SNP (Single Nucleotide Polymorphism) marker influencing disease resistance character of Tibetan sheep
By detecting the genotype of specific SNP loci on chromosomes in Tibetan sheep, the problem of evaluating disease resistance traits in Tibetan sheep has been solved, and accurate assessment of IL-1α, IL-1β, TNF-β, IL-1Ra and IL-10 has been achieved, improving breeding efficiency and the accuracy of disease resistance assessment.
Patent Information
- Application Number
- CN202610057077.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-16
- Publication Date
- 2026-03-10
AI Technical Summary
Existing technologies lack systematic association analysis of disease resistance traits in Tibetan sheep, especially functional SNP sites in the IL-1α, IL-1β, TNF-β, IL-1Ra and IL-10 genes, resulting in low breeding efficiency and difficulty in assessing disease resistance.
A SNP molecular marker for detecting disease resistance traits in Tibetan sheep is provided, located at 190,163,785 bases on chromosome 1 of the international sheep reference genome Oar_v4.0. The levels of IL-1α, IL-1β, TNF-β, IL-1Ra, and IL-10 are assessed by detecting the genotype (T/G) at this locus. Specific amplification primers (SEQ ID No. 2 and SEQ ID No. 3) are designed for PCR amplification, and genotyping is performed.
By detecting the genotype of this SNP locus in Tibetan sheep, we can significantly assess the low expression of IL-1α, IL-1β, TNF-β, and IL-1Ra and the high expression of IL-10. This provides a marker-assisted selection and breeding method for disease resistance traits for non-diagnostic purposes, improving breeding efficiency and accuracy.
Smart Images

Figure CN121629065A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of molecular biology detection, and particularly relates to SNP markers affecting the disease resistance traits of Tibetan sheep and application thereof. BACKGROUND
[0002] Tibetan sheep is a unique breed on the Qinghai-Tibet Plateau, which has long been adapted to the extreme environment of high altitude, low air pressure, strong ultraviolet rays and cold season nutrient stress. Its disease resistance is a core trait to protect the survival of the population and the stability of the breeding industry. With the development of sheep breeding, the types of sheep diseases have increased and the complexity has intensified, which not only seriously affects the production performance of Tibetan sheep, but also causes drug resistance in the body due to the use of a large amount of drugs, thereby bringing potential hidden dangers to animal product safety. Screening of disease resistance-related molecular markers from the genetic basis and carrying out molecular marker-assisted breeding are key ways to fundamentally improve the disease resistance of Tibetan sheep and reduce the risk of breeding.
[0003] The disease resistance of animals mainly depends on the functional state of the immune system. When pathogens invade, the immune system will start a series of immune responses to clear the pathogens, and immune indicators (such as immunoglobulin content) can directly reflect the disease resistance potential of the body. Cytokines, as the core regulatory molecules of the immune system, play a key role in immune response and inflammatory response. Among them, IL-1α and IL-1β, as important pro-inflammatory factors, can activate immune cell proliferation and differentiation, and enhance the body's ability to clear pathogens; TNF-β participates in the regulation of immune cell activity and inflammatory reaction intensity, and is an important medium for anti-infection immunity; IL-1Ra can specifically inhibit the pro-inflammatory effect of the IL-1 family, and maintain the immune balance of the body; IL-10, as the main anti-inflammatory cytokine, can regulate the intensity of immune response and avoid excessive inflammation damage to the body. Studies have shown that changes in the serum levels of these cytokines can directly reflect the immune state and disease resistance of the body.
[0004] The development of molecular marker technology provides an efficient means for disease resistance breeding of Tibetan sheep. By screening SNP sites associated with disease resistance traits, early and accurate selection can be realized, and breeding efficiency and accuracy can be improved. For this unique breed of Tibetan sheep, the functional SNP sites in the above-mentioned cytokine genes have not been clearly defined, and there is also a lack of systematic correlation analysis data between these sites and the disease resistance traits of Tibetan sheep. SUMMARY
[0005] Therefore, the purpose of the present application is to provide SNP markers affecting the disease resistance traits of Tibetan sheep and application thereof.
[0006] This invention provides the application of a reagent for detecting SNP molecular markers associated with disease resistance in Tibetan sheep in the preparation of a kit for in vitro detection of disease resistance in Tibetan sheep. The SNP molecular marker is located at 190,163,785 bases on chromosome 1 of the International Sheep Reference Genome Oar_v4.0. The base variation type at this location is T / G. Tibetan sheep individuals with genotype GG have significantly lower levels of IL-1α, IL-1β, TNF-β, and IL-1Ra than individuals with genotypes TT or TG, while Tibetan sheep individuals with genotype GG have significantly higher levels of IL-10 than individuals with genotypes TT or TG.
[0007] Preferably, the reagent for detecting SNP molecular markers related to disease resistance traits in Tibetan sheep includes amplification primers, the nucleotide sequences of which are shown in SEQ ID No. 2 and SEQ ID No. 3.
[0008] Preferably, the reagents for detecting SNP molecular markers related to disease resistance traits in Tibetan sheep also include PCR reaction reagents.
[0009] This invention provides the application of reagents for detecting SNP molecular markers associated with disease resistance traits in Tibetan sheep in the non-diagnostic selection of disease resistance trait markers in Tibetan sheep, wherein the SNP molecular markers are those used in this application.
[0010] This invention provides the application of a reagent for detecting SNP molecular markers associated with disease resistance traits in Tibetan sheep in the assisted breeding of disease resistance traits in Tibetan sheep, wherein the SNP molecular markers are those used in this application.
[0011] This invention provides a method for marker-assisted selection of disease resistance traits in Tibetan sheep for non-diagnostic purposes, comprising the following steps: 1) Extracting genomic DNA from Tibetan sheep; 2) Using the Tibetan sheep genomic DNA as a template, PCR amplification was performed using the primers shown in SEQ ID No. 2 and SEQ ID No. 3 to obtain the amplification products; 3) Genotyping the amplification products obtained in step 2) yields Tibetan sheep with different genotypes; the genotypes of Tibetan sheep are then correlated with disease resistance indicators. The primers are used to amplify SNP molecular markers, and the nucleotide sequence of the amplification product is shown in SEQ ID No. 1. The genotype is determined based on whether the 147th base is T or G.
[0012] Preferably, the disease resistance indicators include IL-1α, IL-1β, TNF-β, IL-1Ra and IL-10; the levels of IL-1α, IL-1β, TNF-β and IL-1Ra in Tibetan sheep individuals with genotype GG are significantly lower than those with genotype TT or TG, while the level of IL-10 in Tibetan sheep individuals with genotype GG is significantly higher than that in individuals with genotype TT or TG.
[0013] Compared with the prior art, the present invention has the following beneficial effects: The SNP molecular marker described in this invention is located at the 190,163,785th base on chromosome 1 of the Oar_v4.0 version of the International Sheep Reference Genome. The variant type is T / G, named g190163785T>G, and there are three genotypes. When the 190,163,785th base on chromosome 1 is T, the genotype is TT or TG; when the 190,163,785th base on chromosome 1 is G, the genotype is GG. Through association analysis between different genotypes and the levels of IL-1α, IL-1β, TNF-β, IL-1Ra, and IL-10, it was found that Tibetan sheep individuals with the GG genotype had significantly lower levels of IL-1α, IL-1β, TNF-β, and IL-1Ra than those with the TT and TG genotypes (p<0.05), while Tibetan sheep individuals with the GG genotype had significantly higher levels of IL-10 than those with the TT and TG genotypes (p<0.05). This invention demonstrates that the base at the g190163785T>G SNP site on Tibetan sheep chromosome 1 is a SNP marker related to IL-1α, IL-1β, TNF-β, IL-1Ra, and IL-10 in Tibetan sheep. By detecting the base at the 190163785th nucleotide site on Tibetan sheep chromosome 1, the levels of IL-1α, IL-1β, TNF-β, IL-1Ra, and IL-10 in an individual Tibetan sheep can be determined. This invention provides a new SNP molecular marker resource for the selection of immune trait markers in Tibetan sheep for non-diagnostic purposes. Attached Figure Description
[0014] Figure 1 The agarose gel electrophoresis results of the amplified product of the g190163785T>G SNP site on chromosome 1 of Tibetan sheep. Figure 2 The peak diagram and sequence are obtained after purification and sequencing of the amplified product. Detailed Implementation
[0015] This invention provides the application of a reagent for detecting SNP molecular markers associated with disease resistance in Tibetan sheep in the preparation of a kit for in vitro detection of disease resistance in Tibetan sheep. The SNP molecular marker is located at 190,163,785 bases on chromosome 1 of the International Sheep Reference Genome Oar_v4.0. The base variation type at this location is T / G. Tibetan sheep individuals with genotype GG have significantly lower levels of IL-1α, IL-1β, TNF-β, and IL-1Ra than individuals with genotypes TT or TG, while Tibetan sheep individuals with genotype GG have significantly higher levels of IL-10 than individuals with genotypes TT or TG.
[0016] In this invention, the reagent for detecting SNP molecular markers related to disease resistance traits in Tibetan sheep includes amplification primers, the nucleotide sequences of which are shown in SEQ ID No. 2 and SEQ ID No. 3, and the specific sequences are as follows: F: 5'-ATGGCAATTCTCTCCGGTG-3' (SEQ ID No. 2); R: 5'-CCAGCTTCCTCTATAATCCAC-3' (SEQ ID No. 3).
[0017] In this invention, the reagent for detecting SNP molecular markers related to disease resistance traits in Tibetan sheep also includes PCR reaction reagents. This invention does not have a specific limitation on the type of PCR reaction reagents, and commercially available PCR reaction reagents in the field can be used. In the specific implementation of this invention, the PCR reaction reagents preferably used are Gold Mix (green).
[0018] This invention provides the application of reagents for detecting SNP molecular markers associated with disease resistance traits in Tibetan sheep in the non-diagnostic selection of disease resistance trait markers in Tibetan sheep, wherein the SNP molecular markers are those used in this application.
[0019] This invention provides the application of a reagent for detecting SNP molecular markers associated with disease resistance traits in Tibetan sheep in the assisted breeding of disease resistance traits in Tibetan sheep, wherein the SNP molecular markers are those used in this application.
[0020] This invention provides a method for marker-assisted selection of disease resistance traits in Tibetan sheep for non-diagnostic purposes, comprising the following steps: 1) Extracting genomic DNA from Tibetan sheep; 2) Using the Tibetan sheep genomic DNA as a template, PCR amplification was performed using the primers shown in SEQ ID No. 2 and SEQ ID No. 3 to obtain the amplification products; 3) Genotyping the amplification products obtained in step 2) yields Tibetan sheep with different genotypes; the genotypes of Tibetan sheep are then correlated with disease resistance indicators. The primers are used to amplify SNP molecular markers, and the nucleotide sequence of the amplification product is shown in SEQ ID No. 1. The genotype is determined based on whether the 147th base is T or G.
[0021] In this invention, Tibetan sheep genomic DNA is first extracted; preferably, Tibetan sheep blood genomic DNA is extracted, and a blood genomic DNA extraction kit is used in this invention.
[0022] After obtaining the Tibetan sheep genomic DNA, the present invention uses the Tibetan sheep genomic DNA as a template and performs PCR amplification using the primers shown in SEQ ID No. 2 and SEQ ID No. 3 to obtain the amplification product.
[0023] The PCR amplification system, in 25 μL units, includes the following components: 22 μL of Gold Mix (green), 1 μL each of upstream and downstream primers, and 1 μL of template (Tibetan sheep genomic DNA).
[0024] The preferred PCR amplification program is as follows: 98℃ for 2 min; 98℃ for 10 s, 56℃ for 10 s, 72℃ for 10 s, for a total of 40 cycles; extension at 72℃ for 2 min.
[0025] After obtaining the amplification product, the present invention preferably performs electrophoresis detection, and after passing the detection, sequencing is performed; the nucleotide sequence of the amplified product is shown in SEQ ID No. 1, and the SNP marker is located at position 147 of the nucleotide sequence shown in SEQ ID No. 1, as follows: ATGGCAATTCTCTCCGGTGTTCTTGCCTGGGAAATCACATAGAGAGGAGCCTGGCGGGCTACAGTCCACAGGGTCACAAAGAGTCAGGCATGACCGAGTGACTAAACAACAGCCATCACCTGATTTACCATATTCTTAAGAATA T TGGGATTTTCAAAGTTCACACAAGAAGGAAAACAAGCAAACCAACATTAGCCCCTGCCTCCTCCTGTAGGTGGATTATAGAGGAAGCTGG.
[0026] In this invention, the preferred method is to use the bioanalysis software MEGA 6.0 to compare the sequencing results of PCR amplification products, analyze the sequencing peak diagram, and complete the genotyping.
[0027] In this invention, the genotype of Tibetan sheep is correlated with disease resistance indicators. Preferably, the number of individuals with different genotypes is counted based on the genotyping results. The correlation between different genotypes of Tibetan sheep and disease resistance indicators is analyzed using a general linear model in IBM SPSS Statistics 22 software. In this invention, the disease resistance indicators include IL-1α, IL-1β, TNF-β, IL-1Ra, and IL-10. Tibetan sheep individuals with genotype GG have significantly lower levels of IL-1α, IL-1β, TNF-β, and IL-1Ra than those with genotypes TT or TG, while Tibetan sheep individuals with genotype GG have significantly higher levels of IL-10 than those with genotypes TT or TG.
[0028] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0029] The main reagents and instruments used in the examples are as follows: EDTA-K2 vacuum blood collection tubes were purchased from Jiangsu Yuli Medical Instrument Co., Ltd.; the blood genomics extraction kit was purchased from Tiangen Biotech (Beijing) Co., Ltd.; the NanoDrop2000 spectrophotometer was purchased from Thermo Fisher Scientific, USA; DL1000 markers, agarose, and nucleic acid dyes were purchased from Beijing Solarbio Science & Technology Co., Ltd.; the gold-labeled mix (green) was purchased from Beijing Qingke Biotechnology Co., Ltd.; the electrophoresis apparatus was purchased from Beijing Liuyi Instrument Factory; and the PCR instrument was purchased from BioRad. The IL-1α, IL-1β, TNF-β, IL-1Ra, and IL-10 detection kits were purchased from Nanjing Jiancheng Bioengineering Institute.
[0030] Example 1
[0031] 1) Sample collection
[0032] The samples were collected from Tibetan sheep populations under natural grazing conditions, including 77 samples from Gannan Tibetan Autonomous Prefecture in Gansu Province, 44 samples from Yushu Tibetan Autonomous Prefecture in Qinghai Province, and 45 samples from Shigatse City in Tibet Autonomous Region. 5 mL of blood samples were collected from 166 fasting Tibetan sheep in clean, anticoagulant vacuum blood collection tubes. The tubes were allowed to stand for 30 min, then centrifuged at 3500 rpm for 15 min. The supernatant was transferred to clean PE tubes, sealed, and stored at -20°C as serum samples for the detection of pro-inflammatory and anti-inflammatory factors. Separately, 5 mL of blood samples were collected in blood collection tubes containing EDTA-K2 anticoagulant. After collection, the samples were quickly mixed, placed in a sampling box with ice packs for temporary storage, and then frozen at -20°C upon return to the laboratory for DNA extraction.
[0033] 2) Extraction of genomic DNA from blood
[0034] Genomic DNA was extracted from the blood sample collected in step 1) using the blood genomic extraction kit from Tiangen Biotech (Beijing) Co., Ltd. The concentration and purity of the extracted DNA were detected by ultraviolet spectrophotometer. The concentration was >20ng / μL and the OD260 / OD280 was between 1.7 and 1.9, which met the experimental requirements. The DNA was stored at -20℃ for later use.
[0035] 3) Primer design
[0036] Based on the gene sequence of chromosome 1 in the Oar_v4.0 version of the international sheep genome (GenBank accession number: NC_019458.2), a pair of specific primers containing the g190163785T>G SNP site was designed using Primer Premier 5.0 software.
[0037] Primer sequences: F: 5'-ATGGCAATTCTCTCCGGTG -3'; R: 5'-CCAGCTTCCTCTATAATCCAC-3'.
[0038] The amplified fragment was 237 bp in length, and the primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.
[0039] 4) PCR amplification and sequencing
[0040] PCR amplification system 25μL: Gold Mix (green) 22μL, forward and reverse primers 1μL each, genomic DNA 1μL.
[0041] PCR amplification program: 98℃ for 2 min; 98℃ for 10 s, 56℃ for 10 s, 72℃ for 10 s, for a total of 40 cycles; extension at 72℃ for 2 min.
[0042] The amplification products of the g190163785T>G SNP site on chromosome 1 of Tibetan sheep were detected using 1.5% agarose gel electrophoresis (e.g., Figure 1 As shown in the figure, the bands are clear and free of impurities, indicating good specificity. The PCR product fragment size is 237 bp, which is in line with the expected size, and the next step of the experiment can be carried out.
[0043] Sequencing was performed using direct sequencing, and the sequencing was completed by Beijing Qingke Biotechnology Co., Ltd.
[0044] The nucleotide sequence of the amplification product is shown in SEQ ID No. 1, and the SNP marker is located at position 147 of the nucleotide sequence shown in SEQ ID No. 1: ATGGCAATTCTCTCCGGTGTTCTTGCCTGGGAAATCACATAGAGAGGAGCCTGGCGGGCTACAGTCCACAGGGTCACAAAGAGTCAGGCATGACCGAGTGACTAAACAACAGCCATCACCTGATTTACCATATTCTTAAGAATA T TGGGATTTTCAAAGTTCACACAAGAAGGAAAACAAGCAAACCAACATTAGCCCCTGCCTCCTCCTGTAGGTGGATTATAGAGGAAGCTGG.
[0045] The sequencing results of PCR products were compared using the bioanalysis software MEGA 6.0, and the sequencing peak patterns were analyzed to complete the genotyping. The peak patterns and sequences obtained after purification and sequencing of the PCR products are shown below. Figure 2 As shown. By Figure 2 It can be seen that the TG mutation occurs at the g190163785T>GSNP site, resulting in three genotypes: TT, TG, and GG.
[0046] 5) Statistical analysis results
[0047] Genotype and allele frequencies of the g190163785T>G SNP locus on chromosome 1 of Tibetan sheep were analyzed from a population genetics perspective. As shown in Table 1, the GG genotype had the highest frequency at the g190163785T>G SNP locus, indicating it was the dominant genotype, while the G allele frequency was 82.2%, also representing the dominant allele. The χ² fitness test showed that the SNP locus significantly deviated from Hardy-Weinberg equilibrium (P<0.05) (Table 1). The expected heterozygosity of this locus was 0.292, and the PIC was 0.250, indicating moderate polymorphism.
[0048] Table 1. Polymorphism of the g190163785T>G SNP site on chromosome 1 of Tibetan sheep
[0049] 6) Association analysis between different genotypes and IL-1α, IL-1β, TNF-β, IL-1Ra, and IL-10
[0050] The levels of IL-1α, IL-1β, TNF-β, IL-1Ra, and IL-10 in the blood of Tibetan sheep individuals with different genotypes were detected using an IL-1α, IL-1β, TNF-β, IL-1Ra, and IL-10 detection kit. The specific steps are as follows: The assay was performed using the enzyme-linked immunosorbent assay (ELISA) method according to the test kit from Nanjing Jiancheng Biotechnology Research Institute. The assay steps were as follows: (1) The standard was serially diluted according to the instructions; (2) 100 μL of antibody was added to each well and coated for 2 hours, then the liquid was discarded and the sample was dried; (3) 300 μL of diluted washing buffer was added to each well, the mixture was shaken for 30 seconds, then the washing buffer was discarded and the sample was patted dry with absorbent paper. This was repeated 5 times; (4) 200 μL of blocking buffer was added to each well, the mixture was gently shaken and mixed, then the mixture was allowed to stand at room temperature for 30 minutes, then the liquid was discarded and the sample was dried; (5) 300 μL of diluted washing buffer was added to each well, the mixture was shaken for 30 seconds, then the washing buffer was discarded and the sample was patted dry with absorbent paper. This was repeated 5 times; (6) 25 μL of coating buffer, 25 μL of serum sample and 50 μL of standard were added to each well and the mixture was gently shaken and mixed. 7) Add 100 μL of HRP to each well, shake gently to mix, let stand at room temperature for 60 min, then discard the liquid and spin dry; (8) Add 300 μL of diluted washing solution to each well, shake for 30 s, then discard the washing solution and pat dry with absorbent paper, repeat 5 times; (9) Add 100 μL of color developing solution to each well, shake gently to mix, and develop color for 15 min; (10) Add 100 μL of stop solution to each well to stop the reaction (at this time, the blue color immediately turns yellow); (11) Zero the blank well and measure the OD value of each well at a wavelength of 450 nm; (12) Make a standard curve using the OD value of the standard and obtain the curve formula, then substitute the OD measured by the sample test tube into the calculation formula to obtain the result.
[0051] The association between different genotypes of Tibetan sheep and the levels of IL-1α, IL-1β, TNF-β, IL-1Ra, and IL-10 was analyzed using a general linear model in IBM SPSS Statistics 22 software. The results showed that Tibetan sheep with the GG genotype had significantly lower levels of IL-1α, IL-1β, TNF-β, and IL-1Ra than those with the TT and TG genotypes (p<0.05), while Tibetan sheep with the GG genotype had significantly higher levels of IL-10 than those with the TT and TG genotypes (p<0.05). This indicates that the base at the g190163785T>G SNP site on chromosome 1 of Tibetan sheep is a SNP marker associated with IL-1α, IL-1β, TNF-β, IL-1Ra, and IL-10. The results are shown in Table 2.
[0052] Table 2. Correlation analysis between different genotypes and the relative levels (concentrations) of IL-1α, IL-1β, TNF-β, IL-1Ra, and IL-10.
[0053] Note: Different lowercase letters in the intercalation of data in the same row indicate significant differences (P < 0.05).
[0054] As demonstrated by the above embodiments, the different genotypes of the SNP molecular marker loci provided by this invention are significantly correlated with the levels of IL-1α, IL-1β, TNF-β, IL-1Ra, and IL-10. Tibetan sheep individuals with the GG genotype had significantly lower levels of IL-1α, IL-1β, TNF-β, and IL-1Ra than those with the TT and TG genotypes (p<0.05), while Tibetan sheep individuals with the GG genotype had significantly higher levels of IL-10 than those with the TT and TG genotypes (p<0.05). This indicates that by detecting the genotype of this SNP locus in Tibetan sheep, the levels of IL-1α, IL-1β, TNF-β, IL-1Ra, and IL-10 in individual Tibetan sheep can be determined, providing a new SNP molecular marker resource for the selection of immune trait markers in Tibetan sheep for non-diagnostic purposes.
[0055] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. The use of a reagent for detecting a SNP molecular marker related to the disease resistance trait of Tibetan sheep in the preparation of a kit for detecting the disease resistance trait of Tibetan sheep in vitro, characterized in that, The SNP molecular marker is located at base 190163785 on chromosome 1 of the international sheep reference genome Oar_v4.0 version; the base variation type at this position is T / G, the IL-1α, IL-1β, TNF-β, IL-1Ra of the Tibetan sheep individual with genotype GG are significantly lower than those of the individual with genotype TT or TG, and the IL-10 of the Tibetan sheep individual with genotype GG is significantly higher than that of the individual with genotype TT or TG.
2. Use according to claim 1, characterized in that, The reagent for detecting the SNP molecular marker related to the disease resistance trait of Tibetan sheep comprises amplification primers, and the nucleotide sequences of the amplification primers are shown in SEQ ID No. 2 and SEQ ID No.
3.
3. Use according to claim 1, characterized in that, The reagent for detecting the SNP molecular marker related to the disease resistance trait of Tibetan sheep further comprises a PCR reaction reagent.
4. Use of the reagent for detecting the SNP molecular marker associated with the disease resistance trait of Tibetan sheep in marker-assisted selection of the disease resistance trait of Tibetan sheep for non-diagnostic purposes, characterized in that, The SNP molecular marker is the SNP molecular marker in the application of claim 1.
5. The use of the reagent for detecting the SNP molecular marker related to the disease resistance traits of Tibetan sheep in the assisted breeding of the disease resistance traits of Tibetan sheep, characterized in that, The SNP molecular marker is the SNP molecular marker in the application of claim 1.
6. A method for marker assisted selection of disease resistance traits in Tibetan sheep for non-diagnostic purposes, characterized in that, The method comprises the following steps: 1) extracting the genomic DNA of Tibetan sheep; 2) using the genomic DNA of Tibetan sheep as a template, performing PCR amplification on the primers shown in SEQ ID No. 2 and SEQ ID No. 3 to obtain an amplification product; 3) performing genotype typing on the amplification product obtained in step 2) to obtain Tibetan sheep with different genotypes, and correlating the genotype of the Tibetan sheep with a disease resistance index; The primer is used for amplifying the SNP molecular marker, the nucleotide sequence of the amplification product is shown in SEQ ID No. 1, and the genotype is determined based on whether the 147th base is T or G.
7. The method of claim 6, wherein, The disease resistance index comprises IL-1α, IL-1β, TNF-β, IL-1Ra and IL-10; the IL-1α, IL-1β, TNF-β, IL-1Ra of the Tibetan sheep individual with genotype GG are significantly lower than those of the individual with genotype TT or TG, and the IL-10 of the Tibetan sheep individual with genotype GG is significantly higher than that of the individual with genotype TT or TG.