Method for detecting cell gene editing efficiency through CRISPR / Cas9 in-vitro shearing method and application

Abstract

The invention relates to a method for detecting cell gene editing efficiency through a CRISPR / Cas9 in-vitro shearing method and application, and the method comprises the following steps: (1) after CRISPR / Cas9 gene edits cells, INDEL is formed on a genome to cause gene silencing; (2) extracting genome DNA (Deoxyribose Nucleic Acid), and carrying out PCR (Polymerase Chain Reaction) to amplify a target genome segment containing INDEL; (3) cutting the fragment obtained by PCR amplification in the step (2) by using RNP formed by Cas9 protein and sgRNA; (4) carrying out agarose gel electrophoresis on a cutting product obtained in the step (3); and (5) carrying out quantitative analysis on the electrophoretic band in the step (4) through ImageJ software to obtain the gene editing efficiency. The scheme provided by the invention has high detection precision, is very suitable for multiple occasions, such as screening of electrical conversion conditions, screening of substrate concentration, optimization of an electrical conversion process and the like, and has the characteristics of high efficiency, rapidness, accuracy and the like.

Description

Technical Field

[0001] This application belongs to the field of CRISPR / Cas9 gene editing technology, specifically relating to a method and application of CRISPR / Cas9 in vitro shearing method for detecting cell gene editing efficiency. Background Technology

[0002] CRISPR / Cas9 gene editing technology represents a major breakthrough in biotechnology in recent years. The CRISPR / Cas9 system originates from the natural immune system of bacteria and archaea, used to defend against viral invasion. In 2012, Emmanuelle Charpentier and Jennifer Doudna's team first simplified it into a binary combination of Cas9 protein and single guide RNA (sgRNA), developing the third-generation gene editing tool CRISPR / Cas9, for which they were awarded the 2020 Nobel Prize in Chemistry. CRISPR / Cas9 gene editing technology plays a crucial role in cell and gene therapy. However, gene editing efficiency varies greatly due to factors such as RNP concentration, sgRNA sequence, delivery method, and cell type. These differences are key factors in the therapeutic efficacy of cell and gene therapy products.

[0003] To assess the gene editing efficiency of cell therapy products, commonly used methods for evaluating the gene knockout efficiency of CRISPR / Cas9 gene editing technology in cells include flow cytometry, first- or second-generation sequencing, and T7E1 enzyme digestion. Flow cytometry is a technique that analyzes cellularly expressed proteins using antibodies tagged with fluorescein. However, some gene expression proteins are spatiotemporally regulated, making flow cytometry unsuitable for unstable proteins. Furthermore, the lack of readily available antibodies for rare genes also complicates this detection method. First- or second-generation sequencing offers the most accurate assessment of gene knockout efficiency, but it is very costly in terms of both time and money. T7E1 technology is limited by its inherent limitations; it is essentially undetectable when the gene knockout efficiency is below 5%. Moreover, because it detects mismatches, false negatives are common when the gene knockout efficiency is above 70% and one mutation is dominant, resulting in insufficient detection accuracy. Summary of the Invention

[0004] This application addresses the aforementioned shortcomings of the prior art by providing a method for detecting cell gene editing efficiency using the CRISPR / Cas9 in vitro shearing method with high detection accuracy.

[0005] To solve the above-mentioned technical problems, the technical solution adopted in this application is: a method for detecting cell gene editing efficiency using the CRISPR / Cas9 in vitro shearing method, the method comprising: (1) After CRISPR / Cas9 gene editing, INDELs are formed on the genome, resulting in gene silencing; (2) Extract genomic DNA and amplify the target genomic fragment containing INDEL using PCR; (3) Use the RNP formed by Cas9 protein and sgRNA to cut the fragment amplified by PCR in step (2); (4) Perform agarose gel electrophoresis on the cleavage product obtained in step (3); (5) The efficiency of gene editing can be obtained by quantitative analysis of the electrophoretic bands in step (4) using ImageJ software.

[0006] Furthermore, the sgRNA sequence used in the CRISPR / Cas9 gene editing described in step (1) is the same as the sgRNA sequence used in step (3).

[0007] Further, in step (3), the amplified fragment is cut using the RNP formed by Cas9 protein and sgRNA. The amount of Cas9 protein in the cutting system is 1.25-25 ng / μl, the amount of sgRNA is 2.5-25 ng / μl, and the cutting time is 1.0-3.0 h.

[0008] Furthermore, in the cleavage system, the amount of Cas9 protein used is 5-15 ng / μl, the amount of sgRNA is 10-20 ng / μl, and the cleavage time is 1.0-3.0 h.

[0009] Furthermore, in the cleavage system, the amount of Cas9 protein used is 10 ng / μl, the amount of sgRNA is 15 ng / μl, and the cleavage time is 1.0 h.

[0010] Furthermore, after the CRISPR / Cas9 gene-edited cells described in step (1) are formed on the genome, INDELs are created to silence the genes. The cells in this process can be tumor-infiltrating lymphocytes, which are then subjected to PDCD1 or ASXL1 gene knockout.

[0011] Furthermore, step (1) also includes setting up a control group without gene editing. Correspondingly, in subsequent steps (2), (3) and (4), the same genome extraction, PCR amplification, in vitro cutting (in vitro shearing), gel electrophoresis, band quantification and editing efficiency calculation are required for the non-gene-edited group and the gene-edited group.

[0012] Furthermore, the specific parameters for agarose gel electrophoresis in step (4) are as follows: prepare a gel by adding 1X GeneRed nucleic acid dye to 1% agarose gel, and electrophoresis at 120V for 40 minutes in 1X TAE Buffer.

[0013] Furthermore, the sample loading design for agarose gel electrophoresis in step (4) is as follows: lane 1 DL2000 Ladder, lane 2 unedited sample from the unedited group, lane 3 in vitro cleaved sample from the unedited group, lane 4 unedited sample from the gene knockout group, and lane 5 in vitro cleaved sample from the gene knockout group.

[0014] Further, in step (5), the steps for quantitative analysis of electrophoretic bands using ImageJ software are as follows: Open ImageJ software → File → Open, select the image to be analyzed → Edit → Invert → Process → Subtract background → OK → Use the rectangle tool to select the band to be analyzed → Ctrl+1 → Ctrl+3 → Use the line tool to separate the image into independent peaks → Use the magic wand tool to click on each peak in sequence → Export data from the result window: File → Save as, export a CSV file for analysis; the value in the Area column is the integrated optical density value.

[0015] Furthermore, the formula for calculating the efficiency of gene editing in step (5) is: Knockout efficiency % = (Integrated optical density value of residual band in vitro cut in gene knockout group / Integrated optical density value of main band in gene knockout group without cut treatment - Integrated optical density value of residual band in vitro cut in unedited group / Integrated optical density value of main band in unedited group without cut treatment) × 100%.

[0016] This application also provides an application of the above detection method, which is applicable in many situations, such as screening of electroporation conditions, screening of substrate concentration, and optimization of electroporation process, and has the characteristics of high efficiency, speed and accuracy.

[0017] The advantages and beneficial effects of this application are as follows:

[0018] 1. The detection method of this application is applicable in many situations, such as screening of electroporation conditions, screening of substrate concentration, and optimization of electroporation process, and has the characteristics of high efficiency, speed and accuracy.

[0019] 2. The detection method of this application mainly involves applying the CRISPR / Cas9 in vitro cutting method to identify gene editing efficiency, and the specific implementation of this method, mainly including PCR amplification of the INDEL-containing target genome fragment, optimization of the in vitro cutting system, agarose gel electrophoresis of the cutting products, and the calculation method of cutting efficiency. Since CRISPR / Cas9 gene editing technology generates an INDEL (Insertion-deletion) sequence during the editing of the cell genome, causing gene frameshift mutations and gene silencing, the introduction of INDEL will prevent the original RNP from recognizing the original sequence. In vitro, this application uses PCR technology to amplify the genome fragment containing INDEL, and uses the RNP formed by Cas9 and the corresponding sgRNA to cut the amplified fragment. The proportion of unrecognizable bands is the proportion of INDEL, which is the gene knockout efficiency. Attached Figure Description

[0020] Figure 1 This is an electrophoresis gel image of the PDCD1 and ASXL1 genome sequences after amplification in Example 5.

[0021] Figure 2 This is the electrophoretic gel image corresponding to Experiment 1 in the RNP in vitro shearing in Example 6.

[0022] Figure 3 This is the electrophoretic gel image corresponding to Experiment 2 in the RNP in vitro shearing in Example 6.

[0023] Figure 4 This is the electrophoretic gel image corresponding to Experiment 3 in the RNP in vitro shearing in Example 6.

[0024] Figure 5 The electrophoresis diagrams corresponding to Table 13 in Example 7 are shown.

[0025] Figure 6 The electrophoresis diagram is shown in Table 14 of Example 8.

[0026] Figure 7 The electrophoresis diagrams corresponding to Table 18 in Example 9 are shown.

[0027] Figure 8 This is a diagram of the second-generation sequencing results in Example 9. Detailed Implementation

[0028] The present application is described in detail below through specific embodiments, but the present application is not limited to the following embodiments; the following embodiments are only for illustrating the technical concept and features of the present application, and are intended to enable those skilled in the art to understand the content of the present application and implement it, and should not be used to limit the scope of protection of the present application. All equivalent changes or modifications made in accordance with the spirit and essence of the present application should be covered within the scope of protection of the present application.

[0029] The steps for quantitative analysis of electrophoretic bands using ImageJ software in the following example are as follows: Open ImageJ software → File → Open, select the image to be analyzed → Edit → Invert → Process → Subtract background → OK → Use the rectangle tool to select the band to be analyzed → Ctrl+1 → Ctrl+3 → Use the line tool to separate the image into independent peaks → Use the magic wand tool to click on each peak in sequence → Export the data from the result window: File → Save as, export a CSV file for analysis; the value in the Area column is the integrated optical density value.

[0030] Example 1: Design and synthesis of PDCD1 knockout sgRNA The human PDCD1 gDNA gene sequence (GenBank accession#: NG_012110.1) was obtained from Genebank. sgRNA primers were designed online using websites such as CRISPOR, CHOPCHOP, and CRISPick. GenScript Biotech Co., Ltd. was commissioned to synthesize the complete sgRNA primers. Information is shown in Table 1 below. Table 1. PDCD1 related sequence information

[0031] Example 2: Design and synthesis of ASXL1 knockout sgRNA The human ASXL1 gDNA gene sequence (GenBank accession#: NG_027868.1) was obtained from Genebank. sgRNA primers were designed online using websites such as CRISPOR, CHOPCHOP, and CRISPick. GenScript Biotech Co., Ltd. was commissioned to perform the complete sgRNA synthesis. Primer information is shown in Table 2 below. Table 2. ASXL1 related sequence information

[0032] Example 3: Primer design for PDCD1 genome amplification The human PDCD1 gDNA gene sequence (GenBank accession#: NG_012110.1) was obtained from Genebank. Primers were designed and synthesized using primer design software such as Primer5, Oligo7, and DNAMAN to amplify sequences near the PDCD1 gene editing site. Primer information is shown in Table 3 below. Table 3 PDCD1 amplification-specific primer sequences

[0033] Example 4: Primer Design for ASXL1 Genome Amplification The human ASXL1 gDNA gene sequence (GenBank accession#: NG_027868.1) was obtained from Genebank. Primers were designed and synthesized using primer design software such as Primer5, Oligo7, and DNAMAN to amplify sequences near the ASXL1 gene editing site. Primer information is shown in Table 4 below. Table 4. ASXL1 amplification-specific primer sequences

[0034] Example 5: Amplification of PDCD1 and ASXL1 genome sequences Sample source: Tumor-infiltrating lymphocyte genome (TIL); Primer sequences: PDCD1-F: CTCGGGCGGGATATGGAA (SEQ ID NO:11), PDCD1-R: CAGAGGGACTGTCTTAGGCTTGG (SEQ ID NO: 12); ASXL1-F: CATGCCGTCTTTCGCTCAAC (SEQ ID NO:13), ASXL1-R: GCTGTCCCTGGGATTGGAAA (SEQ ID NO:14); PCR kit: PrimeSTAR® HS DNA Polymerase (Brand: TAKARA, Catalog No.: R010A) The PCR reaction system is shown in Table 5 below: Table 5 PCR reaction system

[0035] Table 6 PCR Reaction Procedure

[0036] Table 7 Swimming Lanes

[0037] The specific electrophoresis diagrams corresponding to Table 7 above are shown below. Figure 1 As shown in the electrophoresis gel image, the primer-matched PCR kit designed in this application can amplify PCR products of single bands of the PDCD1 and ASXL1 genes.

[0038] Example 6: Optimization of RNP in vitro shearing effect To maximize the efficiency of RNP in vitro and reduce the background value when calculating gene editing efficiency, we optimized the in vitro RNP cleavage system. Taking the RNP cleavage of the PDCD1 gene as an example, we optimized the original RNP in vitro cleavage system, mainly focusing on three conditions: the amount of Cas9 protein (25ng, 75ng, 100ng, 150ng, 200ng, 500ng), the amount of sgRNA (50ng, 150ng, 200ng, 300ng, 500ng), and the cleavage time (1.5H, 2.0H, 3.0H). The experimental results show that 200ng of Cas9 protein and 300ng of sgRNA in a 20 μl cleavage system are the optimal conditions, while extending the cleavage time does not improve efficiency.

[0039] Cutting ratio calculation method: The integrated optical density value of the strip was quantified using ImageJ software, and then the in vitro cutting efficiency of Cas9 was calculated using the formula: Cutting ratio % = (1 - integrated optical density value of residual main band after cutting / integrated optical density value of main band of control group) × 100%.

[0040] Sample source: PDCD1 genome amplification fragment; Table 8 Original in vitro shearing system

[0041] Original reaction procedure: Incubate at 37°C for 1 hour, then at 80°C for 10 minutes; Table 9 Optimized in vitro shearing system

[0042] Optimized reaction procedure: incubate at 37°C for 1 hour, then incubate at 80°C for 10 minutes.

[0043] Experimental results: Table 10. Electrophoresis-related information for Experiment 1

[0044] Table 11 Electrophoresis-related information for Experiment 2

[0045] Table 12. Electrophoresis-related information from Experiment 3

[0046] The electrophoresis diagram corresponding to Experiment 1 is shown below. Figure 2As shown in the figure, it can be concluded that extending the cutting time and increasing the amount of sgRNA did not improve the cutting efficiency (the proportion of the main band remained unchanged), while increasing the amount of Cas9 protein could improve the cutting efficiency (the proportion of the main band remained decreased, and the bands became weaker: the main bands in lanes 13 and 14 were weaker than those in lane 12).

[0047] The electrophoresis diagram corresponding to Experiment 2 is shown below. Figure 3 As shown in the figure, increasing the Cas9 protein content in the original cleavage system can increase cleavage efficiency. The increase in efficiency is related to the amount of Cas9 protein used, and the efficiency reaches its maximum (with the lowest proportion of residual main band in lane 6) when the amount of Cas9 protein used is 200 ng (final concentration of 10 ng / μl).

[0048] The electrophoresis diagram corresponding to Experiment 3 is shown below. Figure 4 As shown in the figure, it can be concluded that increasing the sgRNA concentration while keeping the Cas9 protein dosage constant (200 ng) has little effect on the cleavage efficiency. The cleavage efficiency reaches its maximum when the sgRNA dosage is 300 ng (final concentration 15 ng / μl) (the proportion of residual main band in lane 4 is the lowest).

[0049] Example 7: Calculation of PDCD1 gene knockout efficiency in TILs using CRISPR / Cas9 in vitro splicing method The PDCD1 gene was knocked out in tumor-infiltrating lymphocytes (TILs) using the CRISPR / Cas9 gene editing system. The PDCD1 knockout efficiency in TILs was then calculated using the CRISPR / Cas9 in vitro splicing method. The specific experimental procedure is as follows: 1. Cellular PDCD1 gene knockout: The PDCD1 RNP complex (formed by mixing Cas9 protein and sgRNA at a 1:2 molar ratio and incubating at room temperature for 10 minutes) was introduced into target cells using the Invitrogen Neon electroporation system (Thermo Fisher, catalog number: NEON1SK). The cells were then cultured in T cell expansion medium for 48 hours. 2. Genomic DNA (gDNA) extraction: DNA was extracted using a blood / cell / tissue genomic DNA extraction kit (TIANGEN, catalog number: DP304), and the gDNA concentration was detected using a microplate reader. 3. PCR amplification of a partial fragment of PDCD1 exon 1: Amplification was performed using the PrimeSTAR® HS DNA kit. Polymerase (brand: TAKARA, catalog number: R010A); amplification primers: forward primer CTCGGGCGGGATATGGAA (SEQ ID NO:7), reverse primer CAGAGGGACTGTCTTAGGCTTGG (SEQ ID NO:8); amplification system and procedure refer to "Example 5"; 4. Purification of PCR amplification products (PCR-P): PCR products were purified using a common DNA product purification kit (brand: TIANGEN, catalog number: DP204), and the PCR-P concentration was detected by microplate reader; 5. CRISPR / Cas9 in vitro shearing: In vitro shearing was performed using the optimized shearing system and incubation procedure in "Example 6"; 6. Electrophoresis of enzyme digestion products: 1% agarose gel electrophoresis (120V, (40 min), and then ImageJ software was used to analyze the integrated optical density values ​​of the electrophoretic bands to calculate the gene knockout efficiency. The calculation formula is: Knockout efficiency % = (Integrated optical density value of the in vitro shearing residual band of the gene knockout group / Integrated optical density value of the un-sheared main band of the gene knockout group - Integrated optical density value of the in vitro shearing residual band of the un-edited group / Integrated optical density value of the un-sheared main band of the un-edited group) × 100%.The results are as follows: The PDCD1 gene knockout efficiency in TILs calculated by the general CRISPR / Cas9 in vitro splicing method is 74.73% (according to the knockout efficiency calculation method mentioned above: knockout efficiency % = (integrated optical density value of the in vitro splicing residual band of the gene knockout group / integrated optical density value of the unspliced ​​main band of the gene knockout group - integrated optical density value of the in vitro splicing residual band of the unedited group / integrated optical density value of the unedited main band of the unedited group) × 100%, the knockout efficiency of 74.73% is calculated as 79.42% - 4.69% = 74.73%; the same applies below); see Table 13 below for details. Table 13 PDCD1 gene knockout efficiency

[0050] The electrophoresis diagrams corresponding to Table 13 above are shown below. Figure 5 As shown in the figure, this graph is used to calculate the cutting efficiency. Lanes 2 and 3 are samples from the unedited group, and lanes 4 and 5 are samples from the PDCD1 gene knockout group. Lanes 3 and 5 contain three bands formed after in vitro cutting, with the top one being the main band. The ratio of the integrated optical density values ​​of the main band in lane 3 to that in lane 2 is 4.69%, and the ratio of the integrated optical density values ​​of the main band in lane 5 to that in lane 4 is 79.42% (Table 13). 79.42% - 4.69% = 74.73% gives the knockout efficiency. As can be seen from the figure, the proportion of the main band remaining in the PDCD1 gene knockout samples is significantly higher after in vitro cutting.

[0051] Example 8: Calculation of ASXL1 gene knockout efficiency in TILs using CRISPR / Cas9 in vitro shearing method The ASXL1 gene was knocked out in tumor-infiltrating lymphocytes (TILs) using the CRISPR / Cas9 gene editing system. The ASXL1 knockout efficiency in TILs was then calculated using the CRISPR / Cas9 in vitro splicing method. The specific experimental procedure is as follows: 1. ASXL1 gene knockout in cells: The ASXL1 RNP complex (formed by mixing Cas9 protein and sgRNA at a 1:2 molar ratio and incubating at room temperature for 10 minutes) was introduced into target cells using the Invitrogen Neon electroporation system (Thermo Fisher, catalog number: NEON1SK). The cells were then cultured in T cell expansion medium for 48 hours. 2. Genomic DNA (gDNA) extraction: DNA was extracted using a blood / cell / tissue genomic DNA extraction kit (TIANGEN, catalog number: DP304), and the gDNA concentration was detected using a microplate reader. 3. PCR amplification of a partial fragment of ASXL1 exon 1: Amplification was performed using the PrimeSTAR® HS DNA kit. Polymerase (brand: TAKARA, catalog number: R010A); amplification primers: forward primer CATGCCGTCTTTCGCTCAAC (SEQ ID NO: 9), reverse primer GCGTCCCTGGGATTGGAAA (SEQ ID NO: 10); amplification system and procedure are as described in "Example 5" above; 4. Purification of PCR amplification products (PCR-P): PCR products were purified using a standard DNA product purification kit (brand: TIANGEN, catalog number: DP204), and the PCR-P concentration was detected using a microplate reader; 5. CRISPR / Cas9 in vitro shearing: In vitro shearing was performed using the optimized shearing system and incubation procedure described in "Example 6" above; 6. Electrophoresis of enzyme digestion products: 1% agarose gel electrophoresis (120V, (40 min), and then the integrated optical density values ​​of the electrophoretic bands were analyzed using ImageJ software to calculate the gene knockout efficiency. The calculation formula is: Knockout efficiency % = (Integrated optical density value of the in vitro shearing residue band in the gene knockout group / Integrated optical density value of the un-sheared main band in the gene knockout group - Integrated optical density value of the in vitro shearing residue band in the un-edited group / Integrated optical density value of the un-sheared main band in the unedited group) × 100%. The results are as follows: The ASXL1 gene knockout efficiency in TILs calculated by the CRISPR / Cas9 in vitro shearing method is 75.61%; see Table 14 below for details: Table 14 ASXL1 gene knockout efficiency

[0052] The corresponding electrophoresis diagrams in Table 14 above are shown below. Figure 6As shown in the attached figure, lanes 2 and 3 are unedited samples, while lanes 4 and 5 are ASXL1 gene knockout samples. Lanes 2 and 4 are unprocessed controls, while lanes 3 and 5 are processed samples. The figure shows that the proportion of the main band remaining in the ASXL1 gene knockout samples is significantly higher after in vitro processing.

[0053] Example 9: Comparison of detection results using CRISPR / Cas9 in vitro shearing method and T7E1 shearing method The ASXL1 gene was knocked out in tumor-infiltrating lymphocytes (TILs) using the CRISPR / Cas9 gene editing system. The ASXL1 knockout efficiency in TILs was then calculated using the CRISPR / Cas9 in vitro splicing method and the T7E1 restriction enzyme digestion assay. The specific experimental procedure for the CRISPR / Cas9 in vitro splicing method was the same as in "Example 8". The experimental procedure for the T7E1 restriction enzyme digestion assay was as follows: 1. Genomic DNA (gDNA) extraction: DNA was extracted using a blood / cell / tissue genomic DNA extraction kit (brand: TIANGEN, catalog number: DP304), and the gDNA concentration was detected using a microplate reader; 2. PCR amplification of the sequence near the ASXL1 gene editing site: Amplification kit PrimeSTAR® HS DNA Polymerase (brand: TAKARA, catalog number: R010A); amplification primers: forward primer CATGCCGTCTTTCGCTCAAC (SEQ ID NO: 9), reverse primer GCGTCCCTGGGATTGGAAA (SEQ ID NO: 9). NO:10); the amplification system and amplification procedure are as described in "Example 5"; 3. Purification of PCR amplification products (PCR-P): PCR products were purified using a common DNA product purification kit (brand: TIANGEN, catalog number: DP204), and the concentration of PCR-P was detected by an enzyme-linked immunosorbent assay (ELISA) reader. 4. T7E1 Enzyme Digestion Identification: The specific procedure for the T7 Endonuclease I identification kit (brand: Beyotime, catalog number: D7080S) is briefly described as follows: Prepare a 19 μl denaturation, annealing, and hybridization system according to "Table 16", run the denaturation and annealing program in "Table 17", add 1 μl of T7EI to the above 19 μl annealed system, incubate at 37ºC for 15 minutes, add 1.5 μl of 0.25M EDTA to terminate the reaction, add 2.4 μl of 10X Loading Buffer and mix by pipetting, perform 1% agarose gel electrophoresis (120V, 40min), and use ImageJ to calculate the cutting ratio (f) based on the integrated optical density value of the quantitative bands, f = (B+C) / (A+B+C), where A is the integrated optical density value of the main band that was not cut, and B and C are the integrated optical density values ​​of the bands produced by cutting. Gene editing efficiency is calculated using the formula: p = [1 - sqrt(1 - f)] × 100%.The results showed that the gene editing efficiency detected by the CRISPR / Cas9 in vitro slicing method was 75.61%, and the gene editing efficiency detected by the T7E1 method was 49.56% (this figure was calculated from the gel images in Table 18; the calculation method was: the cutting ratio (f) was calculated using the ImageJ quantitative band integrated optical density values, f = (B+C) / (A+B+C), where A is the integrated optical density value of the uncut master band, and B and C are the integrated optical density values ​​of the cut bands. The gene editing efficiency was calculated using the formula: p = [1 - sqrt(1 - f)] × 100%). The gene editing efficiency detected by the CRISPR / Cas9 in vitro slicing method is closer to the values ​​of first-generation sequencing (95%) and second-generation sequencing (99.08%). The gene editing efficiency detected by the CRISPR / Cas9 in vitro slicing method was 75.61%; see Table 15 below for details. Table 15. Detection of ASXL1 gene knockout efficiency using CRISPR / Cas9 in vitro cleavage method and T7E1 cleavage method.

[0054] The electrophoresis diagrams corresponding to Table 15 above can also be shown as follows: Figure 6 As shown, from Figure 6 As shown in the figure, lanes 2 and 3 are unedited samples, while lanes 4 and 5 are ASXL1 gene knockout samples. Lanes 2 and 4 are unprocessed controls, while lanes 3 and 5 are processed in vitro. The figure shows that the proportion of residual main bands in the ASXL1 gene knockout samples significantly increased after in vitro processing.

[0055] The gene editing efficiency detected using the T7E1 splicing method was 49.56%. Tables 16 and 17 below show the reaction systems and conditions for wild-type PCR-P and mutant PCR-P: Table 16 Reaction systems for wild-type PCR-P and mutant PCR-P

[0056] Table 17 Reaction system and reaction conditions for wild-type PCR-P and mutant PCR-P

[0057] Table 18 Lane assignments for electrophoresis of wild-type PCR-P and mutant PCR-P.

[0058] The electrophoresis diagrams corresponding to Table 18 above are shown below. Figure 7 As shown, from this Figure 7As shown in the figure, lane 1 is the molecular weight marker, lane 2 is the wild-type genome PCR product, and lane 3 is the ASXL1 gene knockout group PCR product. These products were denatured, annealed, hybridized in vitro, and then digested with the T7E1 enzyme. The figure shows that the ASXL1 gene knockout group PCR product was cleaved into three bands by the T7E1 enzyme. The cleavage ratio can be calculated based on the integrated optical density values ​​of these three bands, and thus the gene editing efficiency can be determined.

[0059] The first-generation sequencing results showed a gene editing efficiency of 95%. PCR amplification of the INDEL-containing gene fragment and the wild-type gene fragment (amplification primers: forward primer CATGCCGTCTTTCGCTCAAC (SEQ ID NO: 9), reverse primer GCGTCCCTGGGATTGGAAA (SEQ ID NO: 10); amplification system and procedure refer to "Example 5") was performed on the fragments by Sangon Biotech. The returned sequencing results were analyzed on the ICE website. By entering the sample name, sgRNA sequence, wild-type gene fragment sequencing results (ab1 file), and mutant gene fragment sequencing results (ab1 file), and clicking "analyze," the percentage of INDEL (95%) was obtained. This value represents the gene knockout efficiency.

[0060] See attached for details. Figure 8 As shown, the next-generation sequencing results showed a gene editing efficiency of 99.08%. Specifically, the gene fragment containing INDEL was amplified in vitro by PCR (amplification primers: forward primer TTGACCCCCCTACTTATTTG (SEQ ID NO:15), reverse primer CCTTACCATCGTTTTCACCA (SEQ ID NO:16); amplification system and procedure refer to "Example 5") and sent to Sangon Biotech for next-generation sequencing. The results were analyzed: the 10 most frequent sequences were selected and compared with the reference genome (NCBI Blast). The wild-type sequence was found to have a frequency of 0.92%. The base deletions or insertions of the 10 sequences were then counted and plotted using Graph Prism software (with the number of base deletions or insertions on the x-axis and the frequency on the y-axis). The results are shown in the attached figure. Figure 8 As shown, from Figure 8 The sequencing results show that the proportion of wild-type sequences (the "0" column) is 0.92%. Next-generation sequencing detected the various sequences contained in the PCR amplified fragments and their frequencies. 0 represents a wild-type sequence, 1 represents an insertion of one nucleotide in the wild-type sequence, -1 represents a deletion of one nucleotide in the wild-type sequence, and so on. Both insertions and deletions affect gene function, causing functional silencing; the ratio of insertions to deletions is the gene knockout ratio.

Claims

1. A method for detecting the efficiency of gene editing in cells by CRISPR / Cas9 in vitro cleavage method, characterized in that: The steps of the method include: (1) After CRISPR / Cas9 gene editing of cells, INDEL is formed on the genome to cause gene silencing; (2) Genomic DNA is extracted, and a target genomic fragment containing INDEL is amplified by PCR reaction; (3) The fragment amplified in step (2) is cut by RNP formed by Cas9 protein and sgRNA; (4) The cutting product obtained in step (3) is subjected to agarose gel electrophoresis; (5) The efficiency of gene editing can be obtained by quantitatively analyzing the electrophoresis bands in step (4) by ImageJ software.

2. The method of claim 1, wherein the CRISPR / Cas9 in vitro cleavage assay is used to assess the efficiency of gene editing in cells. The sgRNA sequence used in step (1) CRISPR / Cas9 gene editing is the same as the RNP formed by Cas9 protein and sgRNA in step (3).

3. The method of claim 1, wherein the CRISPR / Cas9 in vitro cleavage assay is used to assess the efficiency of gene editing in cells. The amount of Cas9 protein in the cutting system in step (3) is 1.25-25 ng / μl, the amount of sgRNA is 2.5-25 ng / μl, and the cutting time is 1.0-3.0 h.

4. The method of claim 3, wherein the CRISPR / Cas9 in vitro cleavage assay is used to assess the efficiency of gene editing in cells. The amount of Cas9 protein in the cutting system is 10 ng / μl, the amount of sgRNA is 15 ng / μl, and the cutting time is 1.0 h.

5. The method of claim 1, wherein the CRISPR / Cas9 in vitro cleavage assay is used to assess the efficiency of gene editing in cells. In step (1), after the CRISPR / Cas9 gene editing of cells, INDEL is formed on the genome to cause gene silencing, wherein the cells include but are not limited to tumor infiltrating lymphocytes, and the tumor infiltrating lymphocytes are subjected to knockout of genes including but not limited to PDCD1 gene or ASXL1 gene.

6. The method of claim 1, wherein the CRISPR / Cas9 in vitro cleavage assay is used to assess the efficiency of gene editing in cells. Step (1) also includes setting an unedited control group, and correspondingly, the subsequent steps (2), (3), (4) and (5) also need to extract genomic DNA, amplify by PCR, cut in vitro, perform gel electrophoresis, quantify the bands and calculate the editing efficiency as the gene editing group.

7. The method of claim 1, wherein the CRISPR / Cas9 in vitro cleavage assay is used to assess the efficiency of gene editing in cells. The specific parameters of agarose gel electrophoresis in step (4) are: 1% agarose gel plus 1X GeneRed nucleic acid dye to prepare the gel, 120V electrophoresis in 1X TAE Buffer for 40 minutes; the loading design of agarose gel electrophoresis in step (4) is: lane 1 DL2000 Ladder, lane 2 unedited group without cutting treatment sample, lane 3 unedited group in vitro cutting sample, lane 4 gene knockout group without cutting treatment sample, lane 5 gene knockout group in vitro cutting sample.

8. The method of claim 1, wherein the CRISPR / Cas9 in vitro cleavage assay is used to assess the efficiency of gene editing in cells. The steps of quantitatively analyzing the electrophoresis bands by ImageJ software in step (5) are: open ImageJ software→file→open select the picture to be analyzed→Edit→Invert→Process→Subtract background→OK→rectangle tool frame selection of the band to be analyzed→Ctrl+1→Ctrl+3→straight line tool to separate the picture into independent peak graph→magic wand tool to click each peak graph in turn→result window export data: File→Save as export csv file, which can be analyzed; the value in the Area column is the integral optical density value.

9. The method of claim 1, wherein the CRISPR / Cas9 in vitro cleavage assay is used to assess the efficiency of gene editing in cells. The calculation formula of the efficiency of gene editing in step (5) is: knock-out efficiency%= (integrated optical density value of in vitro cleavage residual band of gene knock-out group / integrated optical density value of non-cleavage main band of gene knock-out group- integrated optical density value of in vitro cleavage residual band of non-edited group / integrated optical density value of non-cleavage main band of non-edited group) × 100%.

10. The use of a method for detecting the efficiency of gene editing in cells by CRISPR / Cas9 in vitro cleavage according to any one of claims 1 to 9, characterized in that: Applied to screening of electrotransformation conditions, screening of substrate concentration or optimization of electrotransformation process.

Images