Antisense oligonucleotide and application of antisense oligonucleotide in preparation of medicine for treating neuronal intracellular inclusion body disease

Abstract

The invention discloses antisense oligonucleotide and application thereof in preparation of a medicine for treating a neuronal intracellular inclusion body disease, and relates to the technical field of biological medicine. The invention provides an antisense oligonucleotide capable of specifically targeting an abnormal CGG repetitive amplification transcript of a NOTCH2NLC gene and a preparation method of the antisense oligonucleotide. The antisense oligonucleotide comprises a nucleotide sequence which is complementarily paired with a base in a 5 'UTR region containing a CGG repetitive sequence in a NOTCH2NLC gene, and aims to reduce the expression of toxic RNA and protein, so that a brand-new and effective treatment means is provided for treating the neuronal intracellular inclusion body disease; according to the invention, the abnormal repeated mRNA target of the NOTCH2NLC gene is found, and interference is carried out on the target, so that the generation of toxic RNA aggregation lesions and pathogenic inclusion bodies can be effectively reduced, and the pathological phenotype of a disease model is reversed. The antisense oligonucleotides of the present invention can be used for the treatment of neuronal intracellular inclusion body diseases.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to an antisense oligonucleotide and its use in the preparation of a medicament for treating neuronal intranuclear inclusion body disease. Background Technology

[0002] Neuronal intranuclear inclusion disease (NIID) is a rare neurodegenerative disease characterized by the presence of eosinophilic inclusion bodies within the nuclei of neurons. Subsequent studies have revealed high heterogeneity in the clinical phenotype of NIID patients. While the nervous system is the primary target organ, various systems throughout the body can be affected. The pathogenic variants are human-specific. NOTCH2NLC An aberrant duplication of the CGG gene is observed in the 5'-untranslated region (5'UTR). Current research suggests... NOTCH2NLC The gain-of-function mechanism of CGG gene repeat amplification includes RNA toxicity and protein toxicity, and is a major pathogenesis of NIID. RNA toxicity manifests as the transcription of long, high-GC-content nucleic acid repeat sequences, which may form specific palindromic RNA structures (RNA foci). These foci can abnormally recruit some important intracellular RNA-binding proteins, affecting their levels and functions, leading to corresponding cellular dysfunction. Studies on protein toxicity show... NOTCH2NLC There is a classic AUG start codon upstream of the CGG repeat sequence in the 5'UTR region of the gene, therefore... NOTCH2NLC The gene forms an upstream open reading frame (uORF). When CGG aberrantly amplifies, this uORF enables the transcription and translation of a toxic protein containing polyglycine (polyG). These two mechanisms are not mutually exclusive but rather work together, pointing to a common upstream molecular mechanism, namely… NOTCH2NLC The CGG repeat sequence in the 5'UTR region of a gene is transcribed into an abnormal RNA sequence. Therefore, targeted silencing of this abnormally transcribed RNA may be an effective target for the treatment of NIID.

[0003] Antisense oligonucleotides (ASOs) are short, single-stranded oligonucleotides synthesized artificially. Based on the principle of complementary base pairing, they specifically bind to the mRNA sequence of target genes, regulating the expression of those genes. The classic mechanism of ASO action is as follows: ASO binds to target mRNA to form an ASO-mRNA heteroduplex, thereby recruiting ribonuclease H (RNase H). This enzyme specifically cleaves the mRNA strand in the heteroduplex, downregulating the target mRNA and thus reducing protein expression levels. Summary of the Invention

[0004] The purpose of this invention is to at least solve one of the technical problems existing in the prior art, and to provide an antisense oligonucleotide and its use in the preparation of a drug for treating neuronal intranuclear inclusion body disease, specifically disclosing a method capable of specifically targeting NOTCH2NLC Antisense oligonucleotides of the abnormal CGG repeat amplified transcript and their use in the preparation of drugs for treating neuronal intranuclear inclusion body disease.

[0005] The purpose of this invention is to provide a method capable of specifically targeting NOTCH2NLC Antisense oligonucleotides of the abnormal CGG repeat amplified transcript are designed to reduce the expression of toxic RNA and proteins, thus providing a novel and effective treatment for neuronal intranuclear inclusion body disease.

[0006] The technical solution of the present invention is as follows: A first aspect of the present invention provides an antisense oligonucleotide comprising a nucleotide sequence complementary to the bases of the 5'UTR region containing the CGG repeat sequence in the NOTCH2NLC gene.

[0007] This invention found NOTCH2NLC Interfering with abnormally repetitive mRNA targets can effectively reduce the formation of toxic RNA foci and pathogenic inclusion bodies, and reverse the pathological phenotype in disease models. The antisense oligonucleotides of this invention can be used to treat neuronal intranuclear inclusion body disease.

[0008] Optionally, the nucleotide sequence of the antisense oligonucleotide is 20 nucleotides in length.

[0009] Optionally, the nucleotide sequence of the antisense oligonucleotide is: 5'-GCCGCCGCCGCCTGGGCAGA-3'.

[0010] Optionally, the antisense oligonucleotide is also chemically modified.

[0011] Optionally, the chemical modification includes full-chain modification with thiophosphates.

[0012] Optionally, the chemical modification includes modification with at least 1 nt of 2'-O-methyl (2'-OMe) at both the 5' and 3' ends.

[0013] Optionally, the chemical modification includes modification with 1nt to 5nt of 2'-O-methyl (2'-OMe) at the 5' end and 3' end, respectively.

[0014] Optionally, the chemical modification includes modification with 2'-O-methyl (2'-OMe) having 5nt at both the 5' and 3' ends.

[0015] The nucleotides modified by the above chemical method exhibit high stability, strong targeting affinity, and low immunogenicity. This sequence targets the amplified CGG repeat and adds an 8-nt upstream of the CGG repeat to improve sequence specificity and reduce off-target effects.

[0016] A second aspect of the invention provides the use of the aforementioned antisense oligonucleotide in the preparation of a medicament for treating neuronal intranuclear inclusion body disease.

[0017] Experiments have shown that, after using the ASO of the present invention, a significant reduction in pathogenic inclusion bodies and toxic RNA, and an improvement in cell viability can be observed in a neuronal intranuclear inclusion body disease cell model; in a transgenic mouse model of neuronal intranuclear inclusion body disease, local injection of the ASO of the present invention into the hippocampus can reduce intranuclear inclusion bodies.

[0018] A third aspect of the present invention provides a medicament for treating neuronal intranuclear inclusion body disease, the medicament comprising the aforementioned antisense oligonucleotide.

[0019] Experiments have shown that, after using the ASO of the present invention, a significant reduction in pathogenic inclusion bodies and toxic RNA, and an improvement in cell viability can be observed in a neuronal intranuclear inclusion body disease cell model. In a transgenic mouse model of neuronal intranuclear inclusion body disease, local injection of the ASO of the present invention into the hippocampus can reduce intranuclear inclusion bodies. Therefore, the antisense oligonucleotide described herein can be used as a drug to treat neuronal intranuclear inclusion body disease.

[0020] This invention has at least one of the following beneficial effects: Compared with the prior art, the present invention has the following significant advantages: (1) High specificity and targeting: Compared to ASOs designed solely for CGG repetition, the ASO designed in this invention can precisely target the pathogenic source. NOTCH2NLC Abnormal GGC repeats in genes amplify transcripts without affecting the function of wild-type alleles or other normal genes, fundamentally intervening in the disease process and achieving true precision medicine.

[0021] (2). Efficient degradation of pathogenic RNA: By designing ASO that can recruit RNase H1, it can efficiently and specifically cleave and degrade mRNA containing abnormal GGC repeats, thereby significantly reducing the formation of toxic RNA nuclear foci and the expression of toxic polyG proteins.

[0022] (3). Improvement of disease pathological phenotype: Preclinical experiments showed that after using the ASO of the present invention, a significant reduction in pathogenic intranuclear inclusions and RNA toxicity foci and an improvement in cell viability could be observed in the neuronal intranuclear inclusion body disease cell model.

[0023] (4) Favorable pharmacokinetic properties: Advanced chemical modifications to ASO (such as thiophosphate skeleton and 2'-OMe modification) greatly enhance its stability in vivo, prolong its half-life, and improve its bioavailability in the central nervous system after crossing the blood-brain barrier or being administered intrathecally.

[0024] (5) High safety: Due to the high specificity of its mechanism of action and sequence, the risk of off-target effects is low and the potential side effects are minimal. Compared with small molecule drugs or gene therapy, ASO does not integrate into the genome, resulting in extremely low genetic risk.

[0025] (6) Providing a novel treatment strategy: This invention provides the first etiology-guided disease-modifying therapy for neuronal intranuclear inclusion body disease, which is currently incurable by any drug. It fills a gap in this field and has significant clinical value and market prospects. Attached Figure Description

[0026] Figure 1 The figure shows the experimental results of the stability test of the modified ASO and the unmodified ASO in Embodiment 2 of the present invention.

[0027] Figure 2 This is a diagram showing the experimental results of the affinity between ASO and target RNA in Example 3 of the present invention.

[0028] Figure 3 This is a diagram showing the experimental results of ASO successfully penetrating the membrane and entering the nucleus in Example 4 of the present invention.

[0029] Figure 4 This is an immunofluorescence image from Example 5 of the present invention.

[0030] Figure 5 This is an immunoblotting image from Embodiment 5 of the present invention.

[0031] Figure 6 This is an RT-qPCR detection diagram from Example 5 of the present invention.

[0032] Figure 7This is a diagram showing the experimental results of RNA FISH in Example 6 of the present invention.

[0033] Figure 8 This is a diagram showing the experimental results of PCR in Example 6 of the present invention.

[0034] Figure 9 This is a diagram showing the experimental results of cell viability in Example 7 of the present invention.

[0035] Figure 10 This is a diagram showing the experimental results of the transgenic mouse model in Example 8 of the present invention.

[0036] Figure 11 This is a diagram showing the experimental results of the distribution of ASO6-cy3 in the brain of transgenic mice after hippocampal injection in Example 9 of this invention.

[0037] Figure 12 This is an immunofluorescence image of the hippocampus after ASO6-cy3 injection in Example 10 of the present invention.

[0038] Figure 13 This is an immunoblot image of the hippocampus after ASO6-cy3 injection in Example 10 of the present invention. Detailed Implementation

[0039] To make the technical problems solved, the technical solutions, and the beneficial effects of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

[0040] Example 1: ASO Design against NOTCH2NLC ASO6 was designed using the mRNA sequence transcribed from the 5'UTR region (containing the CGG repeat) of the gene (specifically, the sequence is 5'-TCTGCCCAGGCGGCGGCGGC-3'). The specific design strategy is as follows: (1) Selection of ASO binding sites: based on NOTCH2NLC The mRNA sequence of the gene was used to select the 5'UTR (untranslated region) as a potential region for ASO binding.

[0041] (2) Design ASO sequence: Design an ASO sequence with a length of 20 bases.

[0042] (3) Sequence alignment: The designed ASO sequence is aligned with other gene sequences on the NCBI website to confirm that there are no other non-specific bindings except for homologous genes, thereby reducing off-target effects.

[0043] (4) Chemical Modification: 1) Improved Stability: Full-chain phosphate thioate (PS) modification is selected to improve the resistance of ASO to nuclease degradation and prolong its half-life in vivo. PS modification refers to the replacement of oxygen atoms in the phosphodiester bond with sulfur atoms. 2) Enhanced Binding Ability: 2'-O-methyl (2'OMe) modification is selected to enhance the binding affinity of ASO to target RNA and improve efficacy. 2'OMe modification is the addition of a methyl (-CH3) group at the 2' position of the ribose. 3) Synthesis of Modified Monomers: Using solid-phase synthesis technology, the modified monomers are gradually linked to the ASO sequence to form a complete modified ASO. 4) Purification and Detection: The modified ASO is purified using high-performance liquid chromatography (HPLC) and other methods to remove impurities and unreacted modified monomers. The purity and molecular weight of the modified ASO are detected using mass spectrometry (MS) and other methods to ensure that its quality meets the requirements.

[0044] The ASO of the present invention (i.e., experimental group ASO6) was designed according to the above method. The sequence length of the ASO of the present invention is 20 nucleotides, and the specific sequence is "GCCGCCGCCGCCTGGGCAGA" (5'→3'). It is modified with phosphate thioester for full chain modification and 2'-O-methyl (2'-OMe) modification combination at both ends of 5nt.

[0045] To verify the effectiveness and specificity of ASO6 in improving the pathology of the disease model, this embodiment also designed ASO1 targeting the abnormal CGG repeat sequence. The sequence of ASO1 is CCGCCGCCGCCGCCGCCG, and ASO1 is a combination of full-chain phosphate thioester modification and 2'-O-methyl (2'-OMe) modification at both ends (4 nt each). In this experimental example, ASO1 was used as a positive control, but it cannot be used for clinical translation due to its extremely high off-target probability. This embodiment also includes a control ASO (hereinafter referred to as the NTC group). The control ASO uses a no-targeting control (NTC) sequence, which was provided by Guangzhou Ruibo Biotechnology Co., Ltd. NOTCH2NLC The mRNA sequence transcribed from the gene has no complementary base pairings and has been verified not to interfere with mammalian genome expression. After the ASO was designed, it was synthesized, modified, and purified by HPLC by Guangzhou Ruibo Biotechnology Co., Ltd.

[0046] Example 2: In vivo stability testing of ASO6 and unmodified ASO6: In Example 1, both the unmodified ASO6 and the chemically modified ASO6 had a Cy3 fluorescent group added to their 5' ends. At the same concentration (80 nM), they were transfected into HEK293T cells using the transfection reagent Lipo8000 (Beyotime, C0533). After 72 hours, the cells were fixed with 4% paraformaldehyde (White Shark, BL539A) for 10 minutes. An appropriate amount of DAPI (Roche, 10236276001) was added to the culture medium in proportion, and the distribution of ASO in the cells was observed using a Zeiss inverted fluorescence microscope.

[0047] Depend on Figure 1 It can be seen that the chemically modified ASO6 in the experimental group was still widely distributed in the cytoplasm and nucleus 72 hours after transfection, while the unmodified ASO6 was only scattered and did not enter the nucleus, suggesting that the stability of chemically modified ASO6 in cells was significantly improved.

[0048] Example 3: Affinity of ASO6 to target RNA The affinity of the experimental group ASO6 and the control ASO for the target RNA in Example 1 was simultaneously evaluated using MST (micro-thermophoresis). The specific method is as follows: 5' end cy5 fluorescently labeled target ASO (i.e., NTC and ASO6 in Example 1) was mixed with RNA (r(CGG)) transcribed in vitro using T7 at a series of concentration gradients. 100 The binding reaction between nucleic acids was performed. First, two targets, NTC-cy5 and ASO6-cy5, were diluted to a constant concentration (50 nM) in DNA buffer (25 mM HEPES pH 7.4, 100 mM NaCl, 0.05% Tween 20). The analyte r(CGG)100 was serially diluted to prepare multiple concentration points covering values ​​from below the expected dissociation constant (KD) to much higher than the KD value. Equal volumes of target solutions were mixed with ligand solutions of each concentration and incubated at room temperature for 15 minutes to reach binding equilibrium. Subsequently, the mixed solution was aspirated into a standard MST capillary tube. Measurements were performed using a microthermophoresis apparatus (NanoTemper) with the following instrument parameters: at a preset constant temperature of 25°C, an infrared laser was used to locally generate a precise temperature gradient in the capillary tube to induce thermophoresis; simultaneously, the distribution changes of fluorescent molecules within the temperature gradient region were monitored by a fluorescence module. Record the normalized fluorescence intensity variation (ΔF_norm) at different ligand concentrations. The experimental data are analyzed using the instrument's software or a nonlinear fitting model (e.g., a unit point binding model using the law of mass action) to calculate the dissociation constant (KD value) of the two ligands, thereby characterizing their binding affinity.

[0049] To quantify the degree of binding, the normalized fluorescence intensity change (ΔF_norm) is converted into a binding fraction (Fraction Bound) on the ordinate. Specifically, the binding fraction on the ordinate is calculated using the following formula: Fraction Bound = (ΔF_norm - ΔF_free) / (ΔF_bound - ΔF_free) Here, ΔF_free represents the baseline signal when the target molecule is completely unbound, typically corresponding to the measurement value when the ligand concentration is zero; ΔF_bound represents the plateau signal when the target molecule is saturated with ligands, typically taken from the average measurement value at high ligand concentrations. Thus, the binding fraction corresponding to each ligand concentration point can be obtained, with values ​​between 0 (unbound) and 1 (fully bound). Experimental data are analyzed using instrument-compatible software or nonlinear fitting models. Typically, the ligand concentration and corresponding binding fraction are fitted using a unit point binding model based on the law of mass action (e.g., FrictionBound = [L] / (KD + [L]), where [L] is the ligand concentration), to calculate the dissociation constant (KD value), which characterizes the binding affinity.

[0050] The results are as follows Figure 2 As shown, the KD value of the control ASO is 2.60 μM ( Figure 2 The green curve in the figure shows that the KD value of ASO6 in the experimental group was 0.0164 μM. Figure 2 (The red curve in the figure shows that, compared with the control ASO, the experimental group ASO6 designed in Example 1 has a higher affinity for the target RNA.)

[0051] Example 4: ASO6 successfully transmembrane and enters the nucleus. A cy3 fluorescent group was added to the 5' end of ASO6 and transfected into HEK293T cells at different concentrations using the transfection reagent lipo8000 (Beyotime, catalog number C0533). After 48 hours, the cells were fixed with 4% paraformaldehyde (White Shark, BL539A) for 10 minutes. An appropriate amount of DAPI (Roche, 10236276001) was added to the culture medium according to the ratio, and the distribution of ASO in the cells was observed using a Zeiss inverted fluorescence microscope.

[0052] The results are as follows Figure 3 As shown, by Figure 3 It can be seen that 20 nM ASO6-cy3 can clearly enter the cell. As the concentration increases, the amount of ASO6 entering the nucleus increases significantly. At a concentration of 100 nM, the efficiency of entering the nucleus is almost 80% or more. Therefore, the ASO6 in the experimental group designed in Example 1 can successfully pass through the membrane and enter the nucleus (the nucleus is the main site for ASO degradation), and this is concentration-dependent.

[0053] Example 5: ASO6 effectively reduced inclusion bodies in the NIID cell model. HEK293T cells were transfected NOTCH2NLC The 5'UTR region of the gene contains a plasmid (CGG) with 100 CGG repeats. 100 -GFP was used to construct a cell model of neuronal intranuclear inclusion body disease. After plasmid transfection, numerous GFP-positive inclusion bodies were formed and co-localized with p62. Four hours after plasmid transfection, the cells were transfected using Lipo2000 transfection reagent (Thermo Fisher Scientific, 11668019). ） Transfected cells with 80 nM ASO6 and NTC. 48 hours after ASO transfection, cells were fixed in 24-well plates with 4% paraformaldehyde for 15 minutes, permeabilized with 0.3% Triton-100 for 30 minutes, blocked with 3% BSA for 1 hour, and incubated overnight at 4°C with immunofluorescence primary antibody p62 (abcam, ab207305). The next day, cells were incubated with secondary antibody (594 fluorescent secondary antibody used in this study) at room temperature for 2 hours, followed by DAPI incubation for 10 minutes. Finally, the cells were washed, mounted, and observed under a confocal microscope.

[0054] The results are as follows Figures 4-6 As shown, by Figure 4 The immunofluorescence images show that as the concentration of ASO increases, inclusion bodies (…) Figure 4 The reduction in GFP fluorescence became increasingly pronounced; at a concentration of 100 nM ASO, GFP-positive inclusion bodies almost disappeared. Figure 5 The immunoblotting data show that with increasing ASO concentration, insoluble inclusion bodies (upper gel portion) significantly decrease; at a concentration of 100 nM ASO, insoluble inclusion bodies almost disappear. Figure 6 The RT-qPCR plots show that as the ASO concentration increases, the mRNA level of GFP (the tag of the overexpressing polyG plasmid) decreases significantly.

[0055] The above results indicate that ASO can effectively reduce inclusion bodies in the NIID cell model. Therefore, the experimental group ASO6 designed in Example 1 can be used to treat NIID.

[0056] Example 6: ASO6 can effectively reduce RNA aggregation foci and correct downstream alternative splicing disorders. Fluorescent in situ hybridization (FISH) of RNA was performed according to the Beyotime Biotechnology FISH Kit for RNA assay: Cells cultured in 24-well plates were fixed with 4% paraformaldehyde for 10 minutes, washed with PBS, and digested with 5% proteinase K at room temperature for 5 minutes. After permeabilization, the cells were fixed again with 4% paraformaldehyde at room temperature for 10 minutes. Then, an appropriate amount of 0.5M HCl was added and the cells were washed with shake at room temperature for 5 minutes to neutralize basic proteins. After washing with PBS, an appropriate amount of acetylation solution was added to immerse the sample, and the cells were washed with shake at room temperature for 10 minutes for acetylation treatment. An appropriate amount of hybridization solution containing Yeast RNA (1X) was added for pre-hybridization, and the cells were incubated at 37°C in the dark for 20 minutes. The hybridization solution containing the probe was placed at 37°C in the dark and shaken for 20 minutes, then immediately placed on ice for 2 minutes to remove the hybridization solution. The sample was then immersed in the hybridization solution containing the probe, sealed, and incubated at 37°C in the dark overnight. The next day, the sample was washed with washing buffer according to the instructions, and finally incubated with DAPI for 10 minutes. Wash twice with enzyme-free PBS for 5 minutes each time between each medium change, and perform enzyme-free operation throughout the entire process.

[0057] The results are as follows Figure 7 As shown, compared with the NTC group, the number of RNA foci was significantly reduced after administration of 80 nM ASO6.

[0058] Alternative splicing analysis: For SAM68-dependent alternative splicing analysis induced by CGGexp expression, we used HEK293T cells, seeded in 24-well plates, and transfected each well with 250 ng of (CGG)9 or (CGG)9. 100Plasmid, 250 ng SMN2 mini gene, and 80 nM NTC-ASO (i.e., control ASO), ASO1, and ASO6 were used. Forty-eight hours after transfection, cells were lysed using TRIzol reagent (Thermo Fisher Scientific, 15596018CN), and total RNA was extracted according to the manufacturer's instructions. cDNA synthesis was performed using the HiScript® III All-in-one RT SuperMix reverse transcription system (Novizan, R333), following the manufacturer's guidelines. qPCR reactions were performed using 2 × Taq Plus Master Mix (Novizan, P212). The SMN2 primer sequences were as follows: SMN2_F: 5'-GGTGTCCACTCCCAGTTCAA-3', SMN2_R: 5'-GCCTCACCACCGTGCTGG-3'. PCR products were separated by electrophoresis on a 2% agarose gel containing ethidium bromide. Images were acquired using BioRad. Signal intensity of the PCR products was analyzed using ImageJ. The inclusion level of alternatively spliced ​​exons is quantified using the percent of alternative exon spliced ​​in (PSI). PSI is calculated based on the signal intensity of bands representing different splice isomers in the gel electrophoresis image, using the following formula: PSI = (Signal intensity of isomers containing exons / (Signal intensity of isomers containing exons + Signal intensity of isomers not containing exons)) × 100%.

[0059] The results are as follows Figure 8 As shown in a, HEK-293T cells were transfected... NOTCH2NLC The 5'UTR region of the gene contains a plasmid (CGG) with 100 CGG repeats. 100 -GFP was used to construct a cell model of neuronal intranuclear inclusion body disease. The control group was prepared by transfecting the plasmid CGG9-GFP with nine CGG repeats. NIID cell model group (CGG) 100 Compared with the control group (CGG)9, the PSI was abnormally elevated, suggesting the presence of alternative splicing disorder; Figure 8 As shown in b, after administering NTC-ASO (i.e., control ASO), experimental group ASO6, and ASO1 (ASO targeting only CGG repeats), it was found that only experimental group ASO6 could partially correct the alternative splicing disorder (UT was the untreated group, which was only transfected with the corresponding plasmid). This indicates that experimental group ASO6 designed in Example 1 can be used to alleviate the RNA toxicity of NIID.

[0060] Example 7: ASO6 can improve cell viability in the NIID cell model. Cell viability was measured using a CCK8 assay (Cell Counting Kit-8, GLPBIO, GK10001). The specific procedure was as follows: Cell seeding and culture: Cells were seeded at a rate of 10 cells per well. 3 Cells were seeded at a density of [number] cells / wells in a 96-well plate, with 100 μL of culture medium added to each well. The plates were incubated at 37°C with 5% CO2 for 48 hours. CCK-8 addition and incubation: 10 μL of CCK-8 solution was added to each well, avoiding air bubbles, and incubated for 1 hour. After incubation, the plates were gently shaken for 1 minute to ensure uniform color development. Absorbance detection: The absorbance of each well was measured at 450 nm using a microplate reader. Cell viability was calculated using the following formula: Cell viability (%) = [(As-Ab) / (Ac-Ab)] × 100; As = absorbance of experimental wells (absorbance of wells containing cells, culture medium, CCK-8, and the test compound), Ab = absorbance of blank wells (absorbance of wells containing culture medium and CCK-8), Ac = absorbance of control wells (absorbance of wells containing cells, culture medium, and CCK-8).

[0061] The results are as follows Figure 9 As shown, Figure 9 a showed that the cell viability in the NIID model group was significantly lower than that in the control group; Figure 9 b shows that adding ASO6 to the NIID model group can significantly improve cell viability.

[0062] Example 8: NIID transgenic mice can mimic the pathology of neuronal intranuclear inclusion body disease. Construction of NIID transgenic mice: First, a CAG-loxP-STOP-loxP-(CGG)100-WPRE-pA knock-in mouse model was constructed at the Rosa26 locus using CRISPR / Cas9 technology. The process was as follows: 1) Cas9 mRNA and gRNA were generated through in vitro transcription; 2) A donor vector was constructed using In-Fusion. The plasmid structure contained a 5' homologous arm (3.3 kb), an insert sequence (Knock-in), and a 3' homologous arm (3.3 kb); 3) A mixture of Cas9 mRNA, gRNA, and the donor vector was microinjected into fertilized eggs (C57BL / 6J), and one F0 mouse was subsequently identified by PCR and sequencing; 4) The F0 positive mouse was mated with a wild-type C57BL / 6J mouse, and the resulting F1 mouse was the (CGG)9 / 100-loxP conditional knock-in mouse. The mutant mouse line was completed with the assistance of Shanghai Southern Model Biotechnology Co., Ltd. (CGG)9 / 100-loxP conditional gene knock-in mice have been crossed with neuronal tamoxifen-induced Map2-Cre-ERT2 mice, allowing for real-time control of the target gene expression. Intraperitoneal injection of 100 mg / kg tamoxifen for 5 consecutive days induces neuronal-specific expression of the inserted fragment.

[0063] The results are as follows Figure 10 As shown, Figure 10 a represents the hippocampus of mice. The mice induced by tamoxifen are the model mice. Numerous intranuclear inclusion bodies can be seen in the hippocampus. 4D12 is a polyclonal antibody that can specifically recognize inclusion bodies. It was synthesized by Sinocare (the specific recognition peptide site is CAARPPRMHC) and co-localizes with neurons labeled with Map2 antibody. Figure 10 b is a transmission electron microscope image, showing inclusion bodies distributed in the nuclei and cytoplasm of cells in the mouse cortex, hippocampus, and cerebellum, with morphology consistent with a filament-like, membrane-free structure. This suggests that the transgenic mouse model successfully simulated the pathological phenotype.

[0064] Example 9: ASO6-cy3 diffuses well in mouse brains ASO6-cy3 was injected at a single point in the right hippocampus of mice (2.1 mm posterior to Bregma point, 1.6 mm to the right, and 1.7 mm deep) using a stereotaxic instrument. Approximately 15 μg was injected. Samples were taken from mice on the second and seventh day after injection, stained with DAPI, and observed under an inverted fluorescence microscope.

[0065] The results are as follows Figure 11 Therefore, ASO6-cy3 can diffuse to the ipsilateral cortex on the second day after injection, and to the contralateral cortex and hippocampus on the seventh day after injection, indicating that ASO6-cy3 diffuses well.

[0066] Example 10: ASO6 can improve the pathological phenotype of NIID transgenic mice. ASO6-cy3 and NTC-ASO (i.e., control ASO) were injected at a single point in the right hippocampus of mice (2.1 mm posterior to Bregma point, 1.6 mm to the right, and 1.7 mm deep) using a stereotaxic instrument. Approximately 30 μg was injected. Samples were collected one month after injection, and immunofluorescence staining was performed on 4D12 antibody and DAPI. The samples were then observed under an inverted fluorescence microscope.

[0067] The results are as follows Figures 12-13 As shown, Figure 12 Immunofluorescence results showed that when mice were injected with the same dose of ASO6-cy3 and NTC-cy3 at the same site in the hippocampus, no 4D12-positive inclusion bodies were found in the right hippocampus of mice in the ASO6 group, while a large number of inclusion bodies were still found in the NTC group. Figure 13 Immunoblotting results showed that the 4D12 protein in the cortex, hippocampus, and mice of the ASO6 group was reduced to varying degrees compared with that of the NTC group (4D12 is the insoluble part of the outermost gel).

[0068] The above description is only a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any equivalent substitutions or modifications made by those skilled in the art within the scope of the technology disclosed in the present invention, based on the technical solution and inventive concept of the present invention, should be covered within the scope of protection of the present invention.

Claims

1. An antisense oligonucleotide, characterized in that, The antisense oligonucleotide contains and NOTCH2NLC The nucleotide sequence of complementary base pairing in the 5'UTR region of a gene containing a CGG repeat sequence.

2. The antisense oligonucleotide according to claim 1, characterized in that, The antisense oligonucleotide has a nucleotide sequence length of 20 nucleotides.

3. The antisense oligonucleotide according to claim 1, characterized in that, The nucleotide sequence of the antisense oligonucleotide is: 5'-GCCGCCGCCGCCTGGGCAGA-3'.

4. The antisense oligonucleotide according to claim 3, characterized in that, The antisense oligonucleotides were also chemically modified.

5. The antisense oligonucleotide according to claim 4, characterized in that, The chemical modification includes full-chain modification with thiophosphates.

6. The antisense oligonucleotide according to claim 4, characterized in that, The chemical modification includes the modification of having at least 1 nt of 2'-O-methyl at both the 5' and 3' ends.

7. The antisense oligonucleotide according to claim 4, characterized in that, The chemical modification includes the modification of the 5' end and the 3' end with 2'-O-methyl groups having 1nt to 5nt, respectively.

8. The antisense oligonucleotide according to claim 4, characterized in that, The chemical modification includes the modification of having 5nt 2'-O-methyl groups at both the 5' and 3' ends.

9. Use of the antisense oligonucleotide according to any one of claims 1 to 8 in the preparation of a medicament for treating neuronal intranuclear inclusion body disease.

10. A drug for treating neuronal intranuclear inclusion body disease, characterized in that, The drug comprises the antisense oligonucleotide as described in any one of claims 1 to 8.

Images