLC1A5-NK92 treatment group showed the most significant tumor growth inhibition effect.
[0096] Experimental results: Figure 4 The top left image shows the change in tumor volume over time (line graph). The horizontal axis represents time (Days), and the vertical axis represents tumor volume (mm³).
[0097] Results analysis: Tumor volume in the PBS group increased rapidly over time; while the tumor volume growth in each CAR-NK92 treatment group was significantly slower than that in the PBS group. Among them, the tumor volume growth in the CD276-CAR NK92 and CD276-CAR-SLC1A5 NK92 groups was slower than that in the CAR-EV NK92 group, indicating that CAR modification targeting CD276 (especially after combining with SLC1A5 modification) has a more significant inhibitory effect on tumor growth.
[0098] Figure 4 The top-middle image shows the actual size of the tumor (actual image). The arrangement of tumor cells from different groups showed that the PBS group had the largest tumor volume, followed by the CAR-EV NK92 group, the CD276-CARNK92 group had the smallest tumor volume, and the CD276-CAR-SLC1A5 NK92 group had the smallest tumor volume. This evidence is completely consistent with the tumor volume change trend in the line graph, visually demonstrating that CAR-NK92 cells (especially those with targeted modification) can effectively inhibit tumor growth.
[0099] Figure 4 The top right image shows the tumor weight (bar chart). The x-axis represents grouping, and the y-axis represents tumor weight (mg). Results analysis: The tumor weight in the PBS group was significantly higher than that in all CAR-NK92 treatment groups; the tumor weight in the CD276-CAR NK92 and CD276-CAR-SLC1A5 NK92 groups was significantly lower than that in the CAR-EV NK92 group. This result further quantifies and validates, from the perspective of "weight," that CAR-NK92 cells targeting CD276 (after SLC1A5 modification) exhibit the best tumor-inhibiting effect.
[0100] Overall conclusion: These three sets of experiments consistently demonstrated, from the perspectives of "dynamic changes in volume, physical morphology, and weight quantification," that CD276-targeted CAR-NK92 cells (especially those modified with SLC1A5) exhibit significant anti-tumor effects, effectively inhibiting tumor growth and reducing tumor volume and weight. These results provide direct in vivo experimental evidence for the application of CD276-CAR-NK92 cells (and the SLC1A5 modification strategy) in tumor immunotherapy.
[0101] Figure 4 The lower left image shows the proportion of NK92 cells in the blood; The horizontal axis represents the experimental groups: PBS (blank control group), CAR-EV NK92 (unmodified CAR-NK92 cells), CD276-CARNK92 (CD276-targeted CAR-NK92 cells), and CD276-CAR-SLC1A5 NK92 (SLC1A5-modified CD276-CAR-NK92 cells). The vertical axis represents the percentage of NK92 cells in the blood.
[0102] Results analysis: Compared with the PBS group, the proportion of NK92 cells in the blood of each CAR-NK92 treatment group was significantly increased, indicating that there were more NK92 cells in the blood of the CAR-NK92 cell treatment group.
[0103] Figure 4 The lower right figure shows the proportion of NK92 cells in the tumor; The horizontal axis represents the experimental groups: PBS (blank control group), CAR-EV NK92 (unmodified CAR-NK92 cells), CD276-CARNK92 (CD276-targeted CAR-NK92 cells), and CD276-CAR-SLC1A5 NK92 (SLC1A5-modified CD276-CAR-NK92 cells). The vertical axis represents the percentage of NK92 cells in the tumor.
[0104] Results analysis: Compared with the PBS group, the proportion of NK92 cells in the tumors of each CAR-NK92 treatment group was significantly increased (all were significantly marked by CD56), indicating that CAR-NK92 cell therapy is effective because NK92 cells infiltrate the tumor tissue.
[0105] The results of these two sets of experiments show that CAR-NK92 cells targeting CD276 (especially after modification with SLC1A5) can significantly enhance the tumor-killing ability of NK92 cells, providing cellular-level evidence for their role in tumor immunotherapy and potentially enhancing anti-tumor immune responses.
Claims
1. A method of making an NK92 cell expressing a CD276 chimeric antigen receptor and a SLC1A5 transporter, characterized in that, Comprising the following steps: (I) Construction of recombinant lentiviral expression vector (1) Artificially synthesizing the coding sequence of high-affinity single-chain antibody fragment scFv against human CD276 antigen, and the coding sequences of CD8α hinge region and transmembrane region, 4-1BB costimulatory domain and CD3ζ signaling domain in vitro, and assembling the complete CD276-CAR coding sequence after linking the sequences; (2) Artificially synthesizing the eGFP coding sequence for expressing green fluorescent protein in vitro, and artificially synthesizing the coding sequence of human SLC1A5 in vitro; (3) Linking the sequence encoding CD276-CAR and the eGFP sequence through a P2A peptide coding sequence, then linking the eGFP sequence and the SLC1A5 coding sequence through a T2A peptide coding sequence, and cloning into a lentiviral expression vector, thereby constructing a bicistronic expression unit through P2A peptide coding sequence and T2A peptide coding sequence to achieve synergistic expression, which can ensure high efficiency and stable co-expression during infection, i.e. obtaining the recombinant lentiviral expression vector pCDH-EF1α-CAR-P2A-GFP-T2A-SLC1A5; (4) Transforming the recombinant lentiviral expression vector in step (3) into E. coli competent cells, and performing resistance screening, and extracting the recombinant lentiviral expression vector through bacterial liquid PCR screening and sequencing verification, and storing for standby use; (II) Lentivirus packaging (5) Virus packaging and virus particle preparation: taking HEK293T cells frozen at-80°C, melting in a 37°C water bath, transferring the cells to DMEM high-sugar culture medium, centrifuging, removing the supernatant, resuspending the cells in DMEM high-sugar culture medium, and culturing at 37°C for 24-48h; When the cells grow to about 80%-90% confluence, they are subcultured for expansion, and then the logarithmic phase growth of the expanded HEK293T cells is inoculated in DMEM high-sugar complete culture medium and cultured at 37°C for 24h to obtain the cultured host cells; Then mix the recombinant lentiviral expression vector, packaging plasmid and buffer, then add the transfection reagent and shake, stand for 10min, then add the transfection complex after standing to the cultured host cells, and separate the cells from the culture medium after transfection for 6h, add DMEM complete culture medium without antibiotics to the cells to realize medium replacement, and collect the culture supernatant at 48h and 72h after medium replacement, respectively, combine, filter to remove cell debris, and obtain the virus supernatant; (III) Infection of cells (6) Collecting NK92 cells in the logarithmic growth phase, resuspending the cells with NK-92 complete culture medium without antibiotics, and adjusting the cell density, and placing the cell suspension in a 12-well plate; Mix the lentivirus supernatant obtained in step (5), polybrene stock solution, and NK-92 complete culture medium without antibiotics to obtain an infection mixture; discard the medium of the cell suspension, resuspend the NK92 cells with the infection mixture for infection, centrifuge, culture for 12-24h, collect the cell suspension, centrifuge, replace the medium, culture for 12-24h, centrifuge and resuspend, and obtain the infected cells; (IV) Cell expansion (7) Screening by flow cytometry sorting technology to obtain NK92 cell strains stably expressing CD276-CAR and SLC1A5, amplifying and culturing the genetically engineered cells for function verification and cryopreservation.
2. The production method according to claim 1, wherein In step (1), the coding sequence of the scFv is shown in SEQ ID No. 1; in step (1), the CD276-CAR coding sequence is shown in SEQ ID No.
2.
3. The production method according to claim 1, wherein In step (2), the SLC1A5 coding sequence is shown in SEQ ID No. 3; In step (2), the eGFP coding sequence is: atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaag.
4. The production method according to claim 1, wherein In step (3), the P2A peptide coding sequence is: Ggaagcggagctactaacttcagcctgctgaagcaggctggagacgtggaggagaaccctggacct; In step (3), the T2A peptide coding sequence is: GAGGGCAGAGGAAGTCTGCTAACATGCGGTGACGTCGAGGAGAATCCTGGACCT; In step (3), the lentiviral expression vector is pCDH-EF1a.
5. The production method according to claim 1, wherein In step (5), for the passage expansion, the third generation of logarithmic growth HEK293T cells were inoculated in DMEM high glucose complete culture medium at a density of 3.0 x 10 6 cells / 10 cm dish 24 hours before transfection; In step (5), the buffer is jetPRIME buffer, the ratio of the buffer to the recombinant lentiviral expression vector is 100L:1g; the packaging plasmid is psPAX2 and pMD2.G, the mass ratio of the recombinant lentiviral expression vector to psPAX2 and pMD2.G is 4:3:1; In step (5), the transfection reagent is jetPRIME transfection reagent, the amount of the transfection reagent added is 16μL, the volume of the transfection reagent to the total mass of DNA is 2L:1g, or the volume ratio of the buffer to the transfection reagent is 33:
1.
6. The production method according to claim 1, wherein In step (6), the volume ratio of the lentivirus supernatant to the polybrene stock solution is 1000:(1-2); In step (6), the total volume of the infection mixture is 2-3mL.
7. NK92 cells expressing a CD276 chimeric antigen receptor and a SLC1A5 transporter prepared using any of the methods of claims 1-6, characterized in that, Specifically, the CD276-CAR-SLC1A5-NK92 cell or the CD276-CAR-NK92 cell.
8. The NK92 cell expressing the CD276 chimeric antigen receptor and the SLC1A5 transporter protein of claim 7 in the preparation of an anti-esophageal squamous carcinoma drug.
9. The NK92 cell expressing the CD276 chimeric antigen receptor and the SLC1A5 transporter protein of claim 7 in the preparation of a drug for inhibiting the growth of esophageal cancer human xenograft tumor models.
Citation Information
Patent Citations
Construction method and application of overexpression CBF beta gene in tumor immune cells
CN118620844A