Cystathionine beta-synthase for treatment of homocystinuria

The PEGylated human cystathionine β-synergist (CBS) enzyme, modified through recombinant engineering, has solved the problem of the difficulty in reducing serum homocysteine ​​in existing treatments for homocystinuria, achieving a significant reduction in serum homocysteine ​​and restoring normal metabolite levels, thus improving clinical outcomes.

CN121628883APending Publication Date: 2026-03-10COLORADO UNIV SENATE
View PDF 4 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2014-01-29
Publication Date
2026-03-10

AI Technical Summary

Technical Problem

Existing treatments for homocystinuria are ineffective in lowering serum homocysteine ​​levels, especially in individuals who are not responsive to vitamin B6, and poor dietary adherence leads to serious complications. Current treatments also fail to restore normal metabolite levels simultaneously.

Method used

We provide recombinant engineered human cystathionine β-synthase (CBS) enzymes, which are chemically modified and PEGylated to form PEG-rhCBSΔC or PEG-C15S for enzyme replacement therapy. This significantly increases enzyme stability and activity, reduces dietary restrictions, and restores normal metabolite levels.

Benefits of technology

It significantly reduces serum homocysteine ​​levels, restores normal levels of metabolites such as methionine and cystathionine, improves clinical outcomes, reduces morbidity and mortality, and reduces non-compliance with dietary restrictions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121628883A_ABST
    Figure CN121628883A_ABST
Patent Text Reader

Abstract

The present invention relates to cystathionine beta-synthases for use in the treatment of homocystinuria. The present invention provides agents and methods for enzyme replacement therapy using human cystathionine beta-synthase (CBS), homologs, variants, or mutants thereof to treat homocystinuria and other related diseases and disorders.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] This application is a divisional application of the original application which has an application date of January 29, 2014, application number 201480006554.0 (PCT / US2014 / 013602), with the title "Cystathionine Beta-Synthase for Treatment of Homocystinuria."

[0002] Cross Reference to Related Applications This application claims the benefit of U.S. provisional application number 61 / 758,138, filed January 29, 2013, and U.S. non-provisional application number 13 / 803,804, filed March 14, 2013, the disclosures of each of which are incorporated herein by reference. TECHNICAL FIELD

[0003] The present invention relates generally to compositions suitable for enzyme replacement therapy comprising a human cystathionine beta-synthase (CBS) form that can significantly reduce serum homocysteine (Hcy) concentration and increase production of downstream metabolites such as cystathionine and cysteine. Such compositions are useful in treating conditions or diseases such as homocystinuria and homocysteine remethylation disorders. BACKGROUND CBS, an important enzyme in the transsulfuration pathway, plays a central role in homocysteine (Hcy) metabolism in eukaryotes (Mudd et al., 2001, in THE METABOLIC AND MOLECULAR BASES OF INHERITED DISEASE, 8th Ed., pp. 2007-2056, McGraw-Hill, New York). The CBS enzyme catalyzes the pyridoxal-5'-phosphate (PLP; vitamin B6)-dependent condensation of serine and homocysteine to form cystathionine, which is subsequently used to produce cysteine by another PLP-dependent enzyme, cystathionine gamma-lyase. When CBS activity is sharply reduced or absent, as a result of certain genetic mutations, Hcy builds up in tissues and blood. In mammalian cells with the transsulfuration pathway, CBS occupies a key regulatory position between the remethylation of Hcy to methionine or its alternative use in the biosynthesis of cysteine.

[0004] In healthy normal individuals, the CBS-mediated conversion of Hcy to cystathionine is the rate-limiting intermediate step in the metabolism of methionine (Met) to cysteine (Cys). Vitamin B6 is an essential coenzyme for this process. In individuals with certain genetic mutations in the CBS enzyme, the conversion of Hcy to cystathionine is slowed or missing, resulting in elevated serum concentrations of the enzyme substrate (Hcy) and a corresponding decrease in serum concentrations of the enzyme product (cystathionine; Cth). The clinical condition of elevated serum Hcy levels and its concomitant excretion into the urine is collectively known as homocystinuria.

[0005] Estimates of the prevalence of homocystinuria vary widely. Data from neonatal screening and clinical confirmation provide a range of 1:200,000 to 1:335,000 live births (Mudd et al., 2001). Recent evidence from neonatal DNA screening studies in Denmark, Germany, Norway, and the Czech Republic suggest that the true incidence can be as high as ~1:6,000 (Gaustadnes et al., 1999, N Engl J Med . 1340:1513; Linnebank et al., 2001, Thromb Haemost . 85:986; Refsum et al., 2004, Clin. Chem . 50:3; Sokolova et al., 2001, Hum Mutat .18:548). In addition, recent work has indicated that CBS-deficient homocystinuria (CBSDH) individuals have psychiatric or cardiovascular complications, but are currently undiagnosed because of the lack of characteristic connective tissue defects that typically aid in diagnosis (Li and Stewart, 1999, Pathol . 31:221; Linnebank et al., 2003, J. Inherited Metabol. Dis. 26: 509; Maclean et al., 2002, Hum Mutat . 19:641). The major health problems associated with CBSDH include: cardiovascular disease with a predisposition to thrombosis, resulting in high mortality rates in untreated and partially treated patients; connective tissue problems affecting the visual system with progressive myopia and lens dislocation; connective tissue problems affecting the skeleton, characterized by Marfan syndrome, osteoporosis, and scoliosis; and central nervous system problems, including mental retardation and epilepsy.

[0006] Therapeutic solutions for CBS-associated homocystinuria depend on the type of mutation present in the CBS gene. To date, approximately 160 pathogenic mutations in the CBS gene have been identified in humans. There is a functional trichotomy in the nature of pathogenic mutations associated with CBSDH. One group of mutations is classified as "pyridoxine-responsive", in which CBS enzyme function can be restored with high-dose vitamin B6 treatment. This treatment can be effective, but does not always reduce pathological events in these individuals, some of which even occur over time. A second group of functional mutations is represented by "C-terminal CBS mutants", which lack the ability to respond to post-translational upregulation by S-adenosylmethionine. Individuals with this type of mutation often lack mental retardation and connective tissue phenotypes. This type of mutation was detected after plasma Hcy levels were detected after idiopathic thrombosis events before the age of 40 (Maclean et al., 2002, Hum Mutat. 19: 641-55). The last group of CBSDH mutations is "classical homocystinuria", representing the most severe form of the disease. For these latter two groups of individuals, vitamin B6 treatment alone cannot effectively reduce serum Hcy levels.

[0007] The pathophysiology of homozygous CBS deficiency is undoubtedly complex, but there is consensus that the root instigator of end-organ damage is the extreme elevation of serum Hcy. The toxicity of the extreme elevation of Hcy in blood and tissue concentrations can arise from the molecular reactivity and biological effects of Hcy itself, or from its metabolites that affect numerous biological processes (e.g., Hcy-thiolactone) (Jakubowski et al., 2008, FASEB J 22: 4071-6). Abnormalities in chronic platelet aggregation, changes in vascular parameters, and endothelial dysfunction have all been described in individuals with homocystinuria.

[0008] There are currently three treatment options for CBSDH: 1) Use of pharmacological doses of vitamin B6 to increase the residual activity of CBS activity in vitamin B6-responsive patients; 2) Reduction of serum Hcy by diet with strict Met intake restriction; and 3) Detoxification by betaine-mediated conversion of Hcy to Met, thus reducing serum Hcy concentrations.

[0009] Each of these 3 therapies aims at lowering serum Hcy concentration. Standard treatment for individuals with CBSDH who are non-responsive to vitamin B6 consists of a Met-restricted diet supplemented with metabolic formulas and Cys, which in this case has become a conditionally essential amino acid. Intake of meat, dairy products and other foods rich in natural proteins is prohibited. A daily consumption of unpalatable synthetic metabolic formulas containing amino acids and micronutrients is required to prevent secondary malnutrition. Betaine supplementation (trade name: CYSTADANE™, synonym: trimethylglycine) is also a standard therapy. Betaine acts as a methyl donor for the re-methylation of Hcy to Met in the liver, catalyzed by betaine-homocysteine methyltransferase (Wilcken et al., 1983, N. Engl. J. Med . 309: 448-53). Even in medical centers providing optimal care and resources, dietary compliance is usually poor and this non-compliance is mainly implicated in the development of life-threatening complications of homocystinuria.

[0010] The evidence outlined in the above sections is summarized in the following points: Untreated homocystinuria has a high rate of complications in blood vessels, connective tissues and central nervous system.

[0011] Therapies that lower serum Hcy, such as strict Met-restricted diet and betaine, reduce the associated clinical problems if well implemented. Improvement in cognitive performance requires early treatment in infancy.

[0012] Compliance with the diet is invariably poor. In individuals treated in the neonatal period, a decrease in compliance occurs in adolescence. In individuals treated after the neonatal period, compliance is poor at all ages. The extreme difficulty of the current treatment is evident in individuals who experience life-threatening symptoms that could be prevented by the diet, but who still cannot adhere to the treatment.

[0013] Failure in dietary compliance leads to an increase in serum Hcy, recurrence of complications in blood vessels and connective tissues, including fatal and disabling events, and at the risk of severe side effects such as brain edema (due to excessive serum Met concentration) or severe malnutrition (due to lack of essential amino acids).

[0014] The most effective therapeutic strategy is to increase enzyme activity, as is evident when pyridoxine is administered to vitamin B6 responsive homocystinuria. This strategy is not possible for vitamin B6 non-responsive individuals, as the mutant state and increased enzyme activity in these individuals will depend on the delivery of exogenous enzyme, enzyme replacement therapy (ERT) (a strategy that has never been attempted to treat homocystinuria).

[0015] Of the three existing therapeutic strategies, there is proven efficacy: (1) increasing enzyme activity with pyridoxine in vitamin B6 responsive individuals; (2) reducing accumulated metabolites by Met restricted diet; and (3) detoxification by betaine-homocysteine methyltransferase enzyme activity in betaine therapy, all of which collectively reduce total Hcy in plasma (Walter, et al., 1998, J. Inherit. Metab. Dis. 21(7): 705-17). Eur J Pediatr 157 (Suppl 2): S71-6).

[0016] In addition, for all existing therapeutic strategies for human patients (except B6 supplementation, which is only suitable for a subset of homocystinuria), reduction of homocysteine is not accompanied by an increase in Cth or Cys. Because it has not been determined that excess Hcy (rather than lack of downstream metabolites) is the cause of clinical symptoms, existing therapies that limit to reduction of homocysteine can be inadequate to provide a robust and effective therapeutic option.

[0017] Thus, there remains a need in the art for more effective therapeutic strategies for individuals with homocystinuria. SUMMARY As described herein, the present application provides compositions, particularly compositions, and methods for reducing serum Hcy, particularly in individuals with homocystinuria. Also provided are compositions, particularly pharmaceutical compositions, that restore substantially normal metabolite levels, including but not limited to methionine, e.g., cysteine and cystathionine. As described in more detail herein, reagents and methods for enzyme replacement therapy (ERT) of homocystinuria are provided, wherein modified forms of the native enzyme have been recombinantly engineered to improve their pharmaceutical acceptability, by providing, inter alia, improved stability, activity, and in vivo drug utility.

[0018] In a first aspect, the present application provides an isolated CBS polypeptide comprising SEQ ID NO: 02, wherein the isolated CBS polypeptide comprises a chemical modification and is a truncation of a full-length human CBS protein genetically engineered at the amino terminus, carboxy terminus, or at both the amino terminus and carboxy terminus thereof. In one embodiment, the present application provides an engineered variant of human CBS that constitutes a recombinant human CBS from which the C-terminal regulatory region has been removed (e.g., rhCBSAC - this rhCBSAC has a truncated 138 residues at the carboxy terminus and comprises amino acids 1-413 of the 551 amino acids of the full-length protein) (SEQ ID NO: 3). In certain embodiments, this rhCBSAC is mutated, and in a preferred embodiment, the truncated mutant CBS is rhCBSAC-C15S (or abbreviated as "C15S" - this C15S has a truncated 138 residues at the carboxy terminus; same as rhCBSAC) (SEQ ID NO: 13), wherein the cysteine residue at position 15 of the CBS amino acid sequence is changed to a serine. In particular embodiments are disclosed herein that include truncated recombinant human CBS that have been chemically modified, particularly by covalent attachment of a polyethylene glycol (PEG) moiety to the C-terminally truncated recombinant human CBS, particularly rhCBSAC (particularly rhCBSAC-C15S). These PEGylated species are referred to as PEG-rhCBSAC or PEG-C15S, respectively. These compositions (modified recombinant enzymes) and methods of use, particularly therapeutic uses as set forth herein, enable individuals with homocystinuria to enjoy a much less restricted diet (e.g., 2 g or more protein / kg daily intake), and have significantly reduced plasma levels of Hcy and substantially normal metabolite levels (including but not limited to methionine, e.g., cysteine and cystathionine), leading to long-term clinical improvement.

[0019] Advantageously, the present application enables individuals to achieve good control of serum Hcy levels without extreme dietary restrictions, which have an unacceptably poor compliance rate. Using the truncated species, particularly the mutant species, particularly the C15S mutant (PEGylated or both mutant and PEGylated) can advantageously be accompanied by improved metabolism in the individual, and thus improved clinical outcome, which is reflected in reduced morbidity and mortality associated with, inter alia, significantly reduced serum Hcy concentrations.

[0020] As disclosed herein, the C15S mutant human CBS species advantageously adopts a structure that significantly increases drug utilization in vivo (e.g., no detectable levels of aggregation). The C15S mutant human CBS species also exhibits a highly reproducible expression, purification, and pegylation pattern, and the C15S mutation reduces the formation of aggregates, thus improving yield by improving recovery, and enabling more consistent and reproducible pegylation. These aspects are also useful for quality issues, which are particularly relevant for steps prior to in vivo applications.

[0021] As disclosed herein, the pegylated species advantageously have an increased size compared to the non-pegylated truncated variant, particularly the rhCBSAC or C15S species, wherein the pegylated species have reduced or delayed clearance. In addition, the chemical modification with PEG masks potential immunogenic epitopes on the surface of the protein and hinders the access of proteolytic enzymes to the protein. Pegylation also advantageously alters the physicochemical properties of the rhCBSAC protein, thus altering its biodistribution, stability, and solubility, without significantly losing its potency.

[0022] These and other features and advantages of the present application will be more fully understood from the following detailed description of the application taken with the accompanying drawings in which:

[0023] BRIEF DESCRIPTION OF DRAWINGS The following detailed description of embodiments of the application can best be understood when read in conjunction with the following drawings, in which:

[0024] Figure 1 Experimental evidence is presented that demonstrates the increased retention time of plasma enzymes in vivo following pegylation of rhCBSAC. Figure 1 Pharmacokinetic profiles following a single administration of rhCBSAC and pegylated rhCBSAC and evidence of their stability in vivo are provided. Figure 1 a is a bar graph showing experimental results in which C57BL / 6J mice were injected with 5 mg / kg body weight of human truncated CBS (rhCBSAC) via intraperitoneal (IP), intravascular (IV), or subcutaneous (SQ) routes. Five mice each from two experimental groups (designated 1 and 2) were used for each injection route (n = 30 total). For each injection route, blood was drawn from group 1 at 0, 1, 8, and 24 hours post-injection, and from group 2 at 1, 4, 10, and 48 hours post-injection. Plasma was analyzed for CBS activity using a radioactivity assay (as described in Example 1). Figure 1 b is a graph showing the clearance of CBS from the circulation as Figure 1a Photograph of the results of Western blot analysis of CBS in the plasma of 2 representative mice from each group. CBS was separated by SDS-PAGE on 12% gels and blotted to polyvinylidene difluoride (PVDF) membranes, which were probed with rabbit polyclonal anti-hCBS antibody, followed by a secondary anti-rabbit antibody conjugated to horseradish peroxidase, and then the bands were visualized with SuperSignal West Pico chemiluminescent substrate (Pierce Cat# 34077). Figure 1 c is a bar graph showing the results of the experiment in which C57BL / 6J mice were injected with 5 mg / kg body weight of either ME020MA- or GL4-400MA- pegylated rhCBSAC or non-pegylated rhCBSAC via the SQ route. ME020MA represents rhCBSAC enzyme pegylated with ME020MA, GL4-400MA represents rhCBSAC enzyme pegylated with GL4-400MA, and rhCBSAC represents unmodified rhCBSAC enzyme. Each treatment modality included 2 groups of 5 mice, as described in Example 2 and Figure 1 A (total of 30 mice) were bled at the indicated time points. Plasma was analyzed for CBS activity using a radioactivity assay.

[0025] Figure 2 is a bar graph showing the steady level of CBS activity achieved after repeated SQ administration. Injection of pegylated, but not non-pegylated, rhCBSAC, demonstrated that CBS activity was established in vivo. GL4-400MA represents rhCBSAC enzyme pegylated with GL4-400MA, and rhCBSAC represents unmodified rhCBSAC enzyme. C57BL / 6J mice were injected with 5 mg / kg body weight of non-pegylated rhCBSAC (n=5) or GL4-400MA rhCBSAC (n=5) at 0, 24, 48 hours (arrows) and bled at the indicated time points. Plasma was analyzed for CBS activity using a radioactivity assay as described in Example lc.

[0026] Figure 3 illustrates experimental evidence that a single injection of PEGylated rhCBSACdecreases homocysteine and increases cystathionine in plasma. Figure 3a is a graph showing that PEGylation of rhCBSACwith the indicated type of activated PEG modification prolongs the systemic presence of CBS enzyme activity after a single SQ administration of the rhCBSAC. The graph shows experimental results in which 27 C57BL / 6J mice were divided into 9 experimental groups (n=3). Each experimental group was injected with 5 mg / kg body weight of rhCBSACPEGylated with the indicated PEG molecule, or with non-PEGylated enzyme via the SQ route. ME020MA represents rhCBSACenzyme PEGylated with ME020MA, ME050GS represents rhCBSACenzyme PEGylated with ME050GS, ME200GS represents rhCBSACenzyme PEGylated with ME200GS, 200MA0B represents rhCBSACenzyme PEGylated with 200MA0B, ME400MA represents rhCBSACenzyme PEGylated with ME400MA, GL2400MA represents rhCBSACenzyme PEGylated with GL2400MA, GL4400MA represents rhCBSACenzyme PEGylated with GL4400MA, GL2800MA represents rhCBSACenzyme PEGylated with GL2800MA, and rhCBSACrepresents non-PEGylated rhCBSACenzyme. Blood samples were taken at the indicated time points and CBS enzyme activity was measured using the radioactivity assay described in Example 1c. Data are presented as histograms with standard deviation (STD), and scatter plots. Figure 3b is a bar graph showing the natural circadian variation of Hcy, Cth, Cys and Met levels in HO mouse plasma. Results are the average of 6 HO mice (homocystinuria HO mouse model, described in Maclean et al., 2010, Biochem J. 101: 153-62) bled at the indicated time points throughout a 24 hour period. Plasma amino acid levels were measured by stable isotope dilution liquid chromatography-mass spectrometry at the time points described in Example 1e. Mol. Genet. Metab . 101: 153-62) bled at the indicated time points throughout a 24 hour period. Plasma amino acid levels were measured by stable isotope dilution liquid chromatography-mass spectrometry at the time points described in Example 1e.

[0027] Figure 3c is a photograph of the results of electrophoretic analysis of rhCBSACPEGylated with ME-400MA (lane 1), GL4-400MA (lane 2) or ME-200MA0B (lane 3), electrophoretically analyzed together with non-PEGylated enzyme (lane 4) and stained with Coomassie blue (M indicates molecular weight marker). The specific activity (S.A.) of each PEGylated and non-PEGylated rhCBSACis shown in the table.

[0028] Figures 3d and 3e are bar charts showing the experimental results, in which HO mice were injected once with PEGylated rhCBSΔC via the SQ route at 0, and blood was excised at 0 (before injection), 24, 48, and 72 hours after injection. Plasma homocysteine ​​(d) and cystathionine (e) levels are indicated for each group (n=5–6). In Figures 3D and 3E, ME-200MA0B represents rhCBSΔC enzyme PEGylated with ME-200MA0B, ME-400MA represents rhCBSΔC enzyme PEGylated with ME-400MA, and GL4-400MA represents rhCBSΔC enzyme PEGylated with GL4-400MA.

[0029] Figure 4 illustrates the experimental evidence that interrupting CBS treatment, allowing amino acid levels to return to pre-treatment levels, followed by repeated injections of PEGylated rhCBSΔC, significantly affected homocysteine ​​and cystathionine plasma levels, restoring normal homocysteine ​​levels. Six HO mice were injected with GL4-400MA PEGylated rhCBSΔC on days 0, 1, 2, 3, and 4, followed by a 10-day clearance period, and then re-injected on days 14, 15, 16, 17, and 18 (indicated by arrows). Plasma samples were collected on the following days (all before injection): days 0, 2, 4, 5, 11, 14, 16, 18, 19, 24, and 31. For comparison, the same injection protocol was performed in five HO mice injected with the non-PEGylated enzyme. Plasma metabolite levels were measured as described in Example 1e. Figure 4a shows the results for homocysteine ​​plasma concentrations in each HO mouse, and Figure 4b shows the results for cystathionine plasma concentrations. Figure 4c shows the mean concentrations of homocysteine ​​and cystathionine in the plasma of HO mice treated in this study. Figure 4d shows the effect of polyethylene glycol-modified rhCBSΔC on plasma homocysteine ​​levels in this study compared to non-PEGylated rhCBSΔC (expressed as a percentage at 0). GL4-400MA represents PEGylated rhCBSΔC enzyme with GL4-400MA, and rhCBSΔC represents unmodified rhCBSΔC enzyme. Figure 4e shows the effect of PEGylated rhCBSΔC on plasma homocysteine ​​levels in this study compared to non-PEGylated rhCBSΔC. GL4-400MA represents PEGylated rhCBSΔC enzyme with GL4-400MA, and rhCBSΔC represents unmodified rhCBSΔC enzyme.

[0030] Figure 5 This demonstrates the variability in the degree of aggregation of human truncated CBS formulations (rhCBSΔC). Figure 5A consists of 4–15% non-denaturing gels stained with Coomassie blue from different batches (112, 13, 7, 27, and 28) of rhCBSΔC. Note the different proportions between the tetrameric (T) and dimer (D) forms of rhCBSΔC, as well as higher aggregate forms of CBS. M indicates the molecular weight designation. Figure 5 B is an in-gel CBS activity assay for non-denaturing gels, indicating that for Figure 5 The bands shown in batches 112 and 28 of rhCBSΔC in A are indeed CBS-related. Also note the different proportions of the tetrameric (T) and dimer (D) forms of rhCBSΔC, as well as the higher-order aggregates of CBS. Figure 5 C is an SDS-PAGE gel (12%) showing two different rhCBSΔC batches PEGylated with ME-200MA0B(+), indicating different proportions of the two types of PEGylation formed after PEGylation (in the PEGylated (+) lane), while only unmodified rhCBSΔC subunits are present when no PEG reagent is added (in the non-PEGylated (-) lane).

[0031] Figure 6 shows that human C15S mutant CBS only forms dimers. Figure 6A This is a non-denaturing gel that shows C15S-mutant CBS forming only dimers, in contrast to recombinant human truncated CBS (rhCBSΔC) which forms dimers (D), tetramers (T), and higher oligomeric forms. TCEP, a reducing agent, does not affect the oligomeric state of the C15S mutant. M indicates the molecular weight marker. Figure 6B These are non-denaturing gels showing different batches (51, 60, and 73) of C15S-mutated CBS, demonstrating that human C15S-mutated CBS reproducibly forms only dimers, as opposed to (+) rhCBSΔC PEGylated without PEG (-) and with ME-200MA0B, and recombinant human double-truncation (batch RC-2-76; construct with additional deletion of rhCBSΔC residues 2-39). PEGylation of either the C15S or double-truncation construct produced consistent and reproducible bands, with similar proportions between PEGylated bands, as opposed to rhCBSΔC. Denaturing SDS-PAGE was used only. Figure 6C and Figure 6B The same applies. C15S produces a reproducible polyethylene glycolation pattern, which differs from recombinant human truncated CBS (rhCBSΔC). This is also consistent with... Figure 5 C is equivalent, showing an unreproducible PEGylation mode of rhCBSΔC.

[0032] Figure 7 shows rhCBSΔC ( Figure 7A ) and C15S mutant (Figure 7B Size exclusion chromatography (SEC) analysis was performed. Figure 7 provides additional indication that the C15S mutant CBS exists only as a dimer, as reproducible single peaks were produced from five different purification batches. Figure 7B ).Notice Figure 7A Six different modes of rhCBSΔC and Figure 7B The single peak of C15S CBS in the middle.

[0033] Figure 8 Continuous administration of the C15S mutant to two HO mice for up to 20 days resulted in a significant and sustained reduction in plasma homocysteine ​​levels. The C15S mutant enzyme was administered to mice continuously using an ALZET® pump, instead of repeated subcutaneous injections. The ALZET® pump, model 1002, had an average pump rate of 0.21 μL / h (stock solution concentration of 26.2 mg / mL) and an average fill volume of 106.6 μL. Mice were bled at specified time points, and plasma was separated for homocysteine ​​(Hcy) determination by mass spectrometry.

[0034] Figure 9 This is a bar chart showing the experimental results, in which HO mice were injected at time zero with a single dose (7.5 mg / kg) of rhCBSΔC, the C15S mutant (C15S), and the double-truncated construct (double-truncated), which had been PEGylated with ME-200MA0B. Mice were bled at time zero (before injection) and at 24, 48, and 72 hours post-injection. Plasma homocysteine ​​levels are indicated for each group (n=5–6). Invention Details This article provides a form of human cystathionine β-synthase (CBS) particularly suitable for pharmaceutical compositions, and a method for treating individuals with homocystinuria, said method, for example, by enzyme replacement therapy (ERT).

[0035] The nucleic acid sequence encoding human CBS and the amino acid sequence encoding it are available from GenBank accession number L19501, and these sequences are also disclosed in U.S. Patent No. 5,523,225, which is incorporated herein by reference in its entirety. The coding sequence for CBS is represented herein as SEQ ID NO: 1, which is the nucleic acid sequence encoding SEQ ID NO: 2, which is the full-length amino acid sequence of human CBS having 551 amino acid residues. The nucleic acid sequence of the genomic DNA encoding CBS is also publicly available from sequence databases such as GenBank and the University of Colorado-Denver webpage under Kraus Lab.

[0036] The truncated forms of cystathionine β-synthase protein (CBS protein), particularly human CBS protein, used herein may include, but are not limited to, purified truncated CBS protein, chemically cleaved and recombined truncated CBS protein, and isolated CBS protein associated with other proteins. More specifically, the isolated proteins of this invention are proteins (including polypeptides or peptides) that have been removed from their natural environment (i.e., artificially manipulated) and may include, for example, purified proteins, partially purified proteins, recombined proteins, and synthetically produced proteins. Therefore, "isolated" does not reflect the degree of purification of the protein. The isolated truncated CBS protein of this invention may be produced by recombination in cells such as bacterial cells. Furthermore, and by way of example, "human truncated CBS protein" refers to proteins derived from humans. (Homo sapiens) The term "truncated CBS protein" (as described herein) refers to a CBS protein that has been produced by other means, based on knowledge of its structure (e.g., sequence) and possibly on the function of naturally occurring CBS proteins from Homo sapiens. In other words, human truncated CBS proteins include biologically active truncated human CBS proteins as detailed herein.

[0037] As used herein, the term "variant" or "mutant" refers to a protein or peptide that differs from a naturally occurring protein or peptide (i.e., a "prototype" or "wild-type" protein), meaning that the protein or peptide has been modified while retaining its basic protein and side-chain structure in its natural form. Such modifications include, but are not limited to: changes in one, several, or even several amino acid side chains; changes in one, several, or several amino acids (e.g., cysteine ​​at position 15 replaced with serine; C15S); changes in the stereochemistry of one or several atoms; and / or minor derivatizations, including but not limited to: methylation, glycosylation, phosphorylation, acetylation, myristoylation, isopentenylation, palmitation, amidation, and / or the addition of glycosylphosphatidylinositol. A "variant" or "mutant" may have enhanced, reduced, altered, or substantially similar properties compared to a naturally occurring protein or peptide. In a specific embodiment, the present invention provides a truncated CBS protein having the C-terminal deletion of a naturally occurring CBS protein.

[0038] As used in this article, the terms "homologous" or "orthologous" refer to proteins or DNA sequences that share a common ancestor and can be substantially identical in different species. Homologous and orthologous proteins and genes typically have similar amino acid and nucleotide sequences, or high sequence similarity (e.g., homologous proteins may have 50%, 60%, 70%, 80%, 90%, 95% or higher amino acid sequence similarity).

[0039] The methods for determining CBS protein expression levels according to the present invention include, but are not limited to: Coomassie blue or silver staining of the protein in a separation medium, such as gel electrophoresis, Western blotting, immunohistochemistry, and other immunoassays; and assays based on protein characteristics, including, but not limited to, enzyme assays, ligand binding, or interactions with other protein couplers. Binding assays are also well known in the art. For example, the BIAcore instrument can be used to determine the binding constant of a complex between two proteins. The dissociation constant of the complex can be determined by monitoring the change in refractive index over time as the buffer passes through the chip. Other suitable assays for determining the binding of one protein to another include, for example, immunoassays such as enzyme-linked immunosorbent assay (ELISA) and radioimmunoassay (RIA), or determination of binding by monitoring changes in the spectroscopic or optical properties of the protein using fluorescence, ultraviolet absorption, circular dichroism, or nuclear magnetic resonance (NMR).

[0040] In some aspects, CBS variants may include any combination of N-terminal deletions or modifications (e.g., deletions of N-terminal residues 2-39 or 1-70) and C-terminal deletions or modifications (e.g., deletions of C-terminal residues 383-551, 397-551, 414-551, 442-551, 489-551, 497-551, 524-551, 534-551, or 544-551), as described herein or in U.S. Patent Nos. 7,485,307 and 8,007,787, both of which are incorporated herein by reference. In another embodiment, additional modifications may be achieved by modifying other amino acid residues to provide a specified percentage of identity with the wild-type CBS sequence. In a specific embodiment, the human CBS variant of the present invention is a truncated recombinant human CBS (rhCBSΔC) homodimerase wherein the C-terminal regulatory region has been removed (SEQ ID NO: 3). In other embodiments, the human CBS variant of the present invention is rhCBSΔC, wherein the cysteine ​​at amino acid position 15 has been mutated to serine (C15S) (SEQ ID NO: 13).

[0041] In other embodiments of the invention, any CBS variant described herein has no more than one or two non-CBS amino acid residues at its N-terminus (i.e., the variant contains no more than one or two amino acid residues at its N-terminus that are not residues of the naturally occurring human cystathionine β-synthase amino acid sequence at that position). Such variants can be produced using novel methods for the production of recombinant CBS, as described below.

[0042] In a further embodiment, any of the above-described CBS variants of the present invention, including any truncated CBS protein, comprises an amino acid sequence that has at least about 50% identity with the wild-type amino acid sequence represented by SEQ ID NO: 2 or with its biologically active truncated form, or at least about 55% identity, or at least about 60% identity, or at least about 65% identity, or at least about 70% identity, or at least about 75% identity, or at least about 80% identity, or at least about 85% identity, or at least about 90% identity, or at least about 95% identity, or at least about 96% identity, or at least about 97% identity, or at least about 98% identity, or at least about 99% identity; particularly including non-heme-bound or non-S-adenosylmethionine (AdoMet) bound forms, wherein the variants retain catalytic activity (e.g., wherein the activity of certain truncated forms of CBS may even exceed that of the full-length CBS in the presence of AdoMet). In a specific embodiment, the human CBS variant of the present invention is a truncated recombinant human CBS (rhCBSΔC) homodimerase, wherein the C-terminal regulatory region has been removed (SEQ ID NO: 3). In other embodiments, the human CBS variant of the present invention is a truncated recombinant human CBS enzyme, wherein the cysteine ​​residue at amino acid position 15 has been mutated to a serine residue (SEQ ID NO: 13).

[0043] In some embodiments, the CBS protein of the present invention comprises an amino acid sequence having less than 100% identity with SEQ ID NO: 2, particularly a truncated embodiment of the amino acid sequence of the truncated variant given in U.S. Patent No. 8,007,787, and particularly SEQ ID NO: 3 and SEQ ID NO: 13 given herein, and in specific embodiments having less than 99%, less than 98%, less than 97%, less than 96%, less than 95%, less than 94%, less than 93%, less than 92%, less than 91%, less than 90%, etc., of the truncated variant given in U.S. Patent No. 8,007,787, and particularly SEQ ID NO: 3 and SEQ ID NO: 13 given herein.

[0044] Unless otherwise stated, references to the percentage of identity (% identity) used herein refer to the evaluation of homologs using sequence alignment tools or procedures including, but not limited to, those following: (1) BLAST 2.0 BasicBLAST homology search, using blastp for amino acid searches and blastn for nucleic acid searches, with standard default parameters, where query sequences are filtered by default for low-complexity regions; (2) BLAST 2 alignment (using the parameters below); (3) and / or PSI-BLAST, with standard default parameters (position-specific repeat BLAST). Note that due to some differences in standard parameters between BLAST 2.0 BasicBLAST and BLAST 2, two specific sequences may be identified as having significant homology when using the BLAST 2 procedure, while using one of those sequences as a query sequence in BLAST 2.0 BasicBLAST may not determine that the second sequence is the best match. Additionally, PSI-BLAST offers an automated, easy-to-use “profile” search format, which is a sensitive way to find sequence homologs. This procedure first performs a vacancy BLAST database search. The PSI-BLAST procedure takes information from any significant alignment and returns a constructed position-specific scoring matrix, which replaces the query sequence for the next round of database searching. Therefore, it should be understood that %identity can be determined by using any of these procedures.

[0045] CBS derivatives are included within the scope of this invention. These derivatives are chemically modified CBS polypeptide compositions in which the CBS polypeptide is linked to a polymer. The selected polymer is typically water-soluble, such that the protein linked to it does not precipitate in an aqueous environment and that the CBS enzyme is biologically active in biological fluids, such as physiological environments. The polymer can be of any molecular weight and can be branched or unbranched. The scope of CBS polypeptide polymers includes polymer mixtures. In specific embodiments, the polymer will be pharmaceutically acceptable for therapeutic use in the final product formulation.

[0046] The water-soluble polymer or mixture thereof may be selected from, for example, polyethylene glycol (PEG), monomethoxy-polyethylene glycol, dextran (e.g., low molecular weight dextran, such as low molecular weight dextran of about 6 kDa), cellulose, or other carbohydrate-based polymers, poly(N-vinylpyrrolidone) polyethylene glycol, propylene glycol homopolymers, polypropylene oxide / ethylene oxide copolymers, polyoxyethylene polyols (e.g., glycerol), polysalicylic acid, and polyvinyl alcohol. The invention also includes bifunctional PEG crosslinking molecules that can be used to prepare covalently linked CBS polypeptide polymers. In one embodiment, the polyethylene glycol molecule is selected from unbranched and branched polyethylene glycols, wherein the molecular weight of the polyethylene glycol molecule is equal to or greater than 2000 Daltons. In another embodiment, the molecular weight of the polyethylene glycol molecule is in the range of 2–100 kD, 5–80 kD, or 10–40 kD. In another embodiment, the polyethylene glycol molecule is selected from ME-200MA0B, ME-020MA, ME-400MA, GL2-400MA, GL4-400MA, GL2-800MA, ME-050GS, ME-200GS, ME-200AL or MEPA-20T.

[0047] In specific embodiments, the present invention provides a truncated recombinant human CBS (rhCBSΔC) homodimerase, wherein the C-terminal regulatory region has been removed (SEQ ID NO: 3), and the enzyme has been chemically modified by covalently linking with polyethylene glycol (PEG), the enzyme comprising what is referred to herein as a "PEGylated species". In other embodiments of the invention, the human CBS variant of the present invention is a truncated recombinant human CBS enzyme, wherein the cysteine ​​residue at amino acid position 15 has been mutated to serine (SEQ ID NO: 13), and the enzyme has been chemically modified by covalently linking with polyethylene glycol (PEG), the enzyme comprising what is referred to herein as a "PEGylated species".

[0048] Specific implementation schemes for various PEG reagents used in polyethylene glycolation reactions to produce modified polyethylene glycol species are shown in Table 1.

[0049] Table 1 PEG name Target group Molecular weight (Daltons) ME-200MA0B -SH 20,000 ME-020MA -SH 2,000 ME-400MA -SH 40,000 GL2-400MA -SH 40,000 GL4-400MA -SH 40,000 GL2-800MA -SH 80,000 ME-050GS -NH2, -OH, -OH 5,000 ME-200GS -NH2, -OH, -SH 20,000 ME-200AL -NH2 20,000 MEPA-20T -COOH 20,000 PEGylation of CBS peptides can be carried out by any PEGylation reaction known in the art. PEGylation can be carried out via acylation or alkylation with reactive polyethylene glycol molecules (or similar reactive water-soluble polymers) as described below. For acylation, the selected polymer should have a single reactive ester group. For reductive alkylation, the selected polymer should have a single reactive aldehyde group. Reactive aldehydes are, for example, polyethylene glycol propionaldehyde, which is water-stable, or a single C1-C group. 10Alkoxy or aryloxy derivatives. In one embodiment, the polyethylene glycol molecule is linked to CBS via a linking group selected from: N-hydroxysuccinimide (NHS), amines, and aldehydes consisting of monoaldehydes, monoesters of monoacids, monoamines, monothiols, monodisulfides, monobromophenyl carbonate, monochlorophenyl carbonate, monofluorophenyl carbonate, mononitrophenyl carbonate, monocarbonylimidazolium, monohydrazides, monoiodoacetamide, monomaleimide, monooorthopyridyl disulfide, monooxime, monophenylglyoxal, monothiazolidin-2-thione, monothioesters, monotriazines, and monovinyl sulfones.

[0050] One of the water-soluble polymers used in this article is polyethylene glycol, abbreviated as PEG. The use of PEG in this article is intended to include any form of PEG that has been used to derive other proteins, such as mono-(C1-C1)-C1 ... 10 Alkoxy- or aryloxy-polyethylene glycol.

[0051] Generally, chemical derivatization can be carried out under any suitable conditions for reacting a bioactive substance with an activated polymer molecule. Methods for preparing PEGylated CBS peptides typically include the following steps: (a) reacting the CBS peptide with polyethylene glycol (e.g., a reactive ester, amine, aldehyde, or maleimide derivative of PEG) under conditions that link the CBS peptide to one or more PEG groups, and (b) obtaining the reaction product. Generally, the optimal reaction conditions for the acylation reaction are determined based on known parameters and desired results. For example, a higher PEG:protein ratio results in a higher percentage of the PEG-PEGylated product. In one specific aspect, the CBS peptide derivative will have a single PEG moiety at the amino terminus. In a specific embodiment, the PEGylated CBS enzyme provided by the present invention has an average of about 1 to about 10, more particularly 2 to about 5, and more particularly 3 to 5 PEG molecules covalently linked to each enzyme subunit in the composition.

[0052] The proteins of the present invention are preferably recovered, obtained, and / or used in a "substantially pure" form. As used herein, "substantially pure" means a purity that allows the protein to be effectively used in vitro, in vitro, or in vivo according to the present invention. For proteins used in in vitro, in vitro, or in vivo methods according to the present invention, it is substantially free of contaminants, other proteins, and / or chemicals that may interfere with or will interfere with their use in the methods disclosed herein, or chemicals that are undesirable when used in the methods disclosed herein, at least for proteins containing CBS (including homologs). Such methods include enzymatic reactions (e.g., the production of cystathionine), the preparation of therapeutic compositions, the administration of therapeutic compositions, and all other methods disclosed herein. The term "substantially pure" as used herein refers to a protein produced by any method (i.e., by direct purification from a natural source, recombinant, or synthetic) and purified from other protein components, such that the protein in the specified composition comprises at least about 80% by weight of the total protein (e.g., the CBS protein is about 80% protein in solution / composition / buffer), and more preferably at least about 85% by weight of the total protein in the specified composition, and more preferably at least about 90%, and more preferably at least about 91%, and more preferably at least about 92%, and more preferably at least about 93%, and more preferably at least about 94%, and more preferably at least about 95%, and more preferably at least about 96%, and more preferably at least about 97%, and more preferably at least about 98%, and more preferably at least about 99% by weight. In embodiments of the CBS protein or its truncated variants produced in recombinant bacteria, the terms "purified" or "substantially pure" will be understood to include purification from lipopolysaccharides and other pyrogenic compounds.

[0053] Those skilled in the art will recognize that recombinant DNA technology can improve the expression control of transfected nucleic acid molecules by manipulating aspects such as the copy number of the nucleic acid molecule in the host cell, the efficiency of transcription of the nucleic acid molecule, the translation efficiency of the resulting transcript, and the efficiency of post-translational modification. Additionally, promoter sequences can be genetically engineered to improve expression levels compared to natural promoters.

[0054] Recombinant techniques for controlling nucleic acid molecule expression include, but are not limited to, integrating nucleic acid molecules into one or more host cell chromosomes, adding vector stability sequences to plasmids, substituting or modifying transcriptional control signals (e.g., promoters, operons, enhancers), substituting or modifying translational control signals (e.g., ribosome binding sites, Shine-Dalgarno sequences), modifying nucleic acid molecules to conform to the codons used by the host cell, and deleting sequences that disrupt transcript stability.

[0055] In another aspect, the present invention relates to a method for recombinantly generating and purifying human cystathionine β-synthase. The method comprises the steps of: cloning a nucleic acid sequence encoding a human CBS enzyme or a truncated or mutated variant thereof into an expression vector, said sequence as given in U.S. Patent No. 8,007,787 and, in particular, SEQ ID NO: 4 herein. In some embodiments, the human CBS-coding sequence has been modified to utilize optimized codons for expression in microorganisms such as *Escherichia coli*. In other embodiments, the vector comprises: (a) a cloning site linking a fusion coupler (e.g., glutathione S-transferase or GST) to the nucleic acid sequence to be expressed; and (b) a protease cleavage recognition site for human rhinovirus 3C protease (e.g., a fusion protein available from GE Healthcare, referred to as the PreScission protease) or for a protease using a similar cleavage site, for cleaving the fusion coupler from the CBS protein after expression of the recombinant fusion protein. As part of this invention, the expression vector is first genetically modified to specifically introduce a CBS-encoding nucleic acid sequence that will result in the expression of a CBS-fusion protein, which can be cleaved by human rhinovirus 3C protease to produce a CBS protein having only one additional non-CBS N-terminal amino acid residue. This result is not possible using unmodified multiple cloning sites in commercially available vectors. The CBS-encoding nucleic acid sequence is introduced into the genetically modified vector, the recombinant fusion protein is expressed and purified using conventional methods or those suitable for CBS production (see, for example, U.S. Patent No. 5,635,375). , (Source: same as above) Ultimately, the fusion coupler and all but the non-CBS amino acid residues are cleaved from the CBS protein to obtain a highly purified, nearly intact human recombinant CBS protein, ideal for human therapeutic use. In a particularly advantageous embodiment, the nucleotides encoding the human CBS protein are engineered to the codon usage frequency of the recombinant cells, which are prepared recombinantly. Non-limiting embodiments of this type are given herein as SEQ ID NO: 4, wherein the CBS-encoding nucleic acid is engineered to be optimized for recombinant expression in *E. coli*.

[0056] Some aspects of the invention include compositions comprising any CBS variant described herein for the in vitro generation of cystathionine or cysteine ​​to remove or generate hydrogen sulfide in vitro, or for in vivo therapeutic use (e.g., treatment or prevention of homocystinuria and related conditions). Therefore, another embodiment of the invention relates to compositions comprising isolated CBS protein and, in particular, truncated variants of it given in U.S. Patent No. 8,007,787 and, in particular, SEQ ID NO: 3 or SEQ ID NO: 13 described herein. The compositions typically also comprise a pharmaceutically acceptable carrier. The compositions and their components can be used in any in vitro or therapeutic embodiment of the invention described herein.

[0057] The “HO” mouse model used in this study is a novel mouse model of conventional homocystinuria in which the cbs gene is inactivated and exhibits low-level expression of the human CBS transgene under the control of the human CBS promoter. In this mouse model, plasma and tissue levels of Hcy, methionine, S-adenosylmethionine, and S-adenosylhomocysteine ​​are simultaneously elevated, accompanied by decreased plasma and liver homocysteine ​​levels. See Maclean et al., 2010. Mol. Genet. Metab . 101:153-62).

[0058] The compositions of the present invention can be used to produce cystathionine and cysteine ​​in vitro or to treat individuals who may benefit from increased CBS activity (e.g., individuals with homocystinuria).

[0059] According to the present invention, a "pharmaceutically acceptable carrier" comprises pharmaceutically acceptable excipients and / or pharmaceutically acceptable delivery media suitable for administering the composition to suitable in vitro, in vivo, or in vivo sites. Suitable in vitro, in vivo, or in vivo sites preferably include any site where modulation of CBS activity is desired. A pharmaceutically acceptable carrier enables the protein or recombinant nucleic acid molecule of the present invention to be in a form in which the protein or recombinant nucleic acid molecule can interact with its target (e.g., a CBS substrate) upon arrival at target cells or tissues in a culture or individual.

[0060] Suitable excipients for this invention include excipients or formulations that transport or facilitate transport but do not specifically target the composition to cells (also referred to herein as non-targeting carriers). Examples of pharmaceutically acceptable excipients include, but are not limited to, water, phosphate-buffered saline, Ringer's solution, glucose solution, serum-containing solution, Hank's solution, other aqueous physiologically balanced solutions, oils, esters, and glycols. Aqueous carriers may contain suitable excipients that approximate the recipient's physiological conditions, for example, by enhancing chemical stability and isotonicity. The compositions of this invention can be sterilized and / or lyophilized using conventional methods.

[0061] One class of pharmaceutically acceptable carriers includes controlled-release formulations capable of slowly releasing the compositions of the invention into an individual or culture medium. Controlled-release formulations as used herein contain compounds of the invention (e.g., proteins (including homologs), antibodies, nucleic acid molecules, or mimics) within a controlled-release medium. Suitable controlled-release media include, but are not limited to, biocompatible polymers, other polymer matrices, capsules, microcapsules, microparticles, bolus formulations, osmotic pumps (e.g., ALZET® osmotic pumps), diffusion devices, liposomes, lipospheres, and transdermal delivery systems. Other carriers of the invention include liquids that, upon administration to an individual, form a solid or gel in situ. In specific embodiments, the carrier is also biodegradable (i.e., biosoluble). When the compound is a recombinant nucleic acid molecule, suitable carriers include, but are not limited to, liposomes, viral vectors, or other carriers, including ribozymes, gold particles, poly-L-lysine / DNA conjugates, and artificial chromosomes. Carriers containing natural lipids include cells and cell membranes. Carriers containing artificial lipids include liposomes and micelles.

[0062] The vectors of the present invention can be modified to target specific sites in an individual, thereby targeting and delivering the protein of the present invention to that site. Pharmaceutically acceptable vectors capable of targeting may also be referred to herein as “delivery vehicles” or “targeting vehicles.” Suitable modifications include manipulating the chemical formula of the lipid moiety of the delivery vehicle and / or introducing a targeting agent into the vehicle capable of specifically targeting the delivery vehicle to a preferred site or target site (e.g., a preferred cell type). A “target site” refers to a site in the individual to which the composition is desired to be delivered. Alternatively, the pharmaceutically acceptable vector may contain an agent suitable for delivering the CBS protein to the plasma or serum of an animal (preferably a human). Suitable targeting compounds include ligands capable of selectively (i.e. specifically) binding another molecule to a specific site. Examples of such ligands include antibodies, antigens, receptors, and receptor ligands. Manipulating the chemical formula of the lipid moiety of the delivery vehicle can modulate the extracellular or intracellular targeting of the delivery vehicle. For example, chemicals can be added to the lipid formula of the liposome, which alters the charge of the lipid bilayer of the liposome, allowing the liposome to fuse with specific cells having specific charge characteristics. In specific embodiments, the liposomes of the present invention include those liposomes known to those skilled in the art and commonly used in, for example, protein delivery methods. The liposomes can be compounded with the proteins of the present invention using standard methods in the art.

[0063] In another aspect, the present invention relates to a method for regulating biological processes, including cystathionine production, by modulating the expression and / or activity of CBS. This embodiment typically includes the use (e.g., administration) of a therapeutic composition comprising one or more CBS variants, particularly the truncated CBS variants given in U.S. Patent No. 8,007,787 and, in particular, SEQ ID NO: 3 or SEQ ID NO: 13 described herein, which can be used for methods of regulating cystathionine production, which may be mediated by or related to the expression and biological activity of CBS.

[0064] Therefore, in one embodiment, the method of the present invention regulates cystathionine production in animal and human individuals, wherein the individuals are protected from or treated for diseases related to the regulation of cystathionine production, such as homocystinuria and associated conditions / symptoms (e.g., ectopic lens, skeletal disorders, intellectual disability, and premature birth, arteriosclerosis, and thrombosis). The term “protection from disease” as used herein refers to reducing disease symptoms; reducing the incidence of disease; and / or reducing the severity of disease. Protecting an individual can refer to the ability of the therapeutic compositions of the present invention, when administered to an individual, to prevent the occurrence of disease and / or to cure or treat disease by alleviating disease symptoms, signs, or causes. Therefore, protecting an individual from disease includes both preventing the occurrence of disease (preventive treatment) and treating individuals who have or experience the initial or late symptoms of disease (therapeutic treatment). The term “disease” refers to any deviation from an individual’s normal health and includes states where disease symptoms are present, as well as states where deviations have occurred (e.g., in non-limiting instances, including infections, gene mutations, and genetic defects, etc.) but symptoms have not yet appeared (e.g., pre-disease conditions).

[0065] More specifically, when the therapeutic compositions described herein are administered to an individual by the methods of the present invention, they preferably produce a result that may include alleviating disease (e.g., reducing at least one symptom or clinical manifestation of the disease), eliminating disease, alleviating secondary disease resulting from the occurrence of the primary disease, or preventing disease. In another aspect, administration of the therapeutic compositions may produce a result that may include increasing the accumulation of downstream metabolites of transsulfurization in mammals.

[0066] According to the present invention, an effective dosing regimen (i.e., administering the therapeutic composition in an effective manner) includes suitable dosage parameters and a dosing pattern that produces the desired effect in an individual (e.g., an increase in cystathionine β-synthase activity or an increase in the condensation of serine and homocysteine ​​to form cystathionine), preferably protecting the individual from disease (e.g., through disease prevention or by alleviating one or more symptoms of an ongoing disease). The effective dosage parameters can be determined using standard methods in the art for a specific disease. Such methods include, for example, determining survival rates, side effects (i.e., toxicity), and the progression or regression of the disease.

[0067] According to the present invention, a suitable single-dose size is a dose that, when administered once or multiple times over an appropriate period of time, results in an increase in CBS activity in an individual with normal protein intake, or controls Hcy levels or the formation of cystathionine or cysteine ​​in the individual, or results in an improvement in at least one symptom of the individual's condition. The dose may vary depending on the disease being treated. Based on individual size and route of administration, those skilled in the art can readily determine a suitable single-dose size for a given individual.

[0068] In some embodiments of the invention, a suitable single dose of the therapeutic composition of the invention is an amount that, when administered via any route of administration, increases CBS activity as described above compared to an individual who has not been given the therapeutic composition of the invention (i.e., a predetermined control individual or assay), compared to an individual prior to administration of the composition, or compared to a standard established for a specific disease, individual type, and composition. The administered therapeutic composition has enzymatic activity over an extended period of time. This period is preferably longer than 24 hours. Chemically modified therapeutic compositions retain 70% or more of the initial activity of the administered composition after 24 hours. More preferably, the duration of the administered therapeutic composition's effective enzymatic activity exceeds 48 hours. Even more preferably, the duration of the administered therapeutic composition's effective enzymatic activity exceeds 72 hours. In some embodiments, the therapeutic composition may be administered several times daily (e.g., two, three, or more times) or less frequently, including but not limited to once a week, once every two weeks, once a month, once every two months, or less frequently. In other embodiments, the therapeutic composition may be administered continuously for several days, weeks, or months. In another embodiment of the invention, an appropriate dose of the therapeutic composition of the invention may be administered in combination with betaine (e.g., CYSTADANE®), a more relaxed protein-restricted diet, an anticoagulant, or a statin.

[0069] As described above, the therapeutic composition of the present invention is administered to an individual in a manner that effectively delivers the composition to cells, tissues, and / or systems, thereby achieving the desired results of the administration of the composition. Suitable administration regimens include any in vivo or ex vivo administration regimen. Preferred routes of administration are apparent to those skilled in the art and depend on the type of disease being prevented or treated; whether the composition is nucleic acid-based, protein-based, or cell-based; and / or target cells / tissues. For proteins, in vivo administration methods include parenteral administration, and in particular, including but not limited to, osmotic pump administration, intravenous administration, intraperitoneal administration, intramuscular administration, intra-arterial administration, intracoronary administration, intra-arterial administration (e.g., to the carotid artery), subcutaneous administration, intra-articular administration, intraventricular administration, and direct injection into tissues. Combinations of delivery routes may be employed, and in some cases, such combinations may enhance the efficacy of the composition.

[0070] Many of the above-mentioned routes of administration, including intravenous, intraperitoneal, intradermal, intramuscular administration, or via an osmotic pump, can be performed using standard methods in the art.

[0071] One method of local administration is by direct injection. Direct injection techniques are particularly useful for delivering compositions to cells or tissues (which are surgically accessible), and especially to or near the body surface. Local administration of the composition to the target cell area means injecting the composition a few centimeters, and preferably a few millimeters, away from the target cells or tissue.

[0072] Another method of local drug delivery is through the use of one or more osmotic pumps (e.g., ALZET® osmotic pumps), which allow for stable drug delivery over extended periods of time (e.g., weeks or months). Implanted osmotic pumps are particularly useful for delivering compositions to cells, tissues, or subjects (which are surgically accessible), and especially on or near the body surface. Local administration of the composition to the target cells or tissue area of ​​the subject refers to implanting an osmotic pump containing the composition a few centimeters, and preferably a few millimeters, away from the target cells or tissue.

[0073] In the method of this invention, the therapeutic composition may be administered to any member of the vertebrate mammal class, including but not limited to primates, rodents, livestock, and pets. Livestock includes consumable mammals or mammals that produce useful products (e.g., sheep used for wool production). Preferably, individuals requiring protection include humans.

[0074] Some aspects of the present invention include the use of isolated CBS polypeptides or any CBS variants described herein for the preparation of non-aggregated CBS derivatives.

[0075] All references described and / or cited in this article are incorporated herein by reference in their entirety.

[0076] The following embodiments are provided for illustrative purposes and are not intended to limit the scope of the invention. Example

[0077] Example 1: Production of truncated CBS protein in bacteria a. Recombinant expression of truncated CBS protein in bacteria A truncated human CBS variant (rhCBSΔC; SEQ ID No: 3) lacking a specific portion of the non-conserved region was constructed and overexpressed using the previously described E. coli-based expression system (Kozich and Kraus, 1992, ibid.). The construct encoding the truncated human CBS protein variant rhCBSΔC (DNA encoding rhCBSΔC shown in SEQ ID No: 4) was modified by modifying the previously described pHCS3CBS expression construct (Kozich and Kraus, 1992, ...). Hum. MutatThe construct was generated using a method involving 1:113-123, and contained the full-length CBS coding sequence (SEQ ID NO: 1) cloned into pKK388.1. To generate the C-terminal deletion construct, a CBS cDNA fragment spanning the desired nucleotide residues was amplified using primers that incorporated Sph I and Kpn I sites into the 5' and 3' ends of the PCR product, respectively. All PCR products were then digested with Sph I and Kpn I and cloned by ligation into a pHCS3 vector digested with Sph I and Kpn I. A native Sph I site exists in the CBS cDNA, located upstream of the antisense primer hybridization site (base pair position 1012, according to CBS cDNA number SEQ ID NO: 1). The resulting PCR product was then digested with Nco I and Sph I and ligated into a pHCS3 plasmid digested with the same enzymes.

[0078] pKK CBSΔ414-551 Meaningful: 5'-CGTAGAATTCACCTTTGCCCGCATGCTGAT (SEQ ID NO: 5) ( SphI restriction sites in bold ) Antisense: 5'-TACGGGTACCTCAACGGAGGTGCCACCACCAGGGC (SEQ ID NO: 6) ( Kpnl restriction sites in bold ) Finally, the construct was transformed into *E. coli* BL21 (Stratagene). The reliability of the construct was verified by DNA sequencing using a Thermo Sequenase Cy5.5 sequencing kit (Amersham Pharmacia Biotech) and a Visible Genetics Long-Read Tower System-V3.1 DNA sequencer, following the manufacturer's instructions.

[0079] For bacterial expression analysis of CBS deletion mutants, as previously described (Maclean et al., 2002, Hum. Mutat. 19:641-55), E. coli BL21 cells containing the CBS truncated mutant construct were cultured to induce expression and produce crude cell lysate.

[0080] An alternative method was also used, in which a sequence-optimized, truncated human CBS enzyme (rhCBSΔC; SEQ ID No: 3) was prepared in the pET28a (+) vector. The full-length (551 aa) human CBS coding sequence was optimized for bacterial expression and cloned into the pUC57 vector, then used by GenScript USA Inc. (NJ, USA). Eco RV restriction enzyme digestion. The CBS sequence is then amplified by PCR using primers A1 and A2 to generate the sequence encoding the truncated enzyme (aa 1-413): Primers: A1 5' agtcgc CCATGGcgtcagaaacccgcag 3' (SEQ ID NO: 7) Ncol restriction site in the cap (CAP). Bold G mutated to C (for proline).

[0081] A2 5' atcgcg CTCGAGttagcgcaggtgccaccac 3’ (SEQ ID NO: 8) Xhol restriction site in the cap (CAP), followed by TTA, which is a stop codon.

[0082] Then the PCR products were treated with restriction enzymes Nco I and Xho I. The cells were digested and ligated into a pET-28a(+) vector (available from EMD Millipore, Billerica, MA) that had already been digested with the same enzyme. Optimization of cloning into pET-28a(+) Nco At site I, compared to the CBS wild-type sequence, a G→C mutation occurs (encoding alanine instead of proline). Therefore, a site-directed mutagenesis kit (Stratagene, CA, USA) using primers B1 and B2 was used to regenerate the wild-type sequence encoding proline: B1 5' GGAGATATACCATGCcgtcagaaacccgc 3' (SEQ ID NO: 9) B2 5' GCGGGGTTTCTGACGGCATGGTATATCTCC 3' (SEQ ID NO: 10) The same strategy was used to generate the C15S mutant (T→A mutation) by using primers: C1 5'- TGGGTCCGACGGGT A GCCCGCAC-3' (SEQ ID NO: 11) and C2 5' - GTGCGGGC T ACCCGTCGGACCCA - 3' (SEQ ID NO: 12).

[0083] Sequencing confirmed the complete sequences of the optimized rhCBSΔC and C15S mutant polynucleotide constructs.

[0084] In the pET-28a(+) vector, the expression of truncated CBS is controlled by the upstream T7 promoter and requires transformation into DE3 bacteria and induction via IPTG.

[0085] b. Sequence-optimized, truncated expression of human CBS enzyme The pET-28a(+) vector carrying the sequence encoding the truncated human CBS was transformed into DE3 bacteria, namely HMS174(DE3) or BL-21(DE3), and kanamycin-resistant clones were selected and used as mother liquor glycerol at -80°C for further use.

[0086] Bacteria from the mother liquor glycerol were cultured overnight at 37°C in 5 ml Luria-Bertani (LB) medium containing 30 μg / ml kanamycin on a rotating shaker at 275 RPM. The next morning, 1 ml of the overnight culture was added to 100 ml Terrific Broth (TB) medium containing 30 μg / ml kanamycin and cultured overnight as described above. Then, 10 ml of the overnight culture was added to 1 liter of TB medium containing the following supplements: 0.001% Thiamine Hydrochloride, pH 8.0 0.0025% pyridoxine hydrochloride, pH 8.0 0.3 mM δ-(aminolevulinic acid) (δ-ALA) pH 8.0 150 µM ferric chloride 30 ug / ml kanamycin Then, 1 liter of culture was incubated at 30°C on a 275 RPM rotating shaker until OD was reached. 600 The pH reached ~0.6-0.7, and protein expression was induced by adding 1 mM IPTG. Fermentation was continued for an additional 16 hours. Cells were then harvested by centrifugation at 6000 RCF for 10 minutes at 4°C, washed with ice-cold 0.9% NaCl, centrifuged again as described above, and frozen at -80°C.

[0087] For each gram of precipitate, 4.45 ml of lysis buffer (20 mM NaH₂PO₄, pH 7.2, 40 mM NaCl, 0.1 mM PLP) of an aliquot of the sample was added to the cell precipitate, and homogenized in a Dunns homogenizer until no cell clumps were visible. The homogenate was then treated with lysozyme (finally 2 mg / ml), incubated on a shaking platform at 4°C for 1 hour, sonicated to reduce viscosity, and centrifuged at 53,000 RCF. The supernatant containing the soluble fraction was then stored at -80°C.

[0088] Expression levels were confirmed by gel electrophoresis and Coomassie gel staining, and specific activity was determined by radioactivity assay.

[0089] c. CBS Measurement Using the previously described radioisotope determination method, [ 14 [C] Serine was used as a labeled substrate to determine CBS activity (Kraus, 1987). Methods Enzymol 143, 388-394). Protein concentration was determined using bovine serum albumin (BSA) as a standard via the Bradford procedure (Bradford, 1976, Anal. Biochem. 72, 248-254). One unit of activity was defined as the amount of CBS catalyzed by 1 µmol of cystathionine at 37°C for 1 hour.

[0090] d. Denaturing and non-denaturing polyacrylamide gel electrophoresis and Western blotting As previously stated (Majtan et al., 2010) J Biol Chem . 2010;285(21):15866-73), protein blot analysis of CBS samples under denaturing and non-denaturing conditions.

[0091] e. Determination of plasma metabolites Basically, following Allen et al. (1993, Serum betaine N, N-dimethylglycine and N-methylglycine levels in individuals with cobalamin and folate deficiency and related inborn errors of metabolism), MetabolismThe method disclosed in 42: 1448–1460, which uses stable isotope dilution liquid chromatography-mass spectrometry to determine the levels of sulfur-containing amino acid metabolites in mouse plasma.

[0092] Example 2 Following rhCBSΔC PEGylation, plasma retention time in vivo was increased.

[0093] To evaluate the retention time and activity of rhCBSΔC in the bloodstream, experiments were conducted in which C57BL / 6J mice were injected with 5 mg / kg body weight of rhCBSΔC via intraperitoneal (IP), intravascular (IV), or subcutaneous (SQ) routes. To avoid excessive bleeding, five mice from each of the two experimental groups (designated 1 and 2) were used for each injection route (total n=30). For each injection route, blood was collected from group 1 at 0, 1, 8, and 24 hours post-injection, and from group 2 at 1, 4, 10, and 48 hours post-injection. Blood was expelled from the animals under the jaw using a disposable lancet and collected into Capiject T-MLHG lithium heparin (12.5 IU) tubes containing gel (TerumoMedical Corporation, NJ, USA). Each tube was then centrifuged at 1200 G for 10 min, and the plasma was collected into 1.5 ml tubes and stored at -80°C.

[0094] The CBS activity of plasma was analyzed using the radioactivity assay given in Example 1. For the CBS enzyme activity of the injected enzyme at specified time points, see [link to example]. Figure 1 a. For the IP and IV routes, peak activity was recorded 1 hour after injection, while for the SQ route, peak activity was recorded 4 hours after injection, due to the slower release from the SQ compartment into circulation. Of particular interest, activity was comparable for all injection routes 8–10 hours after injection, and almost no activity was observed 24–48 hours after injection.

[0095] To monitor whether the clearance of rhCBSΔC from circulation contributes to the rapid loss of in vivo activity as described above, plasma proteins from two representative mice in each of the above groups were separated by electrophoresis, transferred to a PVDF membrane, and reacted with anti-human CBS antibodies to track the clearance of CBS from circulation. Figure 1 As shown in b, the gradual clearance of rhCBSΔC from circulation occurs over time after injection, with the enzyme becoming undetectable as early as 24 hours post-injection. Therefore, the clearance of rhCBSΔC contributes to the rapid loss of the observed in vivo activity.

[0096] To prolong the retention time of rhCBSΔC, the enzyme was modified with polyethylene glycol (PEG) molecules (PEGylation) using ME-020MA or GL4-400MA PEG. The activated PEG derivative was purchased from NOF Corporation (Tokyo, Japan). PEGylation was performed according to the manufacturer's instructions. For example, the coupling of the PEG maleimide derivative with the SH group of CBS (5 mg / ml) was carried out overnight at 4°C in 100 mM phosphate buffer (pH=6). The molar ratio of PEG molecules to CBS protein was 10:1 or 5:1, depending on the activated PEG derivative.

[0097] To evaluate the activity of PEGylated rhCBSΔC, C57BL / 6J mice were injected via the SQ route with 5 mg / kg body weight of either ME020MA- or GL4-400MA-PEGylated rhCBSΔC or non-PEGylated rhCBSΔC. Each treatment regimen included two groups of five mice each (30 mice in total), and bled as described above. Plasma CBS activity was analyzed using the radioactivity assay given in Example 1. Significant activity was detected for both forms of the PEGylated enzyme at 24 h and 48 h post-injection, with a peak activity of GL4-400MA PEGylated rhCBSΔC at 24 h. Figure 1 As shown in c. This contrasts sharply with the non-PEGylated rhCBSΔC, indicating low or no activity at these same time points. These results suggest that PEGylation of the rhCBSΔC enzyme can effectively prolong its activity in vitro and in vivo.

[0098] Example 3 A repeated injection regimen using PEGylated but not non-PEGylated rhCBSΔC showed that CBS activity accumulated in vivo.

[0099] The rapid clearance of protein from circulation can be ignored by increasing the number of injections to maintain a high plasma concentration. Therefore, repeated injection protocols were tested with non-PEGylated and PEGylated rhCBSΔC. At 0, 24, and 48 hours ( Figure 2 (The arrow in the image indicates that) C57BL / 6J mice were injected with 5 mg / kg body weight of non-PEGylated rhCBSΔC (n=5) or GL4-400MA rhCBSΔC (n=5), and blood was excised at designated time points. Plasma CBS activity was analyzed using the radioactivity assay described in Example 1. Figure 2 As shown, repeated injections of the non-PEGylated enzyme did not lead to the accumulation of enzyme activity in circulation, resulting in almost no activity 24 hours after each injection. In contrast, the activity of the PEGylated enzyme peaked after two injections and then plateaued.

[0100] Example 4 A single injection of PEGylated rhCBSΔC reduced homocysteine ​​and increased cystathionine in plasma.

[0101] The aforementioned examples were performed in wild-type mice, focusing on the characterization of the clearance and activity of injected rhCBSΔC, and on comparisons between PEGylated and non-PEGylated enzymes. Once it was determined that PEGylation prolonged cycle time, different sets of PEGylated CBS enzyme molecules were first tested in wild-type mice, and then these enzyme molecules were evaluated in a homocystinuria mouse model.

[0102] A group of rhCBSΔC enzymes modified with different PEG molecules were tested in wild-type mice to determine the optimal PEGylation strategy. Twenty-seven C57BL / 6J mice were randomly assigned to nine experimental groups (n=3). Each group received either 5 mg / kg body weight of PEGylated rhCBSΔC with the PEG molecules specified in Figure 3 via the SQ route, or a non-PEGylated enzyme. Blood samples were collected at the time points shown in Figure 3, and the activity of the PEGylated rhCBSΔC was determined using the radioactivity assay given in Example 1. Data are shown below. Figure 3A The histogram is shown with standard deviation (STD), and the scatter plot is also shown. Typically, PEGylation with higher molecular weight PEGs (GL2800MA, 80 kDa; ME-400MA and GL2-400MA, 40 kDa; and ME200-MA0B, 20 kDa) results in greater exposure compared to PEGylation with molecules smaller than 20 kDa, and PEGylation using chemistry targeting cysteine ​​residues (referred to as "MA" to indicate the use of maleimide reactive groups) generally results in greater exposure compared to PEGylation with other chemistry.

[0103] In addition to the aforementioned studies on HO mice, the daily fluctuations of homocysteine, cystathionine, cysteine, and methionine were measured in these mice to determine the diurnal variations of these amino acids in these animals. Therefore, blood was drawn from six HO mice at the time points specified in Figure 3B within a 24-hour cycle, and plasma metabolite levels were measured at each specified time point. As shown in Figure 3B, cystathionine and cysteine ​​levels were largely constant within the 24-hour cycle. Homocysteine ​​and methionine levels tended to decrease from 7:00 AM to late morning-early afternoon. This is consistent with animals that eat at night and lack the capacity to metabolize homocysteine ​​via the transsulfurization pathway. Therefore, all injections and bloodletting were performed at 3:00 PM (3 PM), when Hcy levels are lowest, to determine whether treatment resulted in a further reduction in Hcy and other metabolites.

[0104] The molecular weight and specific activity (SA) of polyethylene glycol-modified rhCBSΔC are the main properties to be characterized. In the case of ME-400MA (Diameter 1), Figure 3C After PEGylation with GL4-400MA (lane 2) or ME-200MA0B (lane 3), the products were separated by electrophoresis on a 12% SDS-PAGE gel and compared with the non-PEGylated enzyme (lane 4). The resulting gels were stained with Coomassie blue. The SA (U / mg) of each PEGylated and non-PEGylated rhCBSΔC was as follows: Figure 3C As shown in the attached table. As indicated, PEGylation has no significant effect on the SA value, and the enzyme retains the same activity as before PEGylation. Based on the apparent molecular weight, PEGylation of rhCBSΔC under the conditions used in this experiment yields di- and tri-PEGylated rhCBSΔC.

[0105] The overall objective of the experiments described in this paper was to evaluate the pharmacokinetic parameters of the administered polyethylene glycol-modified rhCBSΔC. Particular emphasis was placed on reducing plasma homocysteine ​​and increasing plasma cystathionine in a CBS-deficient homocystinuria animal model. HO mice fed a normal mouse diet were selected as the model system for testing this type of enzyme replacement therapy (ERT). HO mice were injected once at time zero with polyethylene glycol-modified rhCBSΔC containing PEG molecules (GL4-400MA, ME-400MA, ME-200MA0B), and bled at time zero (before injection), 24, 48, and 72 hours. Plasma homocysteine ​​(Figure 3D) and cystathionine (Figure 3D) levels for each group (n=5-6) are indicated. Figure 3E ) levels. As shown in Figure 3D, compared to zero, homocysteine ​​levels were significantly reduced for each polyethylene glycol form used, and cystathionine levels ( Figure 3E The levels of homocysteine ​​and cystathionine increased by approximately 6 to 7 times. Therefore, it was found that administration of polyethylene glycol-modified rhCBSΔC in vivo significantly and definitively affected homocysteine ​​and cystathionine levels.

[0106] Example 5 Repeated injections of PEGylated rhCBSΔC significantly affected high homocysteine ​​and cystathionine plasma levels and restored normal homocysteine ​​levels.

[0107] The following repeated injection protocols with clearance periods were performed to compare the ability of non-PEGylated and PEGylated rhCBSΔC to reduce and maintain low levels of homocysteine ​​and increase cystathionine and homocysteine ​​levels. Six HO mice were injected with GL4-400MA PEGylated rhCBSΔC on days 0, 1, 2, 3, and 4 (arrows, Figure 4), followed by clearance on day 10, and then repeated injections on days 14, 15, 16, 17, and 18. Plasma samples were collected at the time points shown in Figure 4 (always prior to injection). For comparison, the same injection protocol was performed in five HO mice injected with the non-PEGylated enzyme. Plasma metabolite levels were determined by stable isotope dilution liquid chromatography-mass spectrometry as described in Example 1e. The plasma concentrations of homocysteine ​​(results shown in Figure 4a) and cystathionine (Figure 4b) for each mouse are indicated. Mean values ​​of homocysteine ​​and cystathionine for each experimental group are also given (in Figure 4c). As shown in Figures 4a-4c, the mean homocysteine ​​concentration decreased from 182 µM to 38 µM over 48 hours and remained at a low level for a full week. Cystathione started at 4.7 µM from zero, reached a concentration of 42 µM over 48 hours, and remained at a high level for the first week. During clearance, metabolites returned to their initial values. Subsequent CBS injections again caused a sharp decrease in homocysteine ​​levels and an increase in cystathione levels. Then, discontinuation of treatment again caused these parameters to return to untreated levels.

[0108] The effect of polyethylene glycol-modified rhCBSΔC on plasma homocysteine ​​levels was also determined compared to non-PEGylated rhCBSΔC, as shown in Figure 4d as a percentage at zero. Figure 4d illustrates that when blood samples were taken 24 hours or longer post-injection, the non-PEGylated enzyme had no significant effect on homocysteine ​​concentration compared to PEGylated rhCBSΔC. This is consistent with the results shown in Examples 2 and 3, indicating that the non-PEGylated enzyme was rapidly cleared from circulation, with no significant activity observed at 24 and 48 hours post-injection.

[0109] Compared to non-PEGylated rhCBSΔC, the effect of PEGylated rhCBSΔC on plasma cysteine ​​levels was also determined using the same experimental method. Figure 4E As shown, during the injection of the polyethylene glycol-modified enzyme, cysteine ​​levels normalized (doubled compared to zero), while no change in cysteine ​​levels was observed when using the non-polyethylene glycol-modified enzyme.

[0110] These results indicate that administration of PEGylated rhCBSΔC enzyme to HO mice via SQ significantly and definitively affected homocysteine ​​and cystathionine concentrations, while simultaneously restoring homocysteine ​​levels to their normal values. The latter result suggests that intracellular transsulfurization pathways were activated following rhCBSΔC administration.

[0111] Example 6 Variation in the aggregation degree of human truncated CBS formulation (rhCBSΔC).

[0112] Non-denaturing PAGE gel electrophoresis (4-15%, i.e., without denaturing agents such as sodium dodecyl sulfate) was performed using different batches (112, 13, 7, 27, and 28) of rhCBSΔC. Figure 5 The results shown in Figure A indicate that different formulations exhibit different proportions of tetramers (T) and dimers (D), and higher forms of aggregated CBS. In non-denaturing polyacrylamide gels (by activity staining), the activity of CBS within the gel was determined by electrophoresis on protein samples at 4°C. Figure 5 B). The gel was then immersed in the active staining solution (see Table A) and incubated at 37°C for approximately 15 minutes. After approximately 15 minutes, dark gray bands (~45 kDa dimers of CBS species 1-413) appeared, depending on the loading amount. Tetramers were visible after much longer times; up to 1 hour or overnight at room temperature. Non-denaturing gels were analyzed using this in-gel activity method, such as... Figure 5 As shown in Figure B, bands for the tetramer (T), dimer (D), and other higher aggregation forms of rhCBSΔC were confirmed, indicating that in Figure 5 Batch 112 and 28 in A are CBS related.

[0113] Table A. Active Staining Solution SDS-PAGE analysis of batches 28 and 112 and their PEGylated products showed that the rhCBSΔC batch PEGylated with ME-200MA0B exhibited different proportions between the two PEGylated bands (P) formed after PEGylation (see [link]). Figure 5 C). Therefore, tools were found to reduce aggregation and increase reproducibility.

[0114] Example 7 The human C15S mutant CBS forms only dimers.

[0115] The cysteine ​​residue at position 15 of rhCBSΔC is uncoupled, and is therefore considered a possible factor leading to aggregation. Thus, a novel recombinant plasmid was prepared to generate the rhCBSΔC mutant protein, referred to herein as C15S. The same strategy used to prepare rhCBSΔC in Example 1b was employed to generate the C15S mutant CBS enzyme (T to A nucleotide mutation) using primers: C1 5'-TGGGTCCCGACGGGTAGCCCGCAC – 3' (SEQ ID NO: 11) and C2 5' - GTGCGGGCTACCCGTCGGACCCA - 3' (SEQ ID NO: 12).

[0116] The complete nucleotide sequence of the C15S mutant CBS truncated enzyme (SEQ ID NO: 14) was confirmed by nucleotide sequencing. The same method described in Example 1 for recombinant human CBS truncated enzymes was used for the expression and isolation of the C15S mutant CBS enzyme.

[0117] Non-denaturing PAGE of isolated C15S CBS enzymes confirmed that C15S CBS exists only as a dimer (see [link]). Figure 6A This differs from the results obtained from recombinant human truncated CBS (rhCBSΔC), which forms dimers (D) and tetramers (T), as well as higher oligomeric forms. Multiple batches (51, 60, and 73) of the C15S mutant CBS and the recombinant human double truncated form (batch RC-2-76) demonstrated that both formed only dimers, unlike recombinant human truncated CBS (rhCBSΔC). (See also...) Figure 6B C15S PEGylated with ME-200MA0B produced consistent and reproducible bands with similar proportions between the PEGylated bands. Denatured SDS-PAGE showed that C15S produced a reproducible PEGylation pattern similar to that of recombinant human double-truncated CBS (batch RC-2-76), and both of these differed from the pattern obtained using recombinant human truncated CBS (rhCBSΔC). Figure 6C This is also related to... Figure 5 C is equivalent, showing a non-reproducible rhCBSΔC polyethylene glycol oxidization mode.

[0118] HPLC size exclusion chromatography was performed on the CBS formulation. Recombinant human truncated CBS (rhCBSΔC) Figure 7A ) and C15S mutant ( Figure 7B Both were separated on a Yarra SEC-3000, 300 x 7.8 mm size size size size size size size column (Phenomenex, CA, USA). The column was calibrated and operated at room temperature with 100 mM sodium phosphate at pH 6.8, and a flow rate of 1 ml / min. Figure 7 shows rhCBSΔC ( Figure 7A ) and C15S mutant ( Figure 7B Size exclusion chromatography (SEC) analysis was performed. These analyses provide additional evidence that the C15S mutant CBS exists only as a dimer, as reproducible singlets were given for five different batches (see [link to SEC]). Figure 7B For comparison, note Figure 7A rhCBSΔC and 6 different modes in Figure 7BThe single peak of the C15S mutant CBS in the study.

[0119] Example 8 In two HO mice, continuous administration of polyethylene glycolated C15S for 20 days resulted in a decrease in plasma homocysteine ​​levels.

[0120] The ALZET® osmotic pump allows for stable and controlled delivery of C15S enzyme over extended periods. C15S CBS enzyme was administered to mice using the ALZET® pump (Micro-osmotic ALZET® pump, model 1002, lot number 10268-12) to provide continuous delivery of C15S CBS enzyme instead of repeated subcutaneous injections. In these experiments, the average pump rate was 0.21 μL / hr; the average fill volume was 106.6 μL; and the pump was loaded with approximately 106 μL of polyethylene glycol-modified C15S CBS enzyme at a concentration of 26.2 μg / μL. Continuous administration of C15S CBS for up to 20 days in two HO mice resulted in an initial significant reduction in plasma homocysteine ​​and a subsequent sustained reduction (see [link to relevant documentation]). Figure 8 ).

[0121] To reduce pain before and after the procedure, animals were given TYLENOL® (2 mg / ml) in a water bottle for 48 hours before and after the ALZET® pump was implanted. In addition, animals were given carbofenone 5 mg / kg subcutaneously every 24 hours for 48 hours before the procedure.

[0122] For animal anesthesia and surgery, isoflurane is administered via inhalation. Mice are induced with 5% isoflurane and maintained at 2-3%. While anesthetized, mice are individually implanted with medical-grade ALZET® osmotic pumps under sterile conditions in a biosafety cabinet. The pump is implanted subcutaneously in the loose skin area on the ventral side of the neck. Prior to pump implantation, mice are shaved and prepared with BETADINE®. Pump implantation requires a small surgical incision (5 mm) made with sterile scissors. The incision is closed with a wound clip. The clip is removed after 1 week when the skin has fully healed. [The last sentence appears to be incomplete and possibly refers to a separate procedure.] Figure 8 Blood samples were collected at the indicated times to determine homocysteine ​​levels. The results showed that this administration regimen reduced homocysteine ​​levels in a manner similar to that achieved with daily rhCBSΔC administration. Similar experiments were performed using the non-PEGylated C15S mutant CBS, and no significant reduction in Hcy plasma levels was observed (results not shown).

[0123] Example 9 Comparison of three polyethylene glycol-modified truncated human CBS enzymes.

[0124] Figure 9This is a bar chart showing the experimental results, in which HO mice were injected at time zero with a single dose (7.5 mg / kg) of rhCBSΔC, the C15S mutant (C15S), and the double-truncated construct (double-truncated), which had been PEGylated with ME-200MA0B. Mice were bled at time zero (before injection) and at 24, 48, and 72 hours post-injection. Plasma homocysteine ​​levels are indicated for each group (n=5–6). The results showed that all three enzyme forms resulted in a considerable reduction in plasma Hcy concentration.

[0125] Table 2: CBS Sequences The invention has been described in detail with reference to its specific embodiments. It will be apparent that modifications and variations are possible without departing from the scope of the invention as defined in the appended claims. More specifically, while some aspects of the invention are considered particularly advantageous herein, it is not intended that the invention be limited to these specific aspects.

Claims

1. An isolated cystathionine-β-synthase (CBS) polypeptide comprising SEQ ID NO: 02 or a homolog, variant or mutant thereof, wherein the isolated CBS polypeptide is chemically modified and comprises a truncation of the full-length human CBS protein at the amino terminus, the carboxy terminus, or at both the amino and carboxy termini.

2. The isolated CBS polypeptide of claim 1, wherein the isolated CBS polypeptide is a genetically engineered truncation that lacks C-terminal residues 383-551, 397-551, 414-551, 442-551, 489-551, 497-551, 524-551, 534-551, or 544-551.

3. The isolated CBS polypeptide of claim 2, wherein the isolated CBS polypeptide comprises a deletion of C-terminal residues 414-551.

4. The isolated CBS polypeptide of any one of claims 1-3, wherein the isolated CBS polypeptide is a genetically engineered truncation that lacks N-terminal residues 2-39 or 1-70.

5. The isolated CBS polypeptide of claim 1, wherein the isolated CBS polypeptide comprises a change of cysteine to serine at amino acid position 15.

6. The isolated CBS polypeptide of claim 5, wherein the isolated CBS polypeptide comprising a change of cysteine to serine at amino acid position 15 is a genetically engineered truncation that lacks C-terminal residues 383-551, 397-551, 414-551, 442-551, 489-551, 497-551, 524-551, 534-551, or 544-551.

7. The isolated CBS polypeptide of claim 6, wherein the isolated CBS polypeptide comprising a change of cysteine to serine at amino acid position 15 also lacks C-terminal residues 414-551 (SEQ ID NO: 13).

8. An isolated CBS polypeptide comprising SEQ ID NO: 02 or a homolog thereof, wherein the isolated CBS polypeptide comprises a change of cysteine to serine at amino acid position 15, and wherein the isolated CBS polypeptide is chemically modified.

9. The isolated CBS polypeptide of any one of claims 1-8, wherein the CBS polypeptide is covalently linked to one or more polyethylene glycol molecules.

10. The isolated CBS polypeptide of claim 9, wherein the polyethylene glycol molecules are selected from the group consisting of unbranched and branched polyethylene glycol.

Citation Information

Patent Citations

  • DNA sequence encoding human cystathionine beta -synthase

    US5523225A

  • Method of increasing the yield and heme saturation of cystathione beta -synthase

    US5635375A

  • Human cystathionine beta-synthase variants and methods of production thereof

    US7485307B2

  • Human cystathionine β-synthase variants and methods of production thereof

    US8007787B2