Method for preparing acetyl octapeptide-1 by combining chemical method and biological method and application of acetyl octapeptide-1

Abstract

According to the method for preparing the acetyl octapeptide-1 by combining the chemical method and the biological method, provided by the invention, according to the structural formula of the acetyl octapeptide-1, protected dipeptide H-Glu-Glu-OH is firstly synthesized by adopting the chemical method, then protected pentapeptide Met-Gln-Arg-Arg-Ala is synthesized by adopting the biological method, and then H-Asp (OAll)-OMe is synthesized by adopting the chemical method. The preparation method comprises the following steps: firstly, protecting dipeptide H-Glu-Glu-OH, protecting pentapeptide Met-Gln-Arg-Arg-Ala and H-Asp (Oall)-OMe, connecting the protecting dipeptide H-Glu-Glu-OH, the protecting pentapeptide Met-Gln-Arg-Arg-Ala and the protecting pentapeptide H-Asp (Oall)-OMe according to a certain mode, and finally, chemically modifying and adding acetyl and amino to prepare the high-purity acetyl octapeptide-1. By adopting the method, the steps of chemical synthesis can be effectively reduced, the use of organic reagents is reduced, the pollution to the environment is reduced, the method has the advantage of environmental protection, and a new thought is provided for synthesis of other polypeptides.

Description

Technical Field

[0001] This invention relates to the field of biochemical engineering, and in particular to a method and application for preparing acetyl octapeptide-1 by combining chemical and biological methods. Background Technology

[0002] Acetyl octapeptide-1 is a polypeptide with N-terminal acetyl modification and C-terminal amino modification, and its amino acid sequence is Ac-Glu-Glu-Met-Gln-Arg-Arg-Ala-Asp-NH2. Studies have shown that using skin care products containing acetyl octapeptide-1 can significantly reduce the depth and number of facial wrinkles. At the same time, it can also improve the elasticity and luster of the skin, making the skin look younger and healthier, and has broad application prospects in the cosmetics field. At present, the main method for synthesizing polypeptides is chemical method, such as solid phase synthesis and liquid phase synthesis. However, this method faces some problems: (1) This method requires the addition of amino acids one by one. For the synthesis of polypeptides with more than 3 amino acids, the yield will be greatly reduced. In addition, a large number of non-target peptide impurities will be generated during the synthesis process, and the purity of the target product obtained is low; (2) In the process of synthesizing polypeptides, each step of adding and linking amino acids needs to be completed in organic reagents. The generated organic reagent waste liquid needs to be specially treated, which not only puts great pressure on reagent costs and waste liquid treatment costs, but also has a negative impact on environmental protection. Summary of the Invention

[0003] This invention provides a method for preparing acetyl octapeptide-1 by combining chemical and biological methods. This method can produce acetyl octapeptide-1 with high purity and can effectively reduce the number of chemical synthesis steps, the use of organic reagents, and environmental pollution, thus having the advantages of being environmentally friendly.

[0004] This invention provides a method for preparing acetyl octapeptide-1 by combining chemical and biological methods, comprising the following steps:

[0005] Protects the synthesis of the dipeptide H-Glu-Glu-OH:

[0006] (a) Using glutamic acid as raw material, Boc-Glu(OAll)-OH was obtained by complexing with copper ions, introducing an OAll protecting group, removing copper ions, and introducing a Boc protecting group.

[0007] (b) The Boc-Glu(OAll)-OH is subjected to the introduction of a methyl ester protecting group and the removal of the Boc protecting group to obtain H-Glu(OAll)-OMe;

[0008] (c) The Boc-Glu(OAll)-OH and the H-Glu(OAll)-OMe are subjected to an amide condensation reaction to obtain the dipeptide Boc-Glu(OAll)-Glu(OAll)-OMe;

[0009] (d) The dipeptide Boc-Glu(OAll)-Glu(OAll)-OMe is demethylated to obtain Boc-Glu(OAll)-Glu(OAll)-OH, i.e., the protected dipeptide H-Glu-Glu-OH;

[0010] Protecting the synthesis of the pentapeptide Met-Gln-Arg-Arg-Ala:

[0011] (e) The nucleotide sequence shown in SEQ ID NO.2 was inserted into the pET30a plasmid through the restriction sites KpnI and XhoI to construct the recombinant plasmid pET30a-XXA-DK-5;

[0012] (f) The recombinant plasmid pET30a-XXA-DK-5 was transformed into competent Escherichia coli cells to obtain the fusion polypeptide;

[0013] (g) The fusion polypeptide is purified and cleaved to obtain the pentapeptide Met-Gln-Arg-Arg-Ala;

[0014] (h) The pentapeptide Met-Gln-Arg-Arg-Ala is subjected to the introduction of a Boc protecting group, the removal of the Boc protecting group on the α-amino group and the introduction of a Fmoc protecting group to obtain Fmoc-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-OH, which is the protected pentapeptide Met-Gln-Arg-Arg-Ala.

[0015] Synthesis of H-Asp(OAll)-OMe:

[0016] (i) Using aspartic acid as raw material, H-Asp(OAll)-OMe was obtained by complexing with copper ions, introducing an OAll protecting group, removing copper ions, and introducing a methyl ester protecting group.

[0017] Synthesis of Acetyl Octapeptide-1:

[0018] (j) The H-Asp(OAll)-OMe is subjected to an amide condensation reaction with the Fmoc-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-OH to obtain Fmoc-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OMe;

[0019] (k) The Fmoc-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OMe is obtained by removing the Fmoc protecting group;

[0020] (l) The Boc-Glu(OAll)-Glu(OAll)-OH and the H-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OMe are subjected to an amide condensation reaction to obtain Boc-Glu(OAll)-Glu(OAll)-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OMe;

[0021] (m) The Boc-Glu(OAll)-Glu(OAll)-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OMe is sequentially subjected to N-terminal deprotection of the Boc protecting group, N-terminal acetyl modification, C-terminal deprotection of the methyl ester protecting group, C-terminal amino modification, side chain deprotection of the Boc protecting group, and deprotection of the OAll protecting group to obtain the product Ac-Glu-Glu-Met-Gln-Arg-Arg-Ala-Asp-NH2, which is the acetyl octapeptide-1.

[0022] The method for preparing acetyl octapeptide-1 by combining chemical and biological methods as described above, specifically includes step (a):

[0023] (1) Dissolve glutamic acid in water, adjust the pH to 8-9, add copper sulfate and carry out a complexation reaction to obtain a glutamic acid-copper ion complex.

[0024] (2) The glutamic acid complex with copper ions, allyl bromide and potassium carbonate were added to N,N-dimethylformamide solution and stirred at 50-60℃ for 1-4h. After introducing the OAll protecting group, H-Glu(OAll)-OH complex with copper ions was obtained.

[0025] (3) The H-Glu(OAll)-OH complex with copper ions is reacted to remove copper ions to obtain H-Glu(OAll)-OH;

[0026] (4) Add the H-Glu(OAll)-OH and ditert-butyl dicarbonate to 1,4-dioxane, adjust the pH to 9-10, stir the reaction at room temperature for 0.5-2h, adjust the pH to 2-3, and introduce the Boc protecting group to obtain Boc-Glu(OAll)-OH.

[0027] In the method for preparing acetyl octapeptide-1 by combining chemical and biological methods as described above, the mass ratio of glutamic acid to copper sulfate is 1:(0.7-0.9).

[0028] The mass ratio of the glutamic acid-copper ion complex, the allyl bromide, and the potassium carbonate is 1:(0.7-0.8):(0.3-0.4).

[0029] The mass ratio of H-Glu(OAll)-OH to ditert-butyl dicarbonate is 1:(0.9-1.2).

[0030] In the method for preparing acetyl octapeptide-1 by combining chemical and biological methods as described above, in step (c), the mass ratio of Boc-Glu(OAll)-OH to H-Glu(OAll)-OMe is 1:(1-1.1).

[0031] The method for preparing acetyl octapeptide-1 by combining chemical and biological methods as described above, specifically includes step (f):

[0032] The recombinant plasmid pET30a-XXA-DK-5 was transformed into competent E. coli cells, and after screening, single colonies were picked and cultured in LB medium at 35-38℃ and 200-240 rpm for 8-15 h with shaking to obtain a culture medium. The culture medium was then transferred to TB medium and cultured in TB medium at 35-38℃ and 200-240 rpm for 4-6 h with shaking. Finally, a final concentration of 0.15-0.3 mmol of [agent / recombinant plasmid] was added. Isopropyl-β-D-thiogalactopyranoside was cultured at 23-26℃ and 200-240 rpm for 14-16 h in a shaker. The bacterial cells were collected by centrifugation. The bacterial cells were resuspended in phosphate buffer, sonicated, and centrifuged at 3-5℃ and 10000-12000 rpm. The supernatant was collected to obtain the fusion polypeptide. The sonication parameters were set as follows: power 400W, time 10 min, with a 10 s interval between every 10 s of sonication.

[0033] The method for preparing acetyl octapeptide-1 by combining chemical and biological methods as described above, specifically includes step (g):

[0034] After purification of the fusion peptide using a nickel ion affinity column, it was cleaved with phosphate buffer containing enterokinase to obtain the pentapeptide Met-Gln-Arg-Arg-Ala.

[0035] The method for preparing acetyl octapeptide-1 by combining chemical and biological methods as described above, specifically includes step (h):

[0036] The pentapeptide Met-Gln-Arg-Arg-Ala and ditert-butyl dicarbonate were added to 1,4-dioxane, the pH was adjusted to 9-10, and the reaction was stirred at room temperature for 5 h. The pH was then adjusted to 2-3, and a Boc protecting group was introduced to obtain Boc-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-OH.

[0037] The Boc-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-OH was obtained by removing the Boc protecting group on the α-amino group;

[0038] The H-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-OH and fluorenemethyloxycarbonyl chloride were added to 1,4-dioxane, the pH was adjusted to 9-10, and the reaction was carried out at 0℃ for 1-1.5 h, followed by a reaction at 24-26℃ for 4-6 h. The pH was then adjusted to 2-3, and the Fmoc protecting group was introduced to obtain Fmoc-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-OH, which is the protected pentapeptide Met-Gln-Arg-Arg-Ala.

[0039] In the method for preparing acetyl octapeptide-1 by combining chemical and biological methods as described above, in step (j), the mass ratio of H-Asp(OAll)-OMe to Fmoc-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-OH is (1.1-1.2):1;

[0040] And / or, in step (l), the mass ratio of Boc-Glu(OAll)-Glu(OAll)-OH to H-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OMe is (1.3-1.5):1.

[0041] The method for preparing acetyl octapeptide-1 by combining chemical and biological methods as described above, specifically includes step (m):

[0042] The Boc-Glu(OAll)-Glu(OAll)-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OMe was deprotected at its N-terminus to obtain H-Glu(OAll)-Glu(OAll)-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OMe;

[0043] A solution of dimethylformamide containing acetic anhydride was mixed with diisopropylethylamine at a volume ratio of 1:1, and H-Glu(OAll)-Glu(OAll)-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OMe was added. The mixture was stirred at room temperature for 0.5-2 hours to obtain Ac-Glu(OAll)-Glu(OAll)-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OMe.

[0044] Tetrahydrofuran, methanol, and water were mixed in a volume ratio of 3:1:1. Lithium hydroxide and the Ac-Glu(OAll)-Glu(OAll)-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OMe were added, and the mixture was stirred at room temperature for 1-3 hours. The pH was adjusted to 2-3, and a precipitate was formed to obtain Ac-Glu(OAll)-Glu(OAll)-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OH.

[0045] EEDQ was dissolved in anhydrous dichloromethane to prepare an EEDQ solution. The EEDQ solution was then added dropwise to Ac-Glu(OAll)-Glu(OAll)-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OH at 0°C. After the addition was complete, the reaction was allowed to proceed for 10-20 min, and then ammonia gas was introduced to react for 1-3 h to obtain Ac-Glu(OAll)-Glu(OAll)-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-NH2.

[0046] The Ac-Glu(OAll)-Glu(OAll)-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-NH2 was added to a dichloromethane solution containing trifluoroacetic acid and stirred at room temperature for 25-35 min to obtain Ac-Glu(OAll)-Glu(OAll)-Met-Gln-Arg-Arg-Ala-Asp(OAll)-NH2.

[0047] The Ac-Glu(OAll)-Glu(OAll)-Met-Gln-Arg-Arg-Ala-Asp(OAll)-NH2 was dissolved in anhydrous dichloromethane, and tetrakis(triphenylphosphine)palladium and phenylsilane were added. The mixture was stirred at room temperature for 0.5-2 hours. After filtration and washing, the product Ac-Glu-Glu-Met-Gln-Arg-Arg-Ala-Asp-NH2, i.e., acetyl octapeptide-1, was obtained.

[0048] The present invention also provides the application of acetyl octapeptide-1 obtained by the method in the preparation of cosmetics.

[0049] The solution of the present invention has at least the following effects:

[0050] Based on the structural formula Ac-(Glu-Glu)-(Met-Gln-Arg-Arg-Ala)-Asp-NH2 of acetyl octapeptide-1, this invention first synthesizes the protective dipeptide H-Glu-Glu-OH (Boc-Glu(OAll)-Glu(OAll)-OH) using a chemical method, then synthesizes the protective pentapeptide Met-Gln-Arg-Arg-Ala (Fmoc-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-OH) using a biological method, followed by the chemical synthesis of H-Asp(OAll)-OMe. The protective dipeptide H-Glu-Glu-OH, the protective pentapeptide Met-Gln-Arg-Arg-Ala, and H-Asp(OAll)-OMe are then linked together in a specific manner. Finally, acetyl and amino groups are chemically modified to obtain acetyl octapeptide-1. This invention employs a combination of chemical and biological methods to efficiently synthesize acetyl octapeptide-1. The resulting acetyl octapeptide-1 has the advantage of high purity. Furthermore, this method effectively reduces the number of chemical synthesis steps, the use of organic reagents, and environmental pollution, thus offering environmental advantages and providing a new approach for the synthesis of other peptides. Attached Figure Description

[0051] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0052] Figure 1 The structural formula of acetyl octapeptide-1 obtained in the embodiments of the present invention is shown below;

[0053] Figure 2 This is a spectrum of the recombinant plasmid pET30a-XXA-DK-5 of this invention;

[0054] Figure 3 This is a protein electrophoresis diagram of the present invention;

[0055] Figure 4 The hydrogen spectrum of acetyl octapeptide-1 obtained in an embodiment of the present invention;

[0056] Figure 5 The carbon spectrum of acetyl octapeptide-1 obtained in an embodiment of the present invention;

[0057] Figure 6 The liquid chromatography detection results are for acetyl octapeptide-1 prepared in the embodiments of the present invention. Detailed Implementation

[0058] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions in the embodiments of this invention will be clearly and completely described below in conjunction with the embodiments of this invention. Obviously, the described embodiments are only some embodiments of this invention, not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention. Where specific techniques or conditions are not specified in the embodiments, they shall be performed in accordance with the techniques or conditions described in the literature in this art or in accordance with the product instructions. Reagents or instruments used without specified manufacturers are all conventional products that can be obtained commercially.

[0059] Those skilled in the art should understand that, in the following description of the embodiments of the present invention, the sequence of numbers does not imply the order of execution. Some or all steps may be executed in parallel or sequentially. The execution order of each process should be determined by its function and internal logic, and should not constitute any limitation on the implementation process of the embodiments of the present invention.

[0060] Those skilled in the art will understand that the numerical ranges in the embodiments of the present invention should be understood to specifically disclose each intermediate value between the upper and lower limits of the range. Each smaller range between any stated value or intermediate value within a stated range, and any other stated value or intermediate value within said range, is also included in this application. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0061] Unless otherwise stated, the technical / scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0062] This invention provides a method for preparing acetyl octapeptide-1 by combining chemical and biological methods, comprising the following steps:

[0063] Protects the synthesis of the dipeptide H-Glu-Glu-OH:

[0064] (a) Using glutamic acid as raw material, Boc-Glu(OAll)-OH was obtained by complexing with copper ions, introducing an OAll protecting group, removing copper ions, and introducing a Boc protecting group.

[0065] (b) The Boc-Glu(OAll)-OH is subjected to the introduction of a methyl ester protecting group and the removal of the Boc protecting group to obtain H-Glu(OAll)-OMe;

[0066] (c) The Boc-Glu(OAll)-OH and the H-Glu(OAll)-OMe are subjected to an amide condensation reaction to obtain the dipeptide Boc-Glu(OAll)-Glu(OAll)-OMe;

[0067] (d) The dipeptide Boc-Glu(OAll)-Glu(OAll)-OMe is demethylated to obtain Boc-Glu(OAll)-Glu(OAll)-OH, i.e., the protected dipeptide H-Glu-Glu-OH;

[0068] Protecting the synthesis of the pentapeptide Met-Gln-Arg-Arg-Ala:

[0069] (e) The nucleotide sequence shown in SEQ ID NO.2 was inserted into the pET30a plasmid through the restriction sites KpnI and XhoI to construct the recombinant plasmid pET30a-XXA-DK-5;

[0070] (f) The recombinant plasmid pET30a-XXA-DK-5 was transformed into competent Escherichia coli cells to obtain the fusion polypeptide;

[0071] (g) The fusion polypeptide is purified and cleaved to obtain the pentapeptide Met-Gln-Arg-Arg-Ala;

[0072] (h) The pentapeptide Met-Gln-Arg-Arg-Ala is subjected to the introduction of a Boc protecting group, the removal of the Boc protecting group on the α-amino group and the introduction of a Fmoc protecting group to obtain Fmoc-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-OH, which is the protected pentapeptide Met-Gln-Arg-Arg-Ala.

[0073] Synthesis of H-Asp(OAll)-OMe:

[0074] (i) Using aspartic acid as raw material, H-Asp(OAll)-OMe was obtained by complexing with copper ions, introducing an OAll protecting group, removing copper ions, and introducing a methyl ester protecting group.

[0075] Synthesis of Acetyl Octapeptide-1:

[0076] (j) The H-Asp(OAll)-OMe is subjected to an amide condensation reaction with the Fmoc-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-OH to obtain Fmoc-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OMe;

[0077] (k) The Fmoc-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OMe is obtained by removing the Fmoc protecting group;

[0078] (l) The Boc-Glu(OAll)-Glu(OAll)-OH and the H-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OMe are subjected to an amide condensation reaction to obtain Boc-Glu(OAll)-Glu(OAll)-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OMe;

[0079] (m) The Boc-Glu(OAll)-Glu(OAll)-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OMe is sequentially subjected to N-terminal deprotection of the Boc protecting group, N-terminal acetyl modification, C-terminal deprotection of the methyl ester protecting group, C-terminal amino modification, side chain deprotection of the Boc protecting group, and deprotection of the OAll protecting group to obtain the product Ac-Glu-Glu-Met-Gln-Arg-Arg-Ala-Asp-NH2, which is the acetyl octapeptide-1.

[0080] In some implementations, step (a) specifically includes:

[0081] (1) Dissolve glutamic acid in water, adjust the pH to 8-9, add copper sulfate and carry out a complexation reaction to obtain a glutamic acid-copper ion complex.

[0082] (2) The glutamic acid complex with copper ions, allyl bromide and potassium carbonate were added to N,N-dimethylformamide solution and stirred at 50-60℃ for 1-4h. After introducing the OAll protecting group, H-Glu(OAll)-OH complex with copper ions was obtained.

[0083] (3) The H-Glu(OAll)-OH complex with copper ions is reacted to remove copper ions to obtain H-Glu(OAll)-OH;

[0084] (4) Add the H-Glu(OAll)-OH and ditert-butyl dicarbonate to 1,4-dioxane, adjust the pH to 9-10, stir the reaction at room temperature for 0.5-2h, adjust the pH to 2-3, and introduce the Boc protecting group to obtain Boc-Glu(OAll)-OH.

[0085] In some embodiments, in step (1), the mass ratio of the glutamic acid to the copper sulfate is 1:(0.7-0.9).

[0086] In some embodiments, in step (2), the mass ratio of the glutamic acid complex with copper ions, the allyl bromide and the potassium carbonate is 1:(0.7-0.8):(0.3-0.4).

[0087] In some embodiments, in step (4), the mass ratio of H-Glu(OAll)-OH to ditert-butyl dicarbonate is 1:(0.9-1.2).

[0088] In some embodiments, in step (c), the mass ratio of Boc-Glu(OAll)-OH to H-Glu(OAll)-OMe is 1:(1-1.1).

[0089] In some implementations, step (f) specifically includes:

[0090] The recombinant plasmid pET30a-XXA-DK-5 was transformed into competent E. coli cells, and after screening, single colonies were picked and cultured in LB medium at 35-38℃ and 200-240 rpm for 8-15 h with shaking to obtain a culture medium. The culture medium was then transferred to TB medium and cultured in TB medium at 35-38℃ and 200-240 rpm for 4-6 h with shaking. Finally, a final concentration of 0.15-0.3 mmol of [agent / recombinant plasmid] was added. Isopropyl-β-D-thiogalactopyranoside was cultured at 23-26℃ and 200-240 rpm for 14-16 h in a shaker. The bacterial cells were collected by centrifugation. The bacterial cells were resuspended in phosphate buffer, sonicated, and centrifuged at 3-5℃ and 10000-12000 rpm. The supernatant was collected to obtain the fusion polypeptide. The sonication parameters were set as follows: power 400W, time 10 min, with a 10 s interval between every 10 s of sonication.

[0091] In some implementations, step (g) specifically includes:

[0092] After purification of the fusion peptide using a nickel ion affinity column, it was cleaved with phosphate buffer containing enterokinase to obtain the pentapeptide Met-Gln-Arg-Arg-Ala.

[0093] In some implementations, step (h) specifically includes:

[0094] The pentapeptide Met-Gln-Arg-Arg-Ala and ditert-butyl dicarbonate were added to 1,4-dioxane, the pH was adjusted to 9-10, and the reaction was stirred at room temperature for 5 h. The pH was then adjusted to 2-3, and a Boc protecting group was introduced to obtain Boc-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-OH.

[0095] The Boc-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-OH was obtained by removing the Boc protecting group on the α-amino group;

[0096] The H-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-OH and fluorenemethyloxycarbonyl chloride were added to 1,4-dioxane, the pH was adjusted to 9-10, and the reaction was carried out at 0℃ for 1-1.5 h, followed by a reaction at 24-26℃ for 4-6 h. The pH was then adjusted to 2-3, and the Fmoc protecting group was introduced to obtain Fmoc-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-OH, which is the protected pentapeptide Met-Gln-Arg-Arg-Ala.

[0097] In some implementations, in step (j), the mass ratio of H-Asp(OAll)-OMe to Fmoc-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-OH is (1.1-1.2):1.

[0098] In some embodiments, in step (l), the mass ratio of Boc-Glu(OAll)-Glu(OAll)-OH to H-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OMe is (1.3-1.5):1.

[0099] In some implementations, step (m) specifically includes:

[0100] The Boc-Glu(OAll)-Glu(OAll)-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OMe was deprotected at its N-terminus to obtain H-Glu(OAll)-Glu(OAll)-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OMe;

[0101] A solution of dimethylformamide containing acetic anhydride was mixed with diisopropylethylamine at a volume ratio of 1:1, and H-Glu(OAll)-Glu(OAll)-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OMe was added. The mixture was stirred at room temperature for 0.5-2 hours to obtain Ac-Glu(OAll)-Glu(OAll)-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OMe.

[0102] Tetrahydrofuran, methanol, and water were mixed in a volume ratio of 3:1:1. Lithium hydroxide and the Ac-Glu(OAll)-Glu(OAll)-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OMe were added, and the mixture was stirred at room temperature for 1-3 hours. The pH was adjusted to 2-3, and a precipitate was formed to obtain Ac-Glu(OAll)-Glu(OAll)-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OH.

[0103] EEDQ was dissolved in anhydrous dichloromethane to prepare an EEDQ solution. The EEDQ solution was then added dropwise to Ac-Glu(OAll)-Glu(OAll)-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OH at 0°C. After the addition was complete, the reaction was allowed to proceed for 10-20 min, and then ammonia gas was introduced to react for 1-3 h to obtain Ac-Glu(OAll)-Glu(OAll)-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-NH2.

[0104] The Ac-Glu(OAll)-Glu(OAll)-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-NH2 was added to a dichloromethane solution containing trifluoroacetic acid and stirred at room temperature for 25-35 min to obtain Ac-Glu(OAll)-Glu(OAll)-Met-Gln-Arg-Arg-Ala-Asp(OAll)-NH2.

[0105] The Ac-Glu(OAll)-Glu(OAll)-Met-Gln-Arg-Arg-Ala-Asp(OAll)-NH2 was dissolved in anhydrous dichloromethane, and tetrakis(triphenylphosphine)palladium and phenylsilane were added. The mixture was stirred at room temperature for 0.5-2 hours. After filtration and washing, the product Ac-Glu-Glu-Met-Gln-Arg-Arg-Ala-Asp-NH2, i.e., acetyl octapeptide-1, was obtained.

[0106] The present invention also provides the application of acetyl octapeptide-1 obtained by the method in the preparation of cosmetics.

[0107] The present invention will be further described below through specific embodiments.

[0108] In the following examples, Escherichia coli BL21(DE3) competent cells were purchased from Shanghai Weidi Biotechnology Co., Ltd., catalog number EC1002M; protein markers were purchased from Shanghai Yisheng Biotechnology Co., Ltd., catalog number 26616ES72; and enterokinase was purchased from Beyotime Biotechnology Co., Ltd., catalog number P4237-1000U.

[0109] Example 1

[0110] Figure 1 The structural formula of acetyl octapeptide-1 obtained in the embodiments of the present invention is as follows: Figure 1 As shown, this embodiment provides a method for preparing acetyl octapeptide-1 by combining chemical and biological methods, including the following steps:

[0111] (1) Protecting the synthesis of dipeptide H-Glu-Glu-OH

[0112] S1. Copper ion complexation to protect α-amino and α-carboxyl groups: 150g of glutamic acid (Glu) was dissolved in 500mL of water to prepare an aqueous solution of glutamic acid. The pH was adjusted to 9 with saturated sodium carbonate solution (Na2CO3) and stirred until the glutamic acid was completely dissolved. 127g of copper sulfate (CuSO4) was added, and the reaction was stirred at room temperature for 5 hours. After the reaction was completed, the mixture was filtered, the solid product was collected, and after drying, 132g of glutamic acid and copper ions (CuSO4) were obtained. 2+ Complexes;

[0113] S2. Introducing the OAll protecting group to protect the side chain carboxyl group: 132g of glutamic acid complex with copper ions, 105.12g of allyl bromide (OAll-Br) and 41.46g of potassium carbonate (K2CO3) were added to a 2L reactor containing 1L of N,N-dimethylformamide (DMF). The mixture was stirred at 60℃ for 3h, extracted with ethyl acetate, recrystallized by adding petroleum ether dropwise, and dried to obtain 403.12g of H-Glu(OAll)-OH complex with copper ions.

[0114] S3, Removal of copper ions (Cu) 2+ ): 403.12g of H-Glu(OAll)-OH complex with copper ions was added to a 1L reactor containing 500mL of ethyl acetate and stirred to dissolve. Then, nitrogen (N2) and hydrogen sulfide (H2S) were mixed at a volume ratio of 1:1 and injected into a balloon. The balloon was connected to the reactor and magnetically stirred until the balloon stopped shrinking. Stirring was then stopped, and the pH was adjusted to 3 with hydrochloric acid (HCl). The mixture was allowed to crystallize at 0℃ and dried to obtain 361.8g of solid product H-Glu(OAll)-OH.

[0115] S4, α-amino group introduced into Boc protecting group: 361.8g H-Glu(OAll)-OH and 349.7g ditert-butyl dicarbonate ((Boc)2O) were added to a 2L reactor containing 1L of 1,4-dioxane. The pH was adjusted to 10 by adding saturated sodium hydroxide solution dropwise at 0℃. The reaction was stirred at room temperature for 1h. After the reaction was completed, the pH was adjusted to 3 with HCl to obtain white crystals. After drying, 598.24g of product Boc-Glu(OAll)-OH was obtained.

[0116] S5, α-carboxyl group introduction of methyl ester protecting group: 299.12g of product Boc-Glu(OAll)-OH was dissolved in a 2L reactor containing 1L of dichloromethane solution at 0℃. Then, 500mL of diethyl ether solution (yellow) containing 10% diazonium methane was slowly added dropwise. Nitrogen gas was generated during the dropwise addition. The nitrogen gas was collected using a balloon until the balloon stopped increasing in size, indicating that the reaction was complete. After quenching with acetic acid, the mixture was concentrated to obtain 318.16g of solid product Boc-Glu(OAll)-OMe.

[0117] S6. Removal of Boc protecting group: 318.16g of solid product Boc-Glu(OAll)-OMe was added to a 2L reactor containing 800mL of dichloromethane solution containing 25% trifluoroacetic acid by mass. The mixture was stirred at room temperature for 20min. After extraction with ethyl acetate and removal of ethyl acetate by rotary evaporation, solid product H-Glu(OAll)-OMe was obtained.

[0118] S7. Synthesis of dipeptide Boc-Glu(OAll)-Glu(OAll)-OMe: 299.12 g of product Boc-Glu(OAll)-OH, 318.16 g of solid product H-Glu(OAll)-OMe, and 68.1 g of triethylamine were dissolved in a 2 L reactor containing 1 L of anhydrous dichloromethane to obtain a reaction system; 180 g of 2-ethoxy-1-ethoxycarbonyl-1,2-dihydroquinoline (EEDQ) was dissolved in 300 mL of anhydrous dichloromethane at 0 °C to obtain an EEDQ solution; the EEDQ solution was slowly added dropwise to the reaction system, and after the addition was complete, the reaction was carried out at room temperature for 2 h. After the reaction was completed, saturated sodium bicarbonate solution was added for washing, the organic phase was collected, washed with saturated sodium chloride solution, and dried with anhydrous sodium sulfate to obtain 462.96 g of solid product, namely dipeptide Boc-Glu(OAll)-Glu(OAll)-OMe;

[0119] S8. Removal of the methyl ester protecting group (synthesis of the protected dipeptide H-Glu-Glu-OH): Tetrahydrofuran (THF), methanol (MeOH), and water (H2O) were mixed in a volume ratio of 3:1:1 to prepare 1L of mixed solvent. 462.96g of the dipeptide Boc-Glu(OAll)-Glu(OAll)-OMe was added to the mixed solvent, followed by 29.5g of lithium hydroxide (LiOH). The mixture was stirred at room temperature for 2h. The pH was adjusted to 3 with HCl, and the precipitate was precipitated. After filtration, the product Boc-Glu(OAll)-Glu(OAll)-OH (i.e., the protected dipeptide H-Glu-Glu-OH) was obtained.

[0120] (2) Protecting the synthesis of the pentapeptide Met-Gln-Arg-Arg-Ala

[0121] Since the pentapeptide Met-Gln-Arg-Arg-Ala is an ultrashort peptide for biosynthesis and is easily degraded by microorganisms, this invention uses a fusion expression method (constructing a fusion polypeptide with the amino acid sequence shown in SEQ ID NO.1) and enzymatic cleavage to obtain the target polypeptide (pentapeptide Met-Gln-Arg-Arg-Ala). Because the fusion polypeptide carries a histidine tag at its N-terminus, it is suitable for purification using a nickel ion column (purchased from Wuhan Sangon Biotech Co., Ltd., HyPur P Ni-NTA 6FF (His-Tag) protein purification pre-packed column). The specific steps include:

[0122] S1. Construction of the recombinant vector pET30a-XXA-DK-5: The nucleotide sequence encoding the fusion polypeptide is shown in SEQ ID NO.2. It was synthesized by Wuhan Sangon Biotech Co., Ltd., and inserted into the pET30a plasmid via the restriction enzyme sites KpnI and XhoI to construct the recombinant plasmid pET30a-XXA-DK-5. The map of the recombinant plasmid pET30a-XXA-DK-5 is shown below. Figure 2 As shown:

[0123] S2. Transformation of E. coli competent cells: The recombinant plasmid pET30a-XXA-DK-5 was transformed into E. coli BL21(DE3) competent cells. After screening, single colonies were picked and cultured in 10 mL of LB medium at 37°C and 220 rpm for 12 h. 1 mL of the culture medium was added to 100 mL of TB medium and cultured in 37°C and 220 rpm for 6 h. Isopropyl-β-D-thiogalactopyranoside (IPTG) was added to a final concentration of 0.2 mmol / L, and the cells were induced to grow for 16 h at 25°C and 220 rpm. The cells were then collected by centrifugation. 50 mL of the culture medium was used to transform the cells into competent cells. Bacterial cells were resuspended in 0.1 mol / L phosphate buffer and sonicated on ice (sonication parameters were set as follows: power 400W, time 10 min, 10 s interval between sonications). The cells were then centrifuged at 4 °C and 12000 rpm, and the precipitate and supernatant were collected separately. Both the precipitate and the supernatant contained the fusion peptide.

[0124] The fusion peptides in the precipitate and supernatant were detected by protein electrophoresis, and their expression was observed by observing the protein electrophoresis images. Figure 3 ), Figure 3 The results showed that the fusion peptide could be expressed in Escherichia coli with a molecular weight of 23 KD;

[0125] S3. Purification and cleavage: The supernatant was purified using a nickel ion affinity column to obtain the purified fusion peptide; it was washed with phosphate buffer containing 10U of active enterokinase, and the wash solution was collected. The solution was then centrifuged using a Merck 3KD ultrafiltration tube to remove the enterokinase, and the filtrate was collected. The filtrate was then desalted by dialysis and lyophilized to obtain the pentapeptide Met-Gln-Arg-Arg-Ala.

[0126] SEQ ID NO.1 PKLRDAADQAAKSADGALDEGKAQARGLGEKADGKLESYKEKATDAVDEAHRRAEDTAGAGEAGKLGERAAGQADRGAGEAGGAADRVAREASGGLESATSKAGEAAESARQKASEYAEQAAAKVDGLTDAAKQEAYGLNQRQDQTVDRATEQVDAAAGTVTEKVKQAADSVAHKATEIASKAKDALSEDQMDDDDKMQRRA

[0127] SEQ ID NO.2 ccgaaactgcgcgatgcggcggatcaggcggcgaaaagcgcggatggcgcgctggatgaaggcaaagcgcaggcgcgcggcctgggcgaaaaagcggatggcaaactggaaagctataaagaaaaagcgaccgatgcggtggatgaagcgca tcgccgcgcggaagataccgcgggcgcgggcgaagcgggcaaactgggcgaacgcgcggcgggccaggcggatcgcggcgcgggcgaagcgggcggcgcggcggatcgcgtggcgcgcgaagcgagcggcggcctggaaagcgcgaccagca aagcgggcgaagcggcggaaagcgcgcgccagaaagcgagcgaatatgcggaacaggcggcggcgaaagtggatggcctgaccgatgcggcgaaacaggaagcgtatggcctgaaccagcgccaggatcagaccgtggatcgcgcgaccgaa caggtggatgcggcggcgggcaccgtgaccgaaaaagtgaaacaggcggcggatagcgtggcgcataaagcgaccgaaattgcgagcaaagcgaaagatgcgctgagcgaagatcagatggatgatgatgataaaatgcagcgccgcgcgtaa

[0128] S4. Introduction of Boc protecting group: 300g of pentapeptide Met-Gln-Arg-Arg-Ala and 495.4g of (Boc)2O were added to 2L of 1,4-dioxane. The pH value was adjusted to 9 by adding saturated sodium hydroxide solution dropwise at 0℃. The reaction was stirred at room temperature for 5h. After the reaction was completed, the pH value was adjusted to 3 with HCl, and crystals precipitated. After filtration, Boc-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-OH was obtained. Due to the steric hindrance of the side chain guanidine group and amino group, the α-amino Boc protecting group in Boc-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-OH was selectively removed to obtain H-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-OH.

[0129] S5. Introducing the Fmoc protecting group: 310.44 g of fluorene methoxycarbonyl chloride (Fmoc-Cl) and 512.74 g of H-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-OH were dissolved in 1.5 L of 1,4-dioxane. The pH was adjusted to 9 with saturated sodium carbonate solution. The reaction was carried out at 0 °C for 1 h and then at 25 °C for 5 h. After the reaction was completed, the pH was adjusted to 3 with HCl, and the precipitate was obtained to obtain Fmoc-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-OH (i.e., the protected pentapeptide Met-Gln-Arg-Arg-Ala).

[0130] (3) Synthesis of H-Asp(OAll)-OMe

[0131] S1, Copper Ion Complexation: 100g of aspartic acid (Asp) was dissolved in 90mL of water to prepare an aqueous solution of aspartic acid. The pH value was adjusted to 9 with saturated sodium carbonate solution (Na2CO3) and stirred until the glutamic acid was completely dissolved. 96g of copper sulfate (CuSO4) was added, and the reaction was stirred at room temperature for 5h. After the reaction was completed, the mixture was filtered, the solid product was collected, and after drying, 147.13g of aspartic acid complex with copper ions was obtained.

[0132] S2. Introduction of OAll protecting group: 147.13g of aspartic acid complex with copper ions, 111.16g of allyl bromide (OAll-Br) and 58.56g of potassium carbonate (K2CO3) were added to a 2L reactor containing 1L of N,N-dimethylformamide (DMF). The mixture was stirred at 60℃ for 3h, extracted with ethyl acetate, recrystallized by adding petroleum ether dropwise, and dried to obtain 276.15g of H-Asp(OAll)-OH complex with copper ions.

[0133] S3, Removal of copper ions (Cu) 2+ ): 276.15g of H-Asp(OAll)-OH complex with copper ions was added to a 1L reactor containing 500mL of ethyl acetate and stirred to dissolve. Then, nitrogen (N2) and hydrogen sulfide (H2S) were mixed at a volume ratio of 1:1 and injected into a balloon. The balloon was connected to the reactor and magnetically stirred until the balloon stopped shrinking. Stirring was then stopped, and the pH was adjusted to 3 with hydrochloric acid (HCl). The mixture was allowed to crystallize at 0℃ and dried to obtain 182.83g of solid product H-Asp(OAll)-OH.

[0134] S4: Introduction of methyl ester protecting group: 182.83g of H-Asp(OAll)-OH was dissolved in a 1L reactor containing 500mL of dichloromethane solution at 0℃, and then slowly added dropwise to 300mL of diethyl ether solution (yellow) containing 10% diazonium methane. Nitrogen gas was generated during the dropwise addition process. The nitrogen gas was collected using a balloon until the balloon stopped increasing in size, indicating that the reaction was complete. After quenching with acetic acid, the mixture was concentrated to obtain 252.16g of solid product H-Asp(OAll)-OMe.

[0135] (4) Synthesis of acetyl octapeptide-1:

[0136] Synthesis of S1, Fmoc-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OMe: Weigh the above H-Asp(OAll)-OMe, the above Fmoc-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-OH, and 2-ethoxy-1-ethoxycarbonyl-1,2-dihydroquinoline (EEDQ) in a mass ratio of 1.2:1:1.2; [The text abruptly ends here, likely due to an incomplete translation or missing information.] Arg(Boc)2-Ala-OH was mixed and dissolved in 500 mL of anhydrous dichloromethane to obtain a mixed solution. EEDQ was dissolved in 200 mL of anhydrous dichloromethane to obtain an EEDQ solution. The EEDQ solution was slowly added dropwise to the mixed solution at 0 °C. After the addition was complete, the reaction was carried out at room temperature for 2 h. After the reaction was completed, saturated sodium bicarbonate solution was added for washing. The organic phase was collected, washed with saturated sodium chloride solution, and dried with anhydrous sodium sulfate to obtain the product Fmoc-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OMe. S2. Removal of Fmoc protecting group: Fmoc-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OMe was added to an N,N-dimethylformamide solution containing 20% ​​piperidine by mass, and the mixture was stirred at room temperature for 30 min to obtain the product H-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OMe; Synthesis of S3, Boc-Glu(OAll)-Glu(OAll)-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OMe: Weigh Boc-Glu(OAll)-Glu(OAll)-OH, H-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OMe and 2-ethoxy-1-ethoxycarbonyl-1,2-dihydroquinoline (EEDQ) in a mass ratio of 1.5:1:1.2; [The text abruptly ends here, likely due to an incomplete translation or missing information.] (Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OMe was mixed and dissolved in 800 mL of anhydrous dichloromethane to obtain a mixed solution. EEDQ was dissolved in 200 mL of anhydrous dichloromethane to obtain an EEDQ solution. The EEDQ solution was slowly added dropwise to the mixed solution at 0 °C. After the addition was complete, the reaction was carried out at room temperature for 2 h. After the reaction was completed, saturated sodium bicarbonate solution was added for washing. The organic phase was collected, washed with saturated sodium chloride solution, and dried with anhydrous sodium sulfate to obtain the product Boc-Glu(OAll)-Glu(OAll)-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OMe. S4. Removal of the Boc protecting group from the N-terminus: Boc-Glu(OAll)-Glu(OAll)-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OMe was added to a dichloromethane solution containing 25% trifluoroacetic acid by mass, and the mixture was stirred at room temperature for 5 min to obtain the product H-Glu(OAll)-Glu(OAll)-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OMe; S5, N-terminal acetyl modification: A solution of dimethylformamide containing 20% ​​acetic anhydride and 35% N,N-diisopropylethylamine were mixed at a volume ratio of 1:1 to obtain a mixed solvent. H-Glu(OAll)-Glu(OAll)-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OMe were added at 30% content. The mixture was stirred at room temperature for 1 hour to obtain the product Ac-Glu(OAll)-Glu(OAll)-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OMe. S6. Removal of the C-terminal methyl ester protecting group: Tetrahydrofuran, methanol, and water were mixed in a volume ratio of 3:1:1 to prepare a mixed solvent. Lithium hydroxide (LiOH) and Ac-Glu(OAll)-Glu(OAll)-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OMe were added, and the mixture was stirred at room temperature for 2 hours. The pH was adjusted to 3 with HCl, and the precipitate was precipitated. After filtration, Ac-Glu(OAll)-Glu(OAll)-Met-Gln(Boc)-Arg(Boc)2-Ala-Asp(OAll)-OMe was obtained. rg(Boc)2-Ala-Asp(OAll)-OH; wherein the mass ratio of lithium hydroxide and Ac-Glu(OAll)-Glu(OAll)-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OMe is 37.5:1, and the mass fraction of Ac-Glu(OAll)-Glu(OAll)-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OMe in the mixed solvent is 35%; S7, C-terminal amino modification: Weigh Ac-Glu(OAll)-Glu(OAll)-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OH and 2-ethoxy-1-ethoxycarbonyl-1,2-dihydroquinoline (EEDQ) at a mass ratio of 3:1; [The text then repeats the process of adding Ac-Glu(OAll)-Glu(OAll)-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OH and 2-ethoxy-1-ethoxycarbonyl-1,2-dihydroquinoline (EEDQ).] A 10% (w / w) product solution was prepared by dissolving 11)-OH in anhydrous dichloromethane. An EEDQ solution was obtained by dissolving EEDQ in anhydrous dichloromethane. The EEDQ solution was slowly added dropwise to the product solution at 0°C. After the addition was complete, the reaction was carried out at room temperature for 15 min, and then ammonia gas was introduced and the reaction was carried out for 1.5 h to obtain the product Ac-Glu(OAll)-Glu(OAll)-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-NH2. S8. Removal of Boc protecting group from side chain: Ac-Glu(OAll)-Glu(OAll)-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-NH2 was added at 35% to a dichloromethane solution containing 25% trifluoroacetic acid by mass. The mixture was stirred at room temperature for 30 min and filtered to obtain the product Ac-Glu(OAll)-Glu(OAll)-Met-Gln-Arg-Arg-Ala-Asp(OAll)-NH2. S9. Removal of OAll protecting group: Dissolve Ac-Glu(OAll)-Glu(OAll)-Met-Gln-Arg-Arg-Ala-Asp(OAll)-NH2 in anhydrous dichloromethane at a concentration of 35%, add tetrakis(triphenylphosphine)palladium (Pd(Ph3)4), and slowly add benzenesilane (PhSiH3) under nitrogen protection. Stir the reaction at room temperature for 1 hour, filter, and wash with a dichloromethane solution of diisopropylethylamine to neutralize any possible residues. The palladium catalyst (Pd(Ph3)4) was removed and its complex was eliminated to prevent it from catalyzing subsequent side reactions, yielding the product Ac-Glu-Glu-Met-Gln-Arg-Arg-Ala-Asp-NH2, i.e., acetyl octapeptide-1; wherein the mass ratio of Ac-Glu(OAll)-Glu(OAll)-Met-Gln-Arg-Arg-Ala-Asp(OAll)-NH2, tetrakis(triphenylphosphine)palladium, and benzenesilane was 40:1:3.

[0137] Characterization

[0138] 1. The acetyl octapeptide-1 prepared in the embodiments of the present invention was subjected to proton and carbon spectroscopy, respectively. The results are as follows: Figure 4 and Figure 5 As shown.

[0139] Figure 4 The hydrogen spectrum of acetyl octapeptide-1 obtained in an embodiment of the present invention; Figure 5 This is the carbon spectrum of acetyl octapeptide-1 obtained in an embodiment of the present invention. Figure 4 and Figure 5 It can be seen that acetyl octapeptide-1 was successfully prepared using the method provided by the present invention.

[0140] 2. The acetyl octapeptide-1 prepared in the embodiments of the present invention was detected by liquid chromatography, and the results are as follows: Figure 6As shown. The instruments and conditions used for the detection were: Agilent 1260 liquid chromatograph; column: C18 (2.1 mm x 150 mm, 2.5 μm); mobile phase: a mixture of methanol, water, and 1 mol / L sodium chloride aqueous solution at a volume ratio of 2:6:2; flow rate: 0.5 mL / min; injection volume: 20 μL; detection wavelength: 280 nm; acetyl octapeptide-1 standard: purchased from Shanghai Yuanye Biotechnology Co., Ltd., catalog number S77424-100 mg.

[0141] Figure 6 The above are the liquid chromatography detection results of acetyl octapeptide-1 prepared in the embodiments of the present invention. Figure 6 It can be seen that the purity of acetyl octapeptide-1 obtained in the embodiments of the present invention is 97.93%, indicating that the method provided by the present invention can obtain acetyl octapeptide-1 with high purity.

[0142] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for preparing acetyl octapeptide-1 by a combination of chemical and biological methods, characterized by, The method comprises the following steps: Synthesis of the protected dipeptide H-Glu-Glu-OH: (a) using glutamic acid as raw material, through copper ion complexation, introduction of OAll protective group, removal of copper ion and introduction of Boc protective group, Boc-Glu(OAll)-OH is obtained; (b) the Boc-Glu(OAll)-OH is introduced into the methyl ester protective group and the Boc protective group is removed to obtain H-Glu(OAll)-OMe; (c) the Boc-Glu(OAll)-OH and the H-Glu(OAll)-OMe are subjected to amide condensation reaction to obtain dipeptide Boc-Glu(OAll)-Glu(OAll)-OMe; (d) the dipeptide Boc-Glu(OAll)-Glu(OAll)-OMe is removed by methyl ester protective group to obtain Boc-Glu(OAll)-Glu(OAll)-OH, that is, the protected dipeptide H-Glu-Glu-OH; Synthesis of the protected pentapeptide Met-Gln-Arg-Arg-Ala: (e) the nucleotide sequence as shown in SEQ ID NO. 2 is inserted into pET30a plasmid through enzyme cutting sites KpnI and XhoI to construct a recombinant plasmid pET30a-XXA-DK-5; (f) the recombinant plasmid pET30a-XXA-DK-5 is transformed into E. coli competent cells to obtain a fusion polypeptide; (g) the fusion polypeptide is purified and cut to obtain the pentapeptide Met-Gln-Arg-Arg-Ala; (h) the pentapeptide Met-Gln-Arg-Arg-Ala is introduced into the Boc protective group, the Boc protective group on the alpha amino group is removed and the Fmoc protective group is introduced to obtain Fmoc-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-OH, that is, the protected pentapeptide Met-Gln-Arg-Arg-Ala; Synthesis of H-Asp(OAll)-OMe: (i) using aspartic acid as raw material, through copper ion complexation, introduction of OAll protective group, removal of copper ion and introduction of methyl ester protective group, H-Asp(OAll)-OMe is obtained; Synthesis of acetyl octapeptide-1: (j) the H-Asp(OAll)-OMe and the Fmoc-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-OH are subjected to amide condensation reaction to obtain Fmoc-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OMe; (k) removing the Fmoc protecting group from the Fmoc-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OMe to obtain H-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OMe; (l) carrying out an amide condensation reaction between the Boc-Glu(OAll)-Glu(OAll)-OH and the H-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OMe to obtain Boc-Glu(OAll)-Glu(OAll)-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OMe; (m) sequentially removing the Boc protecting group from the N-terminus, acetyl-modifying the N-terminus, removing the methyl ester protecting group from the C-terminus, modifying the amino group at the C-terminus, removing the Boc protecting group from the side chain, and removing the OAll protecting group from the Boc-Glu(OAll)-Glu(OAll)-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OMe to obtain the product Ac-Glu-Glu-Met-Gln-Arg-Arg-Ala-Asp-NH2, i.e., the acetyl octapeptide-1.

2. The method for preparing acetyl octapeptide-1 by combining chemical method with biological method according to claim 1, characterized in that, Step (a) specifically comprises: (1) dissolving glutamic acid in water, adjusting the pH value to 8-9, and then carrying out a complexation reaction after adding copper sulfate to obtain a glutamic acid and copper ion complex; (2) adding the glutamic acid and copper ion complex, allyl bromide, and potassium carbonate into an N,N-dimethylformamide solution, stirring and reacting at 50-60°C for 1-4h, and then introducing the OAll protecting group to obtain H-Glu(OAll)-OH and a copper ion complex; (3) removing the copper ion from the H-Glu(OAll)-OH and copper ion complex to obtain H-Glu(OAll)-OH; (4) adding the H-Glu(OAll)-OH and di-tert-butyl dicarbonate into 1,4-dioxane, adjusting the pH value to 9-10, stirring and reacting at room temperature for 0.5-2h, adjusting the pH value to 2-3, and then introducing the Boc protecting group to obtain Boc-Glu(OAll)-OH.

3. The method for preparing acetyl octapeptide-1 by combining chemical method with biological method according to claim 2, characterized in that, The mass ratio of the glutamic acid to the copper sulfate is 1:(0.7-0.9); The mass ratio of the glutamic acid and copper ion complex to the allyl bromide and the potassium carbonate is 1:(0.7-0.8):(0.3-0.4); The mass ratio of the H-Glu(OAll)-OH to the di-tert-butyl dicarbonate is 1:(0.9-1.2).

4. The method for preparing acetyl octapeptide-1 by combining chemical method with biological method according to claim 1, characterized in that, In step (c), the mass ratio of the Boc-Glu(OAll)-OH to the H-Glu(OAll)-OMe is 1:(1-1.1).

5. The method for preparing acetyl octapeptide-1 by combining chemical method with biological method according to claim 1, characterized in that, Step (f) specifically comprises: The recombinant plasmid pET30a-XXA-DK-5 is transformed into an E. coli competent cell, screened, and a single colony after screening is picked and cultured in an LB medium at 35-38°C and 200-240 rpm for 8-15 h to obtain a culture solution; the culture solution is cultured in a TB medium at 35-38°C and 200-240 rpm for 4-6 h, 0.15-0.3 mmol / L of isopropyl-β-D-thiogalactopyranoside is added, and the culture is induced at 23-26°C and 200-240 rpm for 14-16 h, and the bacterial cells are collected by centrifugation; the bacterial cells are resuspended with a phosphate buffer, broken by ultrasonic, centrifuged at 3-5°C and 10,000-12,000 rpm, and the supernatant is collected to obtain the fusion polypeptide; wherein the ultrasonic breaking parameters are set as follows: a power of 400 W and a time of 10 min, with an interval of 10 s for each 10 s of ultrasonic.

6. The method for preparing acetyl octapeptide-1 by combining chemical method with biological method according to claim 1, characterized in that, Step (g) specifically comprises: After the fusion polypeptide is purified by a nickel ion affinity column, the fusion polypeptide is cut with an enterokinase-containing phosphate buffer to obtain a pentapeptide Met-Gln-Arg-Arg-Ala.

7. The method for preparing acetyl octapeptide-1 by combining chemical method with biological method according to claim 1, characterized in that, Step (h) specifically comprises: The pentapeptide Met-Gln-Arg-Arg-Ala and di-tert-butyl dicarbonate are added to 1,4-dioxane, the pH value is adjusted to 9-10, and the reaction is stirred at room temperature for 5 h, the pH value is adjusted to 2-3, and a Boc protecting group is introduced to obtain Boc-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-OH; The Boc-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-OH is subjected to removal of a Boc protecting group on an α-amino group to obtain H-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-OH; The H-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-OH and fluorenylmethoxycarbonyl chloride are added to 1,4-dioxane, the pH value is adjusted to 9-10, the reaction is performed at 0°C for 1-1.5 h and then at 24-26°C for 4-6 h, the pH value is adjusted to 2-3, and a Fmoc protecting group is introduced to obtain Fmoc-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-OH, i.e., a protected pentapeptide Met-Gln-Arg-Arg-Ala.

8. The method for preparing acetyl octapeptide-1 by combining chemical method with biological method according to claim 1, characterized in that, In step (j), the mass ratio of the H-Asp(OAll)-OMe to the Fmoc-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-OH is (1.1-1.2):

1. And / or, in step (l), the mass ratio of Boc-Glu(OAll)-Glu(OAll)-OH to H-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OMe is (1.3-1.5):

1.

9. The method for preparing acetyl octapeptide-1 by combining chemical method with biological method according to claim 1, characterized in that, Step (m) specifically comprises: Boc-Glu(OAll)-Glu(OAll)-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OMe is obtained by removing the Boc protecting group at the N-terminus; A solution of acetic anhydride in dimethylformamide is mixed with diisopropylethylamine at a volume ratio of 1:1, and H-Glu(OAll)-Glu(OAll)-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OMe is added, and the reaction is stirred at room temperature for 0.5-2h to obtain Ac-Glu(OAll)-Glu(OAll)-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OMe; Tetrahydrofuran, methanol and water are mixed at a volume ratio of 3:1:1, lithium hydroxide and Ac-Glu(OAll)-Glu(OAll)-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OMe are added, and the reaction is stirred at room temperature for 1-3h, the pH value is adjusted to 2-3, and the precipitate is obtained to obtain Ac-Glu(OAll)-Glu(OAll)-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OH; EEDQ is dissolved in anhydrous dichloromethane to obtain an EEDQ solution, the EEDQ solution is added dropwise to Ac-Glu(OAll)-Glu(OAll)-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-OH at 0°C, and after the addition is completed, the reaction is carried out for 10-20min, ammonia gas is introduced, and the reaction is carried out for 1-3h to obtain Ac-Glu(OAll)-Glu(OAll)-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-NH2; Ac-Glu(OAll)-Glu(OAll)-Met-Gln(Boc)-Arg(Boc)2-Arg(Boc)2-Ala-Asp(OAll)-NH2 was added to a solution of trifluoroacetic acid in dichloromethane and stirred at room temperature for 25-35 min to obtain Ac-Glu(OAll)-Glu(OAll)-Met-Gln-Arg-Arg-Ala-Asp(OAll)-NH2; Ac-Glu(OAll)-Glu(OAll)-Met-Gln-Arg-Arg-Ala-Asp(OAll)-NH2 was dissolved in anhydrous dichloromethane, tetra(triphenylphosphine)palladium and phenylsilane were added, and the reaction was stirred at room temperature for 0.5-2 h to obtain the product Ac-Glu-Glu-Met-Gln-Arg-Arg-Ala-Asp-NH2, i.e. acetyl octapeptide-1, after filtration and washing.

10. Use of acetyl octapeptide-1 prepared by the method of any one of claims 1-9 in the preparation of a cosmetic product.

Images