Recombinant adeno-associated virus and packaging system and application thereof
By using recombinant adeno-associated virus carrying the GTPBP3 gene to target and infect heart and muscle tissue, the treatment challenge of mitochondrial diseases has been solved, and effective correction of GTPBP3 point mutations and symptom improvement have been achieved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-11
- Publication Date
- 2026-03-13
AI Technical Summary
Currently, there is a lack of effective treatments for mitochondrial diseases caused by pathogenic point mutations in taurine-modifying enzymes on human mitochondrial tRNA, and existing treatments such as oral taurine are not very effective.
Using recombinant adeno-associated virus (rAAV) as a vector, carrying the expression cassette of the GTPBP3 gene, the drug was prepared through a three-plasmid packaging system to target and infect heart and muscle tissues, correcting mitochondrial diseases caused by GTPBP3 point mutations.
It effectively corrected mitochondrial diseases caused by GTPBP3 point mutations, improved related symptoms such as chronic progressive extraocular muscle palsy and Kearns-Sayre syndrome, and provided a theoretical basis and method for gene therapy.
Smart Images

Figure CN121653079A_ABST
Abstract
Description
Technical Field
[0001] This application relates to the field of biomedical technology, and in particular to a recombinant adeno-associated virus and its packaging system and applications. Background Technology
[0002] 2-Aminoethanesulfonic acid, also known as taurine, is one of the most abundant amino acids in mammals. It plays multiple roles, including regulating calcium ion flow, nerve excitability, and cell proliferation. In 2002, research found that taurine participates in the synthesis of tRNA at position 34 (τm). 5 U and τm 5 s 2 Modification of U (Suzuki et al., 2002). Previous studies have shown that GTPBP3 and MTO1 jointly govern τm. 5 The synthesis of U-modified GTPBP3 / MTO1 complex using taurine, 5,10-CH2-THF (tetrahydrofuran), flavin adenine dinucleotide (FAD), nicotinamide adenine dinucleotide (NAD, coenzyme I), and GTP as substrates to synthesize τm 5 U-modification occurs, but the specific reaction process of this modification remains unclear (Asano et al., 2018). MTU1, on the other hand, independently catalyzes s... 2 U modification replaces the second oxygen atom at position 34 of uridine in mitochondrial tRNA with a sulfur atom. This modification is related to τm 5 The catalytic process of U-modification has no before-and-after distinction; both together form τm. 5 s 2 Taurine modification (Numata et al., 2006; Sasarman et al., 2011). Currently, five mitochondrial tRNAs (hmtRNAs) with taurine modification have been identified in humans, among which hmtRNAs... Leu (UUR) and hmtRNA Trp The 34th bit is τm 5 U modification, while in hmtRNA Lys hmtRNA Glu hmtRNA Gln The 34th bit is τm 5 s 2 U modification (Asano et al., 2018). In E. coli, τm 5 The modification corresponding to U is 5-carboxymethylaminomethyluracil (cmnm) 5U), the corresponding modifying enzymes are MnmE and MnmG (Yim et al., 2006). They form a heterotetrameric α2β2 complex in *E. coli* (Meyer et al., 2008), using glycine (Gly) instead of taurine, and co-synthesizing cmnm with 5,10-CH2-THF (tetrahydrofuran), flavin adenine dinucleotide (FAD), nicotinamide adenine dinucleotide (NAD, coenzyme I), and GTP as substrates. 5 U modification (Fislage et al., 2014; Moukadiri et al., 2009).
[0003] Human mitochondrial GTPBP3 is a mitochondrial tRNA with GTPase catalytic activity, consisting of 492 amino acid residues and a molecular weight of 52 kDa. 5 U-modifying enzyme. It is encoded by a nuclear gene and translated in the cytoplasm. Because it needs to enter the mitochondria to perform its biological functions, its N-terminal first 20 amino acids form the mitochondrial targeting sequence (MTS). Human mitochondrial GTPBP3 is relatively conserved during evolution, but its structure has not yet been determined. In 2005, a research group solved the crystal structure of MnmE, a homolog of GTPBP3 in *Thermophyton floccosum* (PDB: 1XZP), finding that MnmE has an N-terminal domain, a central helical domain, and a G-domain (Scrima et al., 2005). In 2006, another research group solved the crystal structure of the G-domain of *E. coli* MnmE (PDB: 2GJ8), finding that the G-domain of MnmE requires GTP and Mg2+. 2+ K + GTPase catalytic function requires the participation of molecules such as AlF4 to form a dimer structure. (Scrima and Wittinghofer, 2006) Sequence alignment with MnmE from species such as Thermocysteine and Escherichia coli revealed that human GTPBP3 has three domains: an N-terminal domain, a G domain, and a helical domain. The N-terminal domain is responsible for protein dimerization and binding to 5,10-CH2-THF; the G domain has GTPase activity and mainly performs catalytic function; while the helical domain may be related to the interaction with MTO1. Therefore, pathogenic point mutations in modifying enzymes leading to loss or decrease in modifying activity can also induce mitochondrial diseases.
[0004] Based on existing clinical samples and whole-exome sequencing of patients and their families, 19 pathogenic point mutations in GTPBP3 have been identified in 15 cases, leading to Combined Oxidative Phosphorylation Deficiency 23 (COXPD23), an autosomal recessive genetic disorder characterized by childhood lactic acidosis, hypertrophic cardiomyopathy, and encephalopathy (Erdemir et al., 2018; Yan et al., 2021). Furthermore, 21 pathogenic point mutations in MTO1 have been found to inactivate mitochondrial oxidative phosphorylation complex enzymes, causing lactic acidosis and hypertrophic cardiomyopathy (Li, 2003; Tischner et al., 2015). Additionally, pathogenic point mutations in MTU1 can cause τm 5 s 2 U on s 2 Ureaplasma gondii deficiency, which clinically causes reversible infantile liver failure (RILF) (He et al., 2021; Larsson et al., 2016; Zeharia et al., 2009).
[0005] Currently, there are no effective targeted drugs or methods to treat mitochondrial diseases caused by pathogenic point mutations in human mitochondrial tRNA, such as the loss of taurine modification and related modifying enzymes. Treatment is limited to conventional methods for addressing specific clinical symptoms. For example, hearing loss caused by MALES disease can be restored through cochlear implantation, and epilepsy symptoms can be treated with traditional antiepileptic drugs (Brambilla et al., 2019). In clinical practice, supplementary drugs, including antioxidants and some cofactors, have been used to treat MALES disease. For instance, arginine, coenzyme Q, and creatine have shown some therapeutic effects (Finsterer and Zarrouk-Mahjoub, 2017). The treatment strategy for MERRF disease is similar to that for MALES disease (Finsterer, 2019). Studies have also shown that oral taurine intake can significantly reduce stroke-like attacks and increase the taurine modification level at position 34 of human mitochondrial tRNA in patients with MALES disease. This treatment method has entered phase III clinical trials (Ohsawa et al., 2019). However, the efficacy of oral taurine for mitochondrial diseases caused by pathogenic point mutations in modifying enzymes is not ideal. Therefore, effective treatments for mitochondrial diseases are urgently needed. Summary of the Invention
[0006] Based on this, one or more embodiments of this application provide a recombinant adeno-associated virus and its packaging system, as well as its applications. The technical solutions include the following:
[0007] One or more embodiments of this application provide a recombinant adeno-associated virus, wherein the genome of the recombinant adeno-associated virus has an expression cassette of the GTPBP3 gene inserted.
[0008] In some embodiments of this application, the serotype of the recombinant adeno-associated virus includes type 9.
[0009] In some embodiments of this application, the promoter in the expression box includes a CMV promoter; optionally, the expression box further includes an enhancer; more optionally, the enhancer includes a CMV enhancer.
[0010] One or more embodiments of this application provide a packaging system for the recombinant adeno-associated virus.
[0011] In some embodiments of this application, the packaging cells include a three-plasmid packaging system. The three-plasmid packaging system includes a shuttle plasmid, a pAAV-RC plasmid, and a pHelper plasmid, wherein the shuttle plasmid is inserted into the expression cassette.
[0012] One or more embodiments of this application provide the use of the recombinant adeno-associated virus and / or the packaging system described herein in the preparation of a medicament for treating mitochondrial diseases caused by GTPBP3 point mutations.
[0013] In some embodiments of this application, the mitochondrial disease treated with the drug is mainly caused by the following point mutation in GTPBP3 with uniprot number Q969Y2:
[0014] N374D; or,
[0015] N374D and other GTPBP3 point mutations.
[0016] In some embodiments of this application, the other GTPBP3 point mutations include a mutation at position 230 from glutamine to proline; alternatively, the other GTPBP3 point mutations include Q230P.
[0017] In some embodiments of this application, the drug comprises the recombinant adeno-associated virus and / or the packaging system, as well as pharmaceutically acceptable excipients.
[0018] In some embodiments of this application, the mitochondrial diseases for which the drug treatment is indicated are chronic progressive extraocular muscle palsy, Kearns-Sayre syndrome, mitochondrial encephalomyopathy with hyperlactatemia and stroke-like episodes, Leigh syndrome, myoclonic epilepsy with broken red fibers, simple mitochondrial myopathy, lactic acidosis, hyperglycemia, hyperammonemia, fatty acid oxidation disorders, organic acidemia, or heart disease (e.g., hypertrophic cardiomyopathy).
[0019] Details of one or more embodiments of this application are set forth in the following description, and other features, objects, and advantages of this application will become apparent from the specification and its claims. Attached Figure Description
[0020] To more clearly illustrate the technical solutions in the embodiments of this application and to more completely understand this application and its beneficial effects, the drawings used in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0021] Figure 1 A map of adeno-associated virus shuttle plasmids;
[0022] Figure 2 The following data pertain to the construction and phenotype of the Gtpbp3 mouse model: A. Construction of the Gtpbp3 mouse model; B. Photographs of adult mice; C. Mouse weight monitoring; D. Mouse survival curves; E. Mouse heart photographs; F. Mouse heart-to-body weight ratio; G. Mouse echocardiography; H. Ejection fraction of the model mouse; I. Short-axis contractile rate of the model mouse; J. Stroke volume of the model mouse; K. End-diastolic diameter of the left ventricle in the model mouse; L. End-systolic diameter of the left ventricle in the model mouse; M. Metabolic cage assay of the model mouse.
[0023] Figure 3 To investigate the impaired synthesis of mitochondrial oxidative phosphorylation proteins in Gtpbp3 model mice, the following methods were employed: A. Detecting mitochondrial tRNA homeostasis in model mice; B. Detecting the nuclear gene encoding the oxidative phosphorylation complex subunit in model mice; C. Detecting the mitochondrial gene encoding the oxidative phosphorylation complex subunit in model mice; D. Detecting the oxidative phosphorylation complex homeostasis in heart and muscle mitochondria; E. Detecting the activities of oxidative phosphorylation complex I and IV enzymes in heart and muscle mitochondria.
[0024] Figure 4The following images show the morphological damage of mitochondria in the heart and muscle of Gtpbp3 model mice: A. Transmission electron micrograph of mouse heart mitochondria; B. Area distribution of mitochondria in the heart of model mice; C. Abnormal ratio of mitochondria in the heart of model mice; D. Transmission electron micrograph of mouse muscle mitochondria; E. Area distribution of mitochondria in the muscle of model mice; F. Abnormal ratio of mitochondria in the muscle of model mice.
[0025] Figure 5 A. Cardiac functional phenotype of E / N mice to be restored by adeno-associated virus (AAV); Schematic diagram of AAV infection in AE / N model mice; B. Cardiac morphology of E / N mice after viral infection; C. Masson staining of the heart of mice after viral infection; D. Quantification results of myocardial fibrosis in Masson stained tissue; E. Detection of heart-to-body weight ratio in mice after viral infection; F. Echocardiographic analysis of left ventricle in virus-infected mice; G. Ejection fraction of mouse heart; H. Short-axis contractile rate of mouse heart; I. Stroke volume of mouse heart; J. End-systolic left ventricular diameter of mouse heart; K. Continuous ultrasound analysis of cardiac function indicators such as end-diastolic left ventricular diameter of mouse heart;
[0026] Figure 6 To reconstruct the mitochondrial functional phenotype of skeletal muscle in E / N mice after adeno-associated virus (AAV) infection; A. Western blot detection of oxidative phosphorylation complex (OPC) protein in E / N mice after AAV infection; B. Detection of OPC homeostasis in cardiac and muscle mitochondria; C. Detection of OPC I and IV enzyme activities in cardiac and muscle mitochondria; D. Transmission electron micrographs of cardiac mitochondria in E / N mice after AAV infection; E. Mitochondrial area distribution in the heart of model mice after AAV infection; F. Abnormal mitochondrial ratio in the heart of model mice after AAV infection; G. Transmission electron micrographs of muscle mitochondria in E / N mice after AAV infection; H. Mitochondrial area distribution in the muscle of model mice after AAV infection; I. Abnormal mitochondrial ratio in the muscle of model mice after AAV infection. Detailed Implementation
[0027] The present application will be further described in detail below with reference to the accompanying drawings, embodiments, and examples. It should be understood that these embodiments and examples are for illustrative purposes only and are not intended to limit the scope of the present application. The purpose of providing these embodiments and examples is to enable a more thorough and comprehensive understanding of the disclosure of the present application. It should also be understood that the present application can be implemented in many different forms and is not limited to the embodiments and examples described herein. Those skilled in the art can make various modifications or alterations without departing from the spirit of the present application, and the equivalent forms obtained also fall within the protection scope of the present application. Furthermore, numerous specific details are set forth in the following description to provide a fuller understanding of the present application. It should be understood that the present application can be implemented without one or more of these details.
[0028] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used herein in the specification of this application is for descriptive purposes only and is not intended to be limiting of the application.
[0029] the term
[0030] Unless otherwise stated or in case of contradiction, the terms or phrases used herein shall have the following meanings:
[0031] The terms "and / or," "or / and," and "and / or" as used herein include any one of two or more of the related listed items, as well as any and all combinations of the related listed items. These arbitrary and all combinations include any two related listed items, any more related listed items, or a combination of all related listed items. It should be noted that when at least three items are connected by at least two conjunctions selected from "and / or," "or / and," and "and / or," it should be understood that in this application, the technical solution undoubtedly includes technical solutions connected by "logical AND," and also undoubtedly includes technical solutions connected by "logical OR." For example, "A and / or B" includes three parallel solutions: A, B, and A+B. For example, the technical solution of "A, and / or, B, and / or, C, and / or, D" includes any one of A, B, C, and D (that is, a technical solution that is connected by "logical OR"), as well as any and all combinations of A, B, C, and D, that is, combinations of any two or three of A, B, C, and D, and also combinations of all four of A, B, C, and D (that is, a technical solution that is connected by "logical AND").
[0032] In this application, the terms "multiple", "various", "multiple times", "multi-dimensional", etc., unless otherwise specified, refer to a quantity greater than or equal to 2. For example, "one or more" means one or more than or equal to two.
[0033] The terms “combinations of,” “any combination of,” and “any combination of” used in this article include all suitable combinations of any two or more of the listed items.
[0034] In this document, the term "suitable" as used in phrases such as "suitable combination," "suitable method," and "any suitable method" refers to the ability to implement the technical solution of this application, solve the technical problem of this application, and achieve the expected technical effect of this application.
[0035] In this document, terms such as “preferred,” “better,” “more suitable,” and “ideal” are merely used to describe implementation methods or examples that achieve better results, and should be understood not to limit the scope of protection of this application.
[0036] In this application, terms such as "further," "even further," and "particularly" are used to describe purposes and indicate differences in content, but should not be construed as limiting the scope of protection of this application.
[0037] In this application, "optionally," "optionally," and "optional" mean that something is optional, that is, it means that it is selected from either "with" or "without." If there are multiple "optional" entries in a technical solution, unless otherwise specified, and there are no contradictions or mutual constraints, each "optional" entry shall be independent.
[0038] In this application, the terms "first aspect," "second aspect," "third aspect," "fourth aspect," etc., are used for descriptive purposes only and should not be construed as indicating or implying relative importance or quantity, nor should they be construed as implicitly indicating the importance or quantity of the indicated technical features. Moreover, "first," "second," "third," "fourth," etc., serve only as a non-exhaustive enumeration and should be understood not to constitute a closed limitation on quantity.
[0039] In this application, the technical features described in an open-ended manner include both closed technical solutions consisting of the listed features and open technical solutions that include the listed features.
[0040] In this application, numerical intervals (i.e., numerical ranges) are involved. Unless otherwise specified, the selected numerical distributions within the aforementioned numerical intervals are considered continuous and include the two endpoints (i.e., the minimum and maximum values) of the numerical range, as well as every value between these two endpoints. Unless otherwise specified, when a numerical interval refers only to integers within that interval, it includes the two endpoint integers of the numerical range, as well as every integer between the two endpoints. In this document, this is equivalent to directly listing every integer. For example, if t is an integer selected from 1 to 10, it means that t is any integer selected from the group of integers consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10. Furthermore, when multiple ranges are provided to describe features or characteristics, these ranges can be merged. In other words, unless otherwise specified, the ranges disclosed herein should be understood to include any and all subranges to which they are included.
[0041] Unless otherwise specified, the temperature parameters in this application are permitted to be either constant-temperature treatment or variations within a certain temperature range. It should be understood that the constant-temperature treatment allows temperature fluctuations within the precision range of the instrument control, such as ±5℃, ±4℃, ±3℃, ±2℃, or ±1℃.
[0042] In this application, % (w / w) and wt% both represent weight percentage, % (v / v) refers to volume percentage, and % (w / v) refers to mass-volume percentage.
[0043] Human mitochondrial GTPBP3 (hmGTPBP3, uniport number: Q969Y2), in this application, "human GTPBP3" refers to "human mitochondrial GTPBP3". Human mitochondrial GTPBP3 is a mitochondrial tRNA with GTPase catalytic activity, composed of 492 amino acid residues and a molecular weight of 52 kDa. 5 U-modified enzymes.
[0044] This application constructed a mouse model corresponding to the patient's genotype, demonstrating that gene therapy can effectively treat mitochondrial diseases caused by defects in nuclear gene-encoded proteins, providing a theoretical basis and treatment plan for the subsequent clinical treatment of similar diseases.
[0045] A first aspect of this application provides a recombinant adeno-associated virus, wherein the genome of the recombinant adeno-associated virus has an expression cassette of the GTPBP3 gene inserted.
[0046] This application does not specifically limit the serotype of the recombinant adeno-associated virus (AAV), such as type 1, 2, 3, 4, 5, 6, 7, 8, and 9. Different serotypes have different tissue tropism and application characteristics, and the appropriate serotype can be selected according to the specific research purpose and target tissue. In one example, the recombinant AAV serotype includes type 9, which has a strong ability to cross the blood-brain barrier, can infect the nervous system, and can specifically infect the heart and muscle tissue.
[0047] This application does not specifically limit the expression frame, which may include a promoter, a target gene (GTPBP3 gene), and a terminator. The promoter may be a strong promoter, such as the EF1α promoter, CAG promoter, or UBC promoter. In some examples, the promoter in the expression frame is a CMV promoter. Optionally, the expression frame may also include an enhancer; further optionally, the enhancer may include a CMV enhancer. An expression frame including a CMV promoter and a CMV enhancer is shown below. Figure 1 It is displayed in the middle.
[0048] A second aspect of this application provides a packaging system for the recombinant adeno-associated virus.
[0049] This application does not specifically limit the packaging system, and it can be an auxiliary virus packaging system, a three-plasmid packaging system, an auxiliary virus-free packaging system, or a two-plasmid packaging system. In some examples, the packaging cells include a three-plasmid packaging system, which includes a shuttle plasmid, a pAAV-RC plasmid, and a pHelper plasmid, wherein the shuttle plasmid is inserted with the expression cassette.
[0050] A third aspect of this application provides the use of the recombinant adeno-associated virus and / or the packaging system in the preparation of a medicament for treating mitochondrial diseases caused by GTPBP3 point mutations.
[0051] In some examples, the mitochondrial disease treated by the drug is primarily caused by the following point mutation in GTPBP3 at uniprot number Q969Y2:
[0052] N374D; or,
[0053] N374D and other GTPBP3 point mutations.
[0054] Other GTPBP3 point mutations may include a mutation at position 230 to proline. For example, the newly discovered case in this application has hmGTPBP3-Q230P and hmGTPBP3-N374D (corresponding to c.1216A>G, mRNA coding region sequence number CCDS32951.1). It is understood that the specific point mutation may vary depending on the species; for example, it is E230P in mice and Q230P in humans.
[0055] It is understood that the mitochondrial diseases for which the drug is to be treated include, for example, chronic progressive extraocular muscle palsy, Kearns-Sayre syndrome, mitochondrial encephalomyopathy with hyperlactatemia and stroke-like episodes, Leigh syndrome, myoclonic epilepsy with broken red fibers, simple mitochondrial myopathy, lactic acidosis, hyperglycemia, hyperammonemia, fatty acid oxidation disorders, organic acidemia, and heart disease (e.g., hypertrophic cardiomyopathy).
[0056] It is understood that the drug includes the recombinant adeno-associated virus and / or the packaging system, as well as pharmaceutically acceptable excipients. This application does not specifically limit the type of excipients; appropriate types of excipients can be selected based on the clinically required dosage form and route of administration.
[0057] A fourth aspect of this application provides a method for preparing a treatment for mitochondrial diseases caused by GTPBP3 point mutations, comprising administering an effective dose of the drug as defined in the third aspect to a subject.
[0058] In this application, the "subject" of the drug is an animal, preferably a mammal, and more preferably a human. The subject includes, but is not limited to, patients with diseases, conditions, and / or symptoms. The subject in this application is preferably a mammal. The term "mammal" primarily refers to warm-blooded vertebrate mammals, including, but not limited to, cats, dogs, rabbits, bears, foxes, wolves, monkeys, deer, mice (such as rats and mice), pigs, cattle, sheep, horses, and humans, preferably primates, and more preferably humans.
[0059] An effective dose refers to the amount of drug required to treat the target disease or symptoms in a subject. This dose typically needs to strike a balance between effectiveness and safety. If the dose is too low, it may not produce an adequate therapeutic effect; while if the dose is too high, it may increase the risk of adverse reactions.
[0060] The embodiments of this application will be described in detail below with reference to examples. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of this application. For experimental methods in the following embodiments where specific conditions are not specified, please refer to the guidelines given in this application, or follow experimental manuals or conventional conditions in the art, or follow the conditions recommended by the manufacturer, or refer to experimental methods known in the art.
[0061] In the specific embodiments described below, the measurement parameters involving raw material components may have slight deviations within the weighing accuracy range unless otherwise specified. Temperature and time parameters are subject to acceptable deviations due to instrument testing accuracy or operational precision.
[0062] In this application, the inventors constructed mGtpbp3-E230P and -N374D heterozygous mice. Through self-crossing and hybridization, they obtained E230P homozygous and E230P / N374D compound heterozygous mice, respectively. These two genotypes of mice exhibited significantly shorter lifespans compared to wild-type C57 mice, accompanied by weight loss and hypertrophic cardiomyopathy. The mitochondrial protein expression, oxidative phosphorylation function, and mitochondrial morphology in the heart and muscle of the mutant mice were severely disrupted. By infecting the heart and muscle of E / N mutant mice with a safe, stable, and targeted recombinant adeno-associated virus (rAAV), mGtpbp3 was stably and highly expressed. The results showed that the protein and functional defects in the heart and muscle caused by the mGtpbp3 mutation could be effectively repaired. In summary, this research is the first to explore the feasibility of gene therapy for mitochondrial diseases caused by modifying enzyme defects, providing a theoretical basis and methodology for the clinical treatment of similar mitochondrial diseases.
[0063] This application involves the following:
[0064] 1. Method
[0065] 1.1 Mouse feeding and breeding
[0066] The experimental mice had a genetic background of C57BL / 6J. Mice were housed and bred in an SPF-grade animal facility, and experiments were conducted according to the regulations of the Center for Excellence in Molecular Cell Science, Chinese Academy of Sciences. The mice were housed in a constant temperature and humidity environment of 27°C, with a 12 / 12-hour light / dark cycle to simulate a natural environment. Newborn mice were genotyped using tail tissue at day 10 (P10) and separated into individual cages on day 21 (P21). Six-week-old mice were then separated into mating cages for breeding.
[0067] Heterozygous mice with whole-body knock-in of mGtpbp3-E230P and mGtpbp3-N374D were obtained from Cyagen Pharmaceuticals in China. Homozygous mGtpbp3-E230P mice (E / E) and compound heterozygous mice expressing both mGtpbp3-E230P and mGtpbp3-N374D (E / N) were obtained through self-crossing and hybridization. Early embryonic lethality was not possible with mGtpbp3-N374D homozygous mice (N / N). Related experiments were performed on E / E and E / N mice. All experiments used same-sex mice, with more than three mice in each group.
[0068] 1.2 Mouse cardiac ultrasound
[0069] Continuous echocardiographic monitoring of mice with different genotypes was performed starting from the 6th week after birth. The instrument used was a Visual Sonics Vevo 3100LT (Fujifilm), equipped with a 40MHz small animal ultrasound probe, which allows for echocardiography of mice under anesthesia. In M mode, the instrument can calculate data such as left ventricular ejection fraction, short-axis systolic rate, stroke volume, and left ventricular end-diastolic diameter from the obtained end-diastolic and end-systolic cardiac dimensions. The results were analyzed using Graphpad software.
[0070] 1.3 Recombinant adeno-associated virus infection in mice
[0071] The recombination adeno-associated virus (rAAV) was constructed by Hanheng Biotechnology. The serotype is 9 (targeting the heart and muscle). The virus highly expresses mGtpbp3 in mouse heart and muscle cells.
[0072] E / N hybrid heterozygous mice aged 4-6 weeks were injected with the virus. The viral titer was 1.3 × 10⁻⁶. 12 The dose was vg / mL, administered via tail vein injection or intramuscular injection. The tail vein injection volume was 100 μL, and the intramuscular injection volume was 30 μL. Mice were from the same litter or of the same age, and were injected with either a negative control or a virus that highly expressed mGtpbp3, with at least three mice injected with each virus. Cardiac function and protein expression levels were assessed four weeks after injection (Wang et al., 2020).
[0073] The rAAV packaging system is a 3-plasmid packaging system, which includes a shuttle plasmid (as shown in SEQ ID NO. 1) that can insert foreign genes. Figure 1The three plasmids—pAAV-RC, encoding the rep and cap protein genes, and pHelper, a substitute for the adenovirus that adeno-associated virus (AAV) depends on—are used to co-transfect AAV-293 cells, resulting in rAAV viral particles carrying the exogenous inserted genes. The cap gene encodes the viral capsid protein, and the rep gene is involved in viral replication and integration. AAV has multiple serotypes, each with varying affinities for different tissues, making it suitable for various in vivo infection experiments. Serotype 9 specifically infects heart and muscle tissues. Translation initiation of the exogenous genes relies on a mature, broad-spectrum CMV promoter.
[0074] SEQ ID NO.1:
[0075] atgtggcgtgggctgagcgccctggtgacccaggcggcgtgggcgcccctcaggctgtgcgcacgctgcagcaccagtgcagagtccttagt
[0076] ccccagcagcaccatcttcgcactcagctccggccagggacgctgcgccatcgcagtgatccgcaccagcggtccagctagcgggctcgcg
[0077] ctccgcagcctcacggcgctccaggagccgcctcctgcccgcagagcctgcctgcgccttctccgccacccgtgctccggggagccactgga
[0078] ccgctcactcgtcctctggttcccaggaccccagtttcacgggtgaggattgcgtggagtttcacgtacacggaggtcctgcggtggtcagc
[0079] ggtgtcttgcaggcattgggtagtgtgccaggactgcggccagccgaggccggagagttcaccaggagggcatttgcccatggcaagctgag
[0080] cctgactgaagtggagggactggcagatcttatccgtgcagaaactgaggcccagcgtcgacaggctctgaggcagctggatggggaactga
[0081] gccagctctgccagggctgggcaaagactctcaccaaggctctggcctatgtggaggcctacattgacttcggagaggatgataatttggaaga
[0082] gggtgtgttggagcaggcggacagagaagttcgagccctggaggtggcgctgggttcccacctgcgagatgctaggcgtggacaaaggctc
[0083] ctctcgggggcaaatgttgtggtcactggacctcccaatgcgggcaagagcagtctggtgaatctactcagccaaaagccagtgtccatcgtgt
[0084] ccccagagcctgggaccacccgtgacgtgctggagactcccgtggacttggctgggttccctgtcttgctgagcgacactgcagggctccggg
[0085] aaggcgtgggcgctgttgagcaggagggtgtgcgcagggcccgccacaggctggagcaggctgacatcattctgggggtgctggacgcctc
[0086] cgacctggcctcctcatccagctgcagcttcctggacactgtagtgaccccactgctagcacaaagccaagacagcggtgggcagcgcctcct
[0087] gctgctgctcaacaaatctgatctgctgtctgctaatgccccagcctgcgacatagccctgcctcctcacctgctcctgtcctgccacacgggagc
[0088] cgggatggacagcctcctgcaggccctgaagaccgagctggctgcggtgtgtggggacccatccacaggaccaccgctcttgacccgggtc
[0089] aggcaccagtaccacctccagggctgcctggatgccttgggccactaccagctggccacagacctggctctggcggccgaggccctgcgccaggctcggaggcaactaaatcacctcacaggtggaggaggaacggaggagatcctggatctcatcttccaggacttctgtgtgggcaagtga.
[0090] 1.4 Statistical Analysis
[0091] Statistical analysis was performed using GraphPad Prism 8.0.1 and Origin 2021 software. All results were derived from the mean ± standard deviation (SD) of three independent repeated experiments. The significance of the statistical results was assessed using two-way ANOVA. A p-value < 0.05 was considered statistically significant (*P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001).
[0092] 2. Results
[0093] 2.1 The pathogenic point mutation model of Gtpbp3 (mGtpbp3) in mice affects cardiac function.
[0094] This application describes the use of Cyagen Biosciences to construct heterozygous mice containing the homologous pathogenic point mutations p.mGtpbp3-E230P (corresponding to Q230P in humans) and p.mGtpbp3-N374D in C57BL / 6J mice. Through hybridization and self-crossing of these heterozygous mice, this application successfully obtained E230P homozygous mice (E / E mice) and E230P / N374D compound heterozygous mice (E / N mice) with genotypes similar to those of patients. Figure 2 (Figure A in the middle)
[0095] This application uses these two genotype mice as model mice for subsequent research. After reaching adulthood, these model mice exhibit varying degrees of epilepsy and seizures, with E / E mice showing relatively milder symptoms and E / N mice experiencing more severe symptoms. However, during growth and development, the body length of the model mice was not significantly different from that of wild-type C57 mice. Figure 2 (Figure B in the middle)
[0096] Continuous weight monitoring of the model mice revealed that, regardless of sex, the body weight of the model mice began to gradually decrease compared to wild-type C57 mice around 10 weeks of age, with E / N mice exhibiting a faster and more significant weight loss. Figure 2 (See Figure C). Continuous survival rate monitoring of the model mice revealed that their lifespan was significantly shorter than that of wild-type mice. E / E mice survived for no more than 50 weeks, while E / N mice survived for less than 35 weeks. Figure 2 Figure D shows that the pathogenic point mutation of Gtpbp3 has a severe negative impact on the lifespan of mice. Subsequently, this application dissected 12-week-old model mice and observed the size of their tissues and organs. The results showed that both mouse models exhibited a hypertrophic phenotype in their hearts, with the E / E mice showing relatively mild cardiac hypertrophy while the E / N mice showed severe cardiac hypertrophy. Figure 2 (Figure E) The hearts and bodies of the model mice were weighed and their heart weight versus body weight (HW / BW) ratio was calculated. The results showed that the heart weight versus body weight ratio of the model mice was significantly higher than that of wild-type mice. Figure 2 (Figure F in the original text) These cardiac hypertrophy phenotypes are highly consistent with the predictions made by the inventors in previous RNA-Seq studies at the cell line level. Therefore, this application performed echocardiographic examinations on 12-week-old mouse models, and the results showed abnormalities in echocardiography in both mouse models. Figure 2 (See Figure G). Continuous echocardiographic examination of the model mice revealed that cardiac function decline occurred earlier than body weight differentiation. Cardiac function in both E / E and E / N mice began to decline from week 6 of age, with significant decreases in ejection fraction, short-axis contractility, and cardiac output per minute. Figure 2 (Figures H, I, and J) show that the diameter of the left ventricle increases significantly during both diastole and systole. Figure 2 (K-plot, L-plot). The above data show that the cardiac function of the model mice declines with increasing age, and the thickness of the left ventricle also increases, showing a significant cardiac hypertrophy phenotype. In previous studies, the inventors found that the body weight of the model mice was significantly lower than that of wild-type mice. Would their metabolism also be affected? This application conducted metabolic cage tests on 12-week-old model mice to assess their metabolism. The results showed that the oxygen consumption and carbon dioxide exhalation of E / E mice were not significantly different from those of wild-type C57 mice, but their thermogenesis was slightly lower; while the phenotype of E / N mice was more pronounced, with significantly lower oxygen consumption, carbon dioxide exhalation, and thermogenesis than that of wild-type C57 mice. Figure 2 The figure (M) illustrates that the metabolism of the two mouse models decreased to varying degrees. Skeletal muscle is the largest heat-producing tissue in an organism. Considering the phenotype of reduced body weight and decreased heat production in the mouse models, this application will focus on the effects of pathogenic point mutations in Gtpbp3 on the heart and muscles of the mouse models.
[0097] 2.2 The morphology and function of mitochondria in the heart and muscles of the model mice were affected.
[0098] This application first extracts total RNA from the heart and muscle tissues of model mice and performs Northern Blot to detect the homeostatic level of taurine-modified mitochondrial tRNA in the mice. The results are consistent with the inventors' previous experimental results in cell lines, that is, the homeostatic expression level of taurine-modified mitochondrial tRNA in the heart and muscle tissues of mice is not significantly different from that in wild-type C57 mice. Figure 3 (Figure A). Next, whole-cell lysates of heart and muscle tissues from model mice were extracted and Western blotted to detect changes in mitochondrial oxidative phosphorylation complex proteins. The results showed that the expression levels of nuclear genes encoding subunits II / III / IV of the oxidative phosphorylation complex in the heart and muscle of model mice did not change significantly, while the expression level of Ndufs1, a subunit of complex I, decreased significantly. Figure 3 (Figure B); Regarding the mitochondrial-encoded oxidative phosphorylation complex subunits, this application found that the expression level of Mt-co1 in the heart and muscle of model mice was slightly decreased compared with that in C57 mice, while the expression levels of Mt-Nd3 and Mt-Nd6 in heart tissue were significantly decreased, and the expression level of Mt-Nd3 in muscle tissue was significantly decreased (Figure B). Figure 3 (Figure C). These results suggest a decrease in the expression and function of mitochondrial oxidative phosphorylation complex I in model mice. To support this hypothesis, this application extracted mitochondria from the heart and muscle of model mice and performed BN-PAGE analysis. The results showed a significant decrease in the overall expression level of oxidative phosphorylation complex I in the heart and muscle mitochondria of model mice. Figure 3 (Figure D in the middle) Simultaneously, the levels of the supercomplex assembled on the basis of oxidative phosphorylation complex in the heart and muscle mitochondria of the model mice were further downregulated. Figure 3 Figure D shows that the decreased level of complex I protein in the organ tissues of model mice not only affects the assembly of complex I itself, but also affects the assembly of the entire mitochondrial oxidative phosphorylation supercomplex. Next, this application measured the enzyme activities of oxidative phosphorylation complexes I and IV in the heart and muscle mitochondria of model mice. The results showed that the enzyme activities of oxidative phosphorylation complexes I and IV in both model mice were significantly lower than those in C57 mice. Figure 3 (China E diagram).
[0099] Does the decreased enzyme activity and expression level of mitochondrial oxidative phosphorylation complex affect the morphology of mitochondria in the heart and muscle of model mice? This application used transmission electron microscopy to examine the heart and muscle tissues of 12-week-old model mice. The results showed significant differentiation in mitochondrial morphology between the mouse heart and muscle, with the mitochondrial morphology in the heart tissue of the model mice being significantly better than that in the muscle tissue. Figure 4 (Figures A and D). This application also found that the area distribution of mitochondria in the heart tissue of the model mice was wider, similar to that of the cell lines. The average area of mitochondria in the hearts of E / E and E / N mice was larger than that of wild-type C57 mice, with the increase being more significant in E / N mice. Figure 4 (Figure B in the figure); Approximately 30% of the heart mitochondria in E / E mice and approximately 50% of the heart mitochondria in E / N mice exhibited abnormalities such as reduced cristae and vacuolation. The damage to muscle mitochondria in the model mice was even more severe, with numerous mitochondria showing vacuolation or even complete disappearance of cristae (Figure C in the figure). Unlike cell lines containing the two mutant enzymes or the heart mitochondria in model mice, which show a wider area distribution, the muscle mitochondria in model mice exhibited a narrower area distribution, with the average mitochondrial area decreasing compared to wild-type mice, especially in E / N mice where the decrease in muscle mitochondrial area was more significant. Figure 4 (Figure E); In addition, the abnormal rate of muscle mitochondria in model mice also increased significantly, with approximately 50% of muscle mitochondria in E / E mice and approximately 90% in E / N mice. Figure 4 (Figure F in the middle)
[0100] Based on the above results, this application concludes that pathogenic point mutations in Gtpbp3 lead to the decline in the function of the oxidative phosphorylation complex in mouse heart and muscle mitochondria, resulting in abnormalities in mitochondrial function and morphology, and ultimately causing mitochondrial disease phenotypes such as cardiac hypertrophy, cardiac dysfunction, weight loss, and reduced heat production in mice.
[0101] 2.3 Cardiac function phenotype in adeno-associated virus (AAV) complementation model mice (tail vein injection dose: 100 μL; intramuscular injection dose: 35 μL; viral titer: 1.3 × 10⁻⁶). 12 vg / mL)
[0102] Four weeks after viral infection, this application examined mitochondrial protein expression and cardiac function in the heart and muscle of model mice. Figure 5 (Figure A in the middle)
[0103] First, the infected mouse model was dissected. The results showed that the hearts of E / N mice expressing high levels of mGtpbp3 did not show hypertrophy, similar to those of wild-type mice, while the E / N mice infected with the negative control showed a significant hypertrophic cardiac phenotype. Figure 5 (Figure B). Masson staining of cardiac tissue revealed that E / N mice infected with rAAV9-mGtpbp3 showed a significant decrease in cardiac hypertrophy and myocardial fibrosis phenotypes to wild-type levels. Figure 5 (Figures C and D) , accompanied by a decrease in heart-to-body weight ratio to wild-type levels ( Figure 5 (Figure E). Preliminary echocardiographic analysis of virus-infected E / N mice showed that infection with rAAV9-mGtpbp3 significantly improved cardiac function in mice. Figure 5 (Figure F in the middle), while continuous echocardiographic analysis showed that E / N mice infected with rAAV9-mGtpbp3 significantly regressed to the levels of wild-type C57 mice in almost all cardiac functions, including ejection fraction, short-axis contractility, stroke volume, left ventricular systolic diameter, and left ventricular diastolic diameter, and the regression effect lasted for at least three months. Figure 5 (G-K diagram).
[0104] Due to the large volume of muscle tissue, it was impossible to effectively infect and functionally analyze all skeletal muscle. Therefore, this application used in situ intramuscular injection to target the thigh muscles of model mice and evaluated the compensatory effect of the virus on muscle defects at the molecular level. Simultaneously, this application also evaluated the compensatory effect of the virus on cardiac defects at the molecular level. The results showed that the virus exhibited a significant compensatory phenotype in both muscle and heart. Firstly, the virus could efficiently infect cardiac and muscle tissues and highly express mGtpbp3 (…). Figure 6 (Figure A) Based on this, further supplementation was performed to address the deficiency of mitochondrial and nuclear genes encoding mitochondrial oxidative phosphorylation complex proteins. Figure 6 (Figure A); Based on this, the deficiencies in cardiac and muscle mitochondrial oxidative phosphorylation complex I and the supercomplex were effectively compensated, and the steady-state expression levels of the complexes were essentially restored to the levels of wild-type C57 mice. Figure 6 (Figure B); Simultaneously, the enzyme activities of cardiac and muscle mitochondrial oxidative phosphorylation complexes I and IV, which were previously deficient, were significantly enhanced after infection with rAAV9-mGtpbp3. Figure 6 (See Figure C). These results indicate that infection with rAAV9-mGtpbp3 in E / N mice effectively treated their mitochondrial translation and functional defects. Building upon this functional recovery, the morphology of damaged mitochondria in the heart and muscle also showed further improvement. Figure 6 (Figures D and G) show that the mitochondrial membrane area of E / N mice infected with rAAV9-mGtpbp3 essentially recovered to the level of wild-type mice. Figure 3 E, 3H), the proportion of abnormal mitochondria such as vacuolation and damage was significantly decreased (E, 3H), Figure 6(Figure F, Figure I). However, considering the efficiency of viral infection in muscle tissue, the therapeutic effect on its mitochondrial morphology is not as good as that on the mitochondria of the heart, but it is still very significant.
[0105] In summary, through gene therapy using rAAV9-mGtpbp3 in E / N model mice, this application demonstrates that this therapy has a sustained and significant therapeutic effect on cardiac dysfunction caused by Gtpbp3 pathogenic point mutations at the macroscopic level. At the molecular level, the virus can infect not only the heart but also muscle tissue, and it can effectively compensate for functional defects and morphological damage to mitochondria in the heart and muscles at the molecular level. This indicates that this therapy can not only effectively treat cardiac dysfunction caused by Gtpbp3 pathogenic point mutations but also has great potential in treating symptoms such as myasthenia gravis caused by this genetic disease.
[0106] The technical features of the above-described embodiments and examples can be combined in any suitable manner. For the sake of brevity, not all possible combinations of the technical features in the above-described embodiments and examples are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.
[0107] The embodiments described above are merely illustrative of several implementation methods of this application, intended to facilitate a detailed understanding of the technical solutions of this application, but should not be construed as limiting the scope of protection of the patent application. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of this application, and these all fall within the scope of protection of this application. Furthermore, it should be understood that after reading the above teachings of this application, those skilled in the art can make various alterations or modifications to this application, and the equivalent forms obtained also fall within the scope of protection of this application. It should also be understood that technical solutions obtained by those skilled in the art based on the technical solutions provided in this application through logical analysis, reasoning, or limited experimentation are all within the scope of protection of the appended claims. Therefore, the scope of protection of this patent application should be determined by the content of the appended claims, and the specification and drawings can be used to interpret the content of the claims.
Claims
1. A recombinant adeno-associated virus, characterized in that, The genome of the recombinant adeno-associated virus contains an expression cassette of the GTPBP3 gene.
2. The recombinant adeno-associated virus according to claim 1, characterized in that, The recombinant adeno-associated virus serotypes include type 9.
3. The recombinant adeno-associated virus according to any one of claims 1 to 2, characterized in that, The promoter in the expression box includes a CMV promoter; optionally, the expression box also includes an enhancer; further optionally, the enhancer includes a CMV enhancer.
4. The packaging system for recombinant adeno-associated virus according to any one of claims 1 to 3.
5. The packaging system according to claim 4, characterized in that, The packaging system includes a three-plasma packaging system.
6. Use of the recombinant adeno-associated virus of any one of claims 1 to 3 and / or the packaging system of any one of claims 4 to 5 in the preparation of a medicament for treating mitochondrial diseases caused by GTPBP3 point mutations.
7. The application according to claim 6, characterized in that, The mitochondrial disease treated with the drug is mainly caused by the following point mutation in GTPBP3 with uniprot number Q969Y2: N374D; or, N374D and other GTPBP3 point mutations.
8. The application according to claim 7, characterized in that, Other GTPBP3 point mutations include a mutation at position 230 to proline; optionally, other GTPBP3 point mutations include Q230P.
9. The application according to any one of claims 6 to 8, characterized in that, The drug comprises the recombinant adeno-associated virus and / or the packaging system, as well as pharmaceutically acceptable excipients.
10. The application according to any one of claims 6 to 8, characterized in that, The mitochondrial diseases for which the drug is to be treated include chronic progressive extraocular muscle palsy, Kearns-Sayre syndrome, mitochondrial encephalomyopathy with hyperlactatemia and stroke-like attacks, Leigh syndrome, myoclonic epilepsy with broken red fibers, simple mitochondrial myopathy, lactic acidosis, hyperglycemia, hyperammonemia, fatty acid oxidation disorders, organic acidemia, or heart disease; the heart disease includes hypertrophic cardiomyopathy.