Application of neurogranular protein in diagnosis and treatment of spinal cerebellar ataxia type 3
By detecting the concentration of neurogranule protein in plasma and overexpressing NRGN in an SCA3 mouse model, the diagnostic and therapeutic challenges of SCA3 have been solved, providing new biomarkers and therapeutic targets, and enabling precise diagnosis and treatment and research support for SCA3.
Patent Information
- Application Number
- CN202511960100.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-23
- Publication Date
- 2026-03-10
AI Technical Summary
There are currently no effective treatments or diagnostic methods for spinocerebellar ataxia type 3 (SCA3), which leads to high mortality and disability rates, and the pathogenesis remains unclear.
By detecting the concentration of neurogranule protein (NRGN) in plasma, it was used as a diagnostic biomarker to distinguish SCA3 patients from healthy controls. In an SCA3 mouse model, NRGN was overexpressed as a therapeutic target to improve behavioral and molecular pathological phenotypes.
This enables precise diagnosis and treatment of SCA3, provides new biomarkers and therapeutic targets, and supports in-depth research on SCA3.
Smart Images

Figure CN121629038A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, and in particular to the application of neurogranule proteins in the diagnosis and treatment of spinocerebellar ataxia type 3. Background Technology
[0002] Spinocerebellar ataxias (SCA) are a large group of hereditary neurodegenerative diseases with high clinical and genetic heterogeneity, with an incidence of approximately 1-5 per 100,000. SCA presents with complex clinical manifestations, primarily characterized by ataxia and cerebellar atrophy, and may be accompanied by complex neurological and non-neurological manifestations. SCA is mostly inherited in an autosomal dominant pattern, and there are currently more than 50 subtypes. Spinocerebellar ataxia type 3 (SCA3), also known as Machado-Joseph disease (MJD), is the most common subtype of SCA. SCA3 is caused by an abnormal amplification of the CAG trinucleotide repeat in the coding region of the disease-causing gene ATXN3. The normal copy number is approximately 12-40, while in patients, due to dynamic mutations, it can amplify to 55-86 times. Abnormally amplified CAG leads to the abnormal elongation of the polyglutamine (polyQ) peptide chain in the encoded protein ataxin-3. This polyglutamine selectively accumulates in specific regions of the nervous system (cerebellum, brainstem, etc.), forming neuronal intranuclear inclusions (NIIs) and causing cell death. Diseases caused by selective neuronal death due to this type of polyQ extended mutant protein are also known as polyQ diseases. SCA3 is one of the most representative polyQ diseases. Due to its incompletely understood pathogenesis and lack of specific treatment, it has high mortality and disability rates, placing a heavy burden on patients, families, and society. Therefore, precise diagnosis and treatment of SCA3 is an urgent clinical and fundamental problem to be solved. Summary of the Invention
[0003] The purpose of this invention is to provide the application of neurogranule proteins in the diagnosis and treatment of spinocerebellar ataxia type 3 (SCA3), thereby addressing the problems existing in the prior art. This invention has found that detecting the concentration of neurogranule proteins in plasma can effectively distinguish between SCA3 patients and healthy controls, confirming the diagnostic efficacy of neurogranule proteins in SCA3. Furthermore, by overexpressing neurogranule proteins in an SCA3 mouse model, it has been confirmed that neurogranule proteins can serve as a therapeutic target for SCA3. This invention provides new biomarkers and therapeutic targets for the diagnosis and treatment of SCA3, and provides technical support and theoretical basis for in-depth research on the precision diagnosis and treatment of SCA3 and its pathogenesis.
[0004] To achieve the above objectives, the present invention provides the following solution:
[0005] This invention provides the application of reagents for detecting plasma neurogranule protein concentration in the preparation of products for diagnosing spinocerebellar ataxia type 3.
[0006] Furthermore, patients with spinocerebellar ataxia type 3 had higher plasma neurogranule protein concentrations than healthy individuals.
[0007] Optionally, the product may include reagents or kits.
[0008] The present invention also provides a product for diagnosing spinocerebellar ataxia type 3, the product comprising a reagent for detecting plasma neurogranule protein concentration.
[0009] Optionally, the product may include reagents or kits.
[0010] This invention also provides the use of neurogranule proteins in the preparation of medicaments for treating spinocerebellar ataxia type 3.
[0011] The present invention also provides the use of products overexpressing neurogranule proteins in the preparation of medicaments for treating spinocerebellar ataxia type 3.
[0012] Furthermore, the gene encoding the neurogranule protein is shown in SEQ ID NO.1.
[0013] The present invention also provides a product that overexpresses a neurogranule protein, the gene encoding the neurogranule protein being shown in SEQ ID NO.1.
[0014] The present invention also provides a drug for treating spinocerebellar ataxia type 3, wherein the drug uses neurogranule protein or the above-mentioned product overexpressing neurogranule protein as the active ingredient.
[0015] The present invention discloses the following technical effects:
[0016] This invention reveals that patients with spinocerebellar ataxia type 3 (SCA3) have significantly higher plasma neurogranule protein concentrations compared to healthy controls. Measuring plasma neurogranule protein concentration effectively distinguishes SCA3 patients from healthy controls, confirming the diagnostic efficacy of neurogranule protein in SCA3. Furthermore, this invention demonstrates that overexpression of neurogranule protein in a mouse model of SCA3 significantly improves behavioral and molecular pathological phenotypes, synapses, and related neural circuits, proving that neurogranule protein can serve as a therapeutic target for SCA3. This invention provides novel biomarkers and therapeutic targets for the diagnosis and treatment of SCA3, offering technical support and theoretical basis for precise diagnosis and treatment of SCA3 and in-depth research into its pathogenesis. Attached Figure Description
[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0018] Figure 1 The results of NRGN detection in brain tissue of SCA3-KI-96Q mice are shown below. A shows the differential gene volcano plot of transcriptome sequencing of cerebellar tissue from 9-month-old WT and SCA3-KI-96Q mice, and the qPCR results of NRGN mRNA expression level detection; B shows the Western blot results of NRGN protein detection in brain tissue from 9-month-old WT and SCA3-KI-96Q mice; C shows the immunohistochemical results of NRGN in cerebellar tissue from 9-month-old WT and SCA3-KI-96Q mice, and a comparative statistical graph of the number of NRGN-positive Purkinje cells. The arrows indicate Purkinje cells in the cerebellum. The magnification of the left and right images is 20× and 63×, respectively, and the scale bars are 20µm and 50µm, respectively. *P<0.05, **P<0.01;
[0019] Figure 2 The results show the detection results of plasma NRGN concentration in SCA3-KI-96Q mice; where A represents the detection results of plasma NRGN concentration in 18-month-old WT and SCA3-KI-96Q mice; B represents the correlation analysis results between plasma NRGN concentration and rotarod time in SCA3-KI-96Q mice; C represents the correlation analysis results between plasma NRGN concentration and balance beam time in SCA3-KI-96Q mice; and D represents the correlation analysis results between plasma NRGN concentration and grip strength in SCA3-KI-96Q mice.
[0020] Figure 3 The four-parameter logistic curve fitting equation for determining plasma NRGN concentration using an ELISA kit;
[0021] Figure 4 To screen for plasma NRGN concentrations in SCA3 patients and healthy controls (HC); **P<0.01;
[0022] Figure 5 To validate the plasma NRGN concentrations of SCA3 patients and healthy controls (HC); where A is a box plot comparing plasma NRGN concentrations of all SCA3 patients and healthy controls, ***P<0.001; B is a box plot comparing plasma NRGN concentrations among the preclinical, clinical, and healthy control groups after natural logarithmic transformation, **P<0.01, ***P<0.001;
[0023] Figure 6 Operating curves for distinguishing between SCA3 patients and healthy controls based on plasma NRGN concentration at different stages; where A is the operating curve for distinguishing between SCA3 patients (SCA3) and healthy controls based on plasma NRGN concentration; B is the operating curve for distinguishing between attaxic SCA3 and healthy controls based on plasma NRGN concentration; and C is the operating curve for distinguishing between preclinical SCA3 and healthy controls based on plasma NRGN concentration.
[0024] Figure 7 The correlation between plasma NRGN concentration and disease severity in SCA3 patients is shown below. Specifically, A represents the correlation analysis results between plasma NRGN concentration and SARA score in SCA3 patients; B represents the correlation analysis results between plasma NRGN concentration and ICARS score in SCA3 patients; C represents the correlation analysis results between plasma NRGN concentration and posture and gait scores in SCA3 patients; D represents the correlation analysis results between plasma NRGN concentration and limb coordination score in SCA3 patients; E represents the correlation analysis results between plasma NRGN concentration and dysarthria score in SCA3 patients; and F represents the correlation analysis results between plasma NRGN concentration and oculomotor dysfunction score in SCA3 patients.
[0025] Figure 8 A schematic diagram of the structure of the NRGN overexpression viral vector;
[0026] Figure 9 Figure 1 shows the behavioral and molecular pathological results of SCA3-KI-96Q mice after overexpression of NRGN virus. A represents the infection extent of the cerebellum of SCA3-KI-96Q mice after stereotactic injection of AAV virus overexpressing NRGN (scale bar: 200 μm); B represents the immunofluorescence detection results of NRGN in the cerebellar tissue of the control and treatment groups (scale bar: 100 μm); C represents the behavioral scores of AAV-controlled and treatment-treated mice; D represents the expression of NRGN, CD28K, and GFAP proteins in the cerebellar tissue of the control and treatment groups (*p < 0.05, **p < 0.01).
[0027] Figure 10 The images show the synaptic and neural circuit detection results of SCA3-KI-96Q mice after NRGN virus overexpression. A shows the Golgi staining results of the treatment and control groups after NRGN virus overexpression, with magnifications of 20× and 63× for the upper and lower images, respectively. B shows the statistical results of Golgi staining; the left image is a statistical chart of Purkinje dendritic length, and the right image is a statistical chart of dendritic branch complexity. C is an optogenetic statistical chart representing changes in the dentate nucleus-thalamus neural circuit. Detailed Implementation
[0028] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0029] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0030] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0031] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0032] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0033] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the instruments and equipment used in the following examples are all conventional laboratory instruments and equipment; unless otherwise specified, the experimental materials used in the following examples were all purchased from conventional biochemical reagent stores.
[0034] The technical concept of this invention is as follows:
[0035] Our research group previously successfully constructed a novel humanized SCA3 mouse model (SCA3-KI-96Q) expressing the polyQ extended mutant ataxin-3. Transcriptome analysis revealed that the mRNA and protein expression levels of neurogranin (NRGN) in the cerebellar tissue of SCA3 mice were significantly lower than those in healthy control mice. NRGN is a postsynaptic protein mainly expressed in the cerebral cortex, hippocampus, striatum, cerebellum, and amygdala. NRGN can bind to calmodulin (CaM) and participate in the regulation of various postsynaptic signaling pathways. Mice with NRGN gene knockout exhibit phenotypes such as motor dysfunction. In recent years, research on NRGN has mainly focused on its value as a biomarker. Studies have shown that NRGN expression is reduced in the brain tissue of Alzheimer's disease (AD) patients, but significantly increased in plasma, and positively correlated with disease severity. This may be because as the disease progresses, neuronal damage and death in AD patients lead to the release of NRGN from neurons, which crosses the damaged blood-brain barrier into the peripheral circulation, resulting in increased plasma NRGN levels. Previous research by our group found that plasma NRGN concentration was significantly higher in SCA3 patients compared to healthy controls, and that this was correlated with disease severity. This provides a new clinical research perspective for evaluating the potential value of NRGN as a biomarker for SCA3.
[0036] Furthermore, our research group applied stereotactic injection of AAV-NRGN overexpression into the brain, which significantly improved the motor and molecular pathological phenotypes of ataxia in SCA3 mice. The dentate nucleus, as a major site of cerebellar involvement in SCA3, is also considered to play a crucial role in the regulation of cerebellar motor function due to changes in its neural circuits with the thalamus. Therefore, we hypothesize that NRGN may play an important role in the neural circuits of the dentate nucleus-thalamus in the SCA3 cerebellum and could be a potential therapeutic target for SCA3.
[0037] Example 1: Application of neurogranulin (NRGN) as a diagnostic biomarker for SCA3
[0038] I. Experimental Methods
[0039] 1. Detection of NRGN expression levels in SCA3-KI-96Q mice at different disease stages
[0040] 1.1 Experimental Animals
[0041] The construction process of SCA3-KI-96Q mice can be found in Chinese Patent ZL 202211587327.4 (publication date: July 2, 2024). SCA3-KI-96Q mice aged 2, 6, 12, and 18 months were selected as experimental groups, and sex- and age-matched wild-type mice were selected as control groups. Three mice of each age were included. Cerebellar tissue was obtained from the mice and stored in liquid nitrogen for later use.
[0042] 1.2 Detection of mRNA and protein expression levels of NRGN in mouse brain tissue
[0043] (1) Collect cerebellar tissues from SCA3-KI-96Q mice of different ages and normal control mice, and extract mRNA and protein.
[0044] (2) The mRNA expression level of NRGN in the cerebellar tissue of the above mice was detected by qPCR, and the differences in mRNA expression of NRGN in the cerebellar tissue of SCA3-KI-96Q mice of different ages and normal control mice were compared.
[0045] (3) Western blot was used to detect the protein expression level of NRGN in the cerebellar tissue of the above mice, and the differences in protein expression of NRGN in the cerebellar tissue of SCA3-KI-96Q mice of different ages and normal control mice were compared.
[0046] (4) Combine behavioral experiments such as rotarod, balance beam, footprint, grip force, and open field in SCA3-KI-96Q mice to analyze the correlation between the expression level of NRGN in mouse cerebellar tissue and the severity of the disease.
[0047] 1.3 Detection of NRGN expression levels in mouse plasma
[0048] (1) Blood samples were collected from SCA3-KI-96Q mice of different ages and normal control mice, and plasma was separated by centrifugation.
[0049] (2) The concentration of NRGN in the plasma of the above mice was detected by ELISA, and the difference in the concentration of NRGN in the plasma of SCA3-KI-96Q and normal control mice at different age stages was compared.
[0050] (3) Based on the phenotypic data of SCA3-KI-96Q mice, including behavioral experiments such as rotarod, balance beam, footprint, grip, and open field, the correlation between plasma NRGN concentration and disease severity was analyzed.
[0051] 2. Construction of a clinical cohort of SCA3 patients
[0052] Relying on the Department of Neurology, the National Clinical Research Center for Geriatric Diseases (Xiangya), and the Hunan Provincial Key Laboratory of Neurodegenerative Diseases of Xiangya Hospital, Central South University, we recruited 50 preclinical patients diagnosed with SCA3 by genetic testing, 150 clinical patients, and 150 age- and sex-matched healthy controls. All patients were confirmed to have no other underlying diseases by physical examinations and auxiliary laboratory tests conducted by at least two neurologists and met the following criteria:
[0053] Inclusion criteria: 1) Age 18 years or older; 2) Willing to participate in this study and good compliance; 3) Understand and sign the informed consent form and be willing to cooperate with the researchers to complete relevant examinations, treatments and follow-ups.
[0054] Exclusion criteria: 1) History of cerebrovascular disease, traumatic brain injury, dementia, Parkinson's disease, mental illness, etc.; 2) Fever or infection within the past month; 3) History of diabetes, hyperthyroidism, liver disease, kidney disease, autoimmune disease, etc.
[0055] 3. Detection of plasma NRGN concentration
[0056] After obtaining informed consent, 5 mL of fasting venous blood was drawn from all participants, and plasma was separated. Plasma NRGN concentrations were measured using ELISA in SCA3 patients and healthy controls. Differences in plasma NRGN concentrations between the two groups were compared, as were differences between SCA3 patients in the clinical phase and those in the preclinical phase. Correlation analysis was performed on plasma NRGN concentrations in SCA3 patients with age of onset, disease duration, clinical scores (ICARS, SARA scores), and auxiliary examinations to explore the value of NRGN as a potential biomarker for monitoring SCA3 disease progression.
[0057] II. Experimental Results
[0058] 1. Expression of neurogranulin (NRGN) in different disease stages in SCA3-KI-96Q mice
[0059] Based on the previously established SCA3-KI-96Q mouse model, transcriptome sequencing and validation were performed on the cerebellar tissues of 9-month-old KI and WT mice. The results showed that NRGN mRNA expression in the cerebellar tissue of 9-month-old SCA3 KI mice was significantly downregulated; Western blot analysis revealed significantly downregulated protein expression in the cerebellar tissue of 9-month-old SCA3 KI mice; and immunohistochemistry showed decreased NRGN expression levels in the cerebellar tissue of 9-month-old SCA3 KI mice. Figure 1 ).
[0060] Blood was collected from the eyes of 24 18-month-old SCA3-KI-96Q mice and 16 18-month-old WT mice. Plasma NRGN concentration was measured by ELISA. The results showed that the plasma NRGN concentration in KI mice was significantly higher than that in WT mice, consistent with the findings in the SCA3 clinical cohort. Eighteen KI mice were selected, and correlation analysis was performed between NRGN concentration and various mouse behaviors (rotarod, balance beam, grip strength), but no significant correlation was found. Figure 2 ).
[0061] 2. Application of plasma neurogranulin (NRGN) concentration in the diagnosis of SCA3 patients
[0062] First, 20 SCA3 patients and 20 sex- and age-matched healthy controls were randomly selected from the previously constructed SCA3 clinical cohort as the screening set. Plasma NRGN concentration was measured using an ELISA kit. The four-parameter logistic curve fitting equation was y = 5.89 / [1 + (x / 713.97)^-1.14] + 0.13, r 2 = 0.99969 ( Figure 3 Comparative analysis of the measured plasma NRGN concentrations in the two groups revealed that the plasma NRGN concentrations in SCA3 patients were significantly higher than those in healthy controls (SCA3: 631.18 ± 732.69 vs HC: 101.49 ± 115.78, p < 0.01). Figure 4 The results suggest that plasma NRGN concentration has potential diagnostic value for SCA3.
[0063] Next, based on the previously constructed SCA3 clinical cohort, 166 SCA3-diagnosed patients (28 preclinical patients and 138 clinical patients) and 115 age- and sex-matched healthy controls were randomly selected as the validation set. Plasma NRGN concentration was measured using ELISA. It was found that, compared with healthy controls, the plasma NRGN concentration in SCA3 patients was significantly higher than that in normal controls. Figure 5 ).
[0064] The ability of plasma NRGN concentration to distinguish between HC and different stages of SCA3 was assessed using receiver operating characteristic (ROC) curves. Results showed that plasma NRGN could effectively distinguish between SCA3 patients and healthy controls; plasma NRGN could also effectively distinguish between the symptomatic phase of SCA3 and healthy controls, and between the pre-symptomatic phase of SCA3 and healthy controls; however, plasma NRGN could not distinguish between the symptomatic phase of SCA3 and the pre-symptomatic phase of SCA3. Figure 6 ).
[0065] A comparison of the correlation between plasma NRGN concentration and disease severity in SCA3 patients revealed a negative correlation between plasma NRGN concentration and SARA (serial acute renal impairment), r = -0.28, p < 0.01. SCA3 patients were grouped into three groups based on SARA scores: mild (0-3 points), moderate (3-10 points), and severe (>10 points). The group with a SARA score of 0-3 had higher plasma NRGN concentrations, but there were no statistically significant differences among the three groups. Plasma NRGN concentration showed a negative correlation with ICARS (Integrated Carotid Artery Score) in SCA3 patients, r = -0.19, p < 0.05. Furthermore, it showed a negative correlation with two of the four sub-items of the ICARS score: limb coordination score and dysarthria score. Figure 7 ).
[0066] Example 2: Application of neurogranule protein (NRGN) as a therapeutic target for SCA3
[0067] I. Experimental Methods
[0068] 1. Construction of AAV-based NRGN overexpression vector
[0069] Based on the cross-packaging method, an infectious NRGN recombinant AAV vector was synthesized. The target gene NRGN (SEQ ID NO.1) and green fluorescent protein EGFP were ligated into the WPRE-hGH polyA vector using a 2A peptide, enabling overexpression under the regulation of the broad-spectrum promoter CAG. A schematic diagram of the viral vector structure is shown below. Figure 8 .
[0070] SEQ ID NO.1:
[0071] atggactgctgcaccgagaacgcctgctccaagccggacgacgacattctagacatcccgctggacgatcccggcgccaacgcggccgccgccaaaatccaggcgagttttcggggc cacatggcgcggaagaagataaagagcggagagcgcggccggaagggcccgggccctggggggcctggcggagctggggtggcccggggaggcgcgggcggcggccccagcggagac.
[0072] The constructed viral vector and the plasmids pHelper (carrying adenovirus-derived genes) and pAAV-RC (carrying AAV replication and capsid genes) (1:1:1) were transfected into AAV-293 cells. After cell culture, lysis, purification, and collection, the recombinant virus rAAV-CAG-NRGN-2a-EGFP-WPRE-pA was collected, its titer was determined, and it was stored. The empty vector virus rAAV-CAG-EGFP-WPRE-pA was prepared using the same method. The above process was completed by Wuhan Shumi Brain Science Technology Co., Ltd.
[0073] rAAV-CAG-NRGN-2a-EGFP-WPRE-pA was used for the treatment group virus (AAV-NRGN), and rAAV-CAG-EGFP-WPRE-pA was used for the control group virus (AAV-Control). The viral titer for both was 1×10⁻⁶. 13 vg / mL.
[0074] 2. Experimental Grouping
[0075] Twenty 12-month-old male SCA3-KI-96Q mice were selected and divided into two groups (empty control group and NRGN treatment group), with 10 mice in each group. The mice were evenly distributed into the two groups according to the baseline behavioral test results.
[0076] 3. Stereotactic injection of the brain
[0077] Mice were anesthetized with isoflurane and fixed in a prone position on a stereotaxic apparatus. After routine skin preparation, disinfection, and draping, a 1cm midline incision was made to expose the skull and determine the injection coordinates. Two injection sites were established on each side: 6.84mm posterior to the anterior fontanelle, 1mm lateral to the midline on both sides, with a depth of 3mm. 1µL was injected at each site at a rate of 0.1µL / min. The needles were left in place for 10 minutes after each injection, with a withdrawal rate of 1mm / min. The injection site was sutured and disinfected after the procedure. The mice's vital signs were closely monitored intraoperatively and postoperatively.
[0078] 4. Mouse behavioral testing
[0079] Four weeks after viral injection, mice underwent behavioral tests including rotarod, balance beam, footprint, grip, and open field tests.
[0080] 5. Detection of mouse molecular pathological phenotypes
[0081] The following molecular pathological phenotypes were detected: ① Western blot was used to detect changes in the expression levels of related indicators such as NRGN protein, ataxin-3 protein, calbindin-28k protein, autophagy / apoptosis, neuroinflammation, and synaptic function in cerebellar tissue; ② Immunofluorescence and immunohistochemistry were used to detect changes in molecular pathological phenotypes such as the morphology, number, molecular layer thickness, and expression and distribution of synaptic proteins in nuclear inclusion bodies and Purkinje cells; ③ Golgi staining was used to detect changes in the morphology of Purkinje cells in the cerebellum of mice in the treatment and control groups; ④ Electron microscopy was used to detect indicators such as the number, morphology, and synaptic cleft of cerebellar tissue synapses.
[0082] 6. Investigate the effects of NRGN intervention on the SCA3-KI-96Q mouse model on related neural circuits.
[0083] 6.1 Investigating the overall effects of NRGN on the cerebellar dentate nucleus-thalamic ventrolateral nucleus circuit in SCA3-KI-96Q mice
[0084] Fiber optic photometric recording combined with optogenetics was used to compare changes in the cerebellar dentate nucleus-thalamic ventrolateral nucleus circuit in 12-month-old SCA3-KI-96Q and wild-type male mice to elucidate the changes in this circuit in the mouse model. Furthermore, changes in this circuit were compared between the NRGN treatment group and the control group in 12-month-old SCA3-KI-96Q mice (opogenetic virus injection and fiber optic embedding were performed one week after NRGN injection in both groups) to elucidate the regulatory role of NRGN in this circuit. The procedures are as follows:
[0085] (1) Behavioral tests were performed on 12-month-old SCA3-KI-96Q mice;
[0086] (2) Optogenetic activation of the dentate nucleus and recording of neuronal activity in the ventrolateral nucleus of the thalamus: 800 nL of rAAV-hSyn-hChR2 (H134R)-mCherry (titer: 4.77E+12vg / mL) optogenetic virus with the photosensitive ion channel protein ChR2 as its core element was injected into the right dentate nucleus of mice. Simultaneously, 200 nL of rAAV-hSyn-GCaMP6s (titer: 5.05E+12vg / mL) calcium imaging virus with the calcium ion probe GCaMP6 as its core element was injected into the left ventrolateral nucleus of the thalamus. After ten minutes of no significant bleeding following injection, ceramic optical fibers were implanted approximately 100 μm above the virus injection site using a clamp. After hemostasis and disinfection, the fibers were fixed with dental cement. Three weeks postoperatively, mice were stimulated with yellow light (590 nm, 1.5 Mw / mm²). 2 (Pulse width 20ms, frequency 8.33Hz, duration 10s) When the right dentate nucleus was used, the activity of neurons in the contralateral ventrolateral thalamus was recorded simultaneously to assess the function of the dentate nucleus-ventrolateral thalamus circuit.
[0087] 6.2 Investigating the effects of NRGN on neuronal activity in various brain regions of the cerebellar dentate nucleus-thalamic ventrolateral nucleus circuit in SCA3-KI-96Q mice.
[0088] Fiber optic photometry combined with optogenetics was used to compare changes in neuronal calcium signaling in various brain regions of 12-month-old SCA3-KI-96Q and wild-type male rat models to assess neuronal activity changes in various brain regions within the motor circuit of the disease model. Furthermore, changes in neuronal calcium signaling in various regions of this circuit were compared between the NRGN treatment group and the control group of 12-month-old SCA3-KI-96Q rats to assess the effect of NRGN on neurons in various brain regions of the cerebellar dentate nucleus-thalamic ventrolateral nucleus circuit. The procedures are as follows:
[0089] (1) Evaluation of cerebellar dentate nucleus neuronal activity: The above-mentioned rAAV-hSyn-hChR2 (H134R)-mCherry and rAAV-hSyn-GCaMP6s viruses were injected into the right dentate nucleus region of mice and then embedded in an optical fiber. Three weeks later, yellow light stimulation (590nm, 1.5Mw / mm) was applied. 2 The pulse width was 20ms, the frequency was 8.33Hz, and the duration was 10s. The activity of neurons in the dentate nucleus was recorded simultaneously.
[0090] (2) Evaluation of neuronal activity in the ventrolateral nucleus of the thalamus: The rAAV-hSyn-hChR2 (H134R)-mCherry and rAAV-hSyn-GCaMP6s viruses were injected into the left ventrolateral nucleus of the thalamus of mice and then embedded in an optical fiber. Three weeks later, the mice were stimulated with yellow light (590nm, 1.5Mw / mm). 2 The activity of neurons in the ventral nucleus of the thalamus was recorded simultaneously with a pulse width of 20ms, a frequency of 8.33Hz, and a duration of 10s.
[0091] II. Experimental Results
[0092] After overexpressing AAV-NRGN in the cerebellum of SCA3-KI-96Q mice using stereotactic injection, the results showed that NRGN expression was significantly increased in the brain tissue of the treatment group compared with the control group, indicating that AAV-NRGN was successfully overexpressed in mice. Overexpression of NRGN significantly improved behavioral scores, molecular pathological phenotypes, synaptic and related neural circuits in SCA3-KI-96Q mice. Figure 9 and Figure 10 ).
[0093] The above results demonstrate that neurogranulin (NRGN) can not only serve as a biomarker for timely diagnosis of SCA3, but also as a therapeutic target for treating SCA3. This invention provides new biomarkers and therapeutic targets for the diagnosis and treatment of SCA3, offering technical support and theoretical basis for in-depth research into the precision diagnosis and treatment of SCA3 and its pathogenesis.
[0094] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. Use of a reagent for detecting the concentration of plasma neurogranin in the preparation of a product for the diagnosis of Spinocerebellar ataxia type 3.
2. Use according to claim 1, characterized in that, The concentration of neurogranin in the plasma of patients with Spinocerebellar ataxia type 3 is higher than in healthy subjects.
3. Use according to claim 1, characterized in that, The product comprises a reagent or a kit.
4. A product for diagnosing spinocerebellar ataxia type 3, characterized in that, The product comprises a reagent for detecting the concentration of plasma neurogranin.
5. The product of claim 4, wherein, The product comprises a reagent or a kit.
6. Use of neurogranin in the preparation of a medicament for the treatment of Spinocerebellar ataxia type 3.
7. Use of a product overexpressing neurogranin in the preparation of a medicament for the treatment of Spinocerebellar ataxia type 3.
8. Use according to claim 7, characterized in that, The coding gene of said neurogranin is shown in SEQ ID NO.
1.
9. A product overexpressing neurogranin, characterized in that, The coding gene of said neurogranin is shown in SEQ ID NO.
1.
10. A medicament for treating spinocerebellar ataxia type 3, characterized by comprising the compound according to claim 1. The medicament comprises as active principle neurogranin or a product overexpressing neurogranin according to claim 9.
Citation Information
Patent Citations
Construction and application of humanized ATXN3 gene knock-in mouse model based on CRISPR / Cas9
CN116064667B