Specific marker, primer pair and application and detection method of DNA insertion variation in exon region of oplegnathus fasciatus

Abstract

The present application relates to the field of molecular biology, in particular to a specific marker of DNA insertion variation in the exon region of Oplegnathus fasciatus, a primer pair and application and a detection method. The specific marker of the DNA insertion variation in the exon region of Oplegnathus fasciatus is a nucleotide sequence specific to the non-insertion and insertion of the DNA fragment in the exon region of Oplegnathus fasciatus, and the sequence is shown in the bases of SEQ ID NO:1 and SEQ ID NO:2. Then a pair of primers is used to amplify 521bp and 210bp bands in the individuals with DNA insertion variation, and only 210bp bands are amplified in the individuals without DNA insertion variation. The detection method of the present application significantly shortens the identification time, improves the detection efficiency, and has important application value in the gender identification, high male seed preparation and family selection of Oplegnathus fasciatus.

Description

Technical Field

[0001] This invention relates to the field of molecular biology, specifically to specific markers, primer pairs, applications, and detection methods for DNA insertion variations in the exon regions of the spotted sea bream gene. Background Technology

[0002] Spotted sea bream ( Oplegnathus punctatus Belonging to the family Scutellaridae and genus Scutellaridae, they are mainly distributed in the tropical and subtropical waters of the western Pacific Ocean. Current sex chromosome studies show that males have 2n=47 chromosomes, while females have 2n=48, suggesting that their sex determination system may be of the X1X1X2X2 / X1X2Y type (females carry two pairs of X chromosomes, while males carry a combination of X1, X2, and Y chromosomes). Recent structural studies have revealed significant structural differences between the Y chromosome and the homologous regions of X1X2, providing potential targets for the development of sex-based molecular markers. Combined with the observed influence of sex on growth in aquaculture practice (males typically grow faster than females), developing genetic markers that can accurately distinguish sex and achieve high male ratios or all-male fry breeding is of great significance for improving the production capacity of spotted scutellaridae and advancing breeding efforts. Furthermore, rapid sex identification technology for spotted scutellaridae is also important for preserving and utilizing superior male genetic resources.

[0003] Exon insertion-deletion variants are a crucial molecular basis for research on human genetic diseases, tumorigenesis, and trait selection. Slip chain mismatches, non-homologous end joining, homologous recombination, and splicing site activation are the driving forces behind exon insertions and deletions. Studies have found that a 14bp insertion and an 18bp deletion in the first exon of the wheat TraesCS7A03G0149400 gene affect F-box protein function through frameshift mutations, significantly reducing plant height and thousand-grain weight. A 3bp in-frame indel in the fourth exon of the rice APX9 gene differentiates alleles between japonica and wild rice, regulating grain weight and antioxidant activity. An 8bp deletion in exon 7 of the fragrant rice OsBadh2 gene is a key variant determining the unique aroma of Basmati rice. Currently, InDel marker development based on high-throughput sequencing has become a core tool in molecular-assisted selection (MAS). For example, in mung beans, 129 InDel markers were used to construct a high-density linkage map to locate major QTLs controlling traits such as stem color and flowering time. Furthermore, long-read sequencing technology has advanced the analysis of structural variations in livestock and poultry genomes. For instance, in the bovine genome, numerous exon insertions and deletions have been identified as associated with complex traits such as milk production and tuberculosis resistance, providing new functional variation resources for genomic selection breeding. To date, there are few reports on the genetic identification of male and female spotted sea bream based on exon DNA insertion variations. Summary of the Invention

[0004] The purpose of this invention is to overcome the shortcomings of existing technologies for detecting DNA insertion variations in the exon regions of the spotted sea bream gene, and to provide specific markers, primer pairs, applications, and detection methods for DNA insertion variations in the exon regions of the spotted sea bream gene.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] A specific marker for DNA insertion variation in the exon region of the spotted sea bream gene is provided. The specific marker for insertion variation in the exon region of the spotted sea bream gene consists of the nucleotide sequences of the non-insertion and insertion-specific markers of the DNA fragments in the exon region of the spotted sea bream gene, and the sequences are the bases shown in SEQ ID NO:1 and SEQ ID NO:2.

[0007] The nucleotide sequence SEQ ID NO:1 in the DNA fragment of the exon region of the spotted sea bream gene, which is a non-insertion and insertion-specific marker, is a homologous fragment of the exon region of the gene shared by male and female spotted sea bream X1 chromosomes, in which no DNA insertion variation has occurred. It is a DNA characteristic marker shared by individuals with non-insertion and insertion bases in the exon region of the spotted sea bream gene.

[0008] The nucleotide sequence SEQ ID NO:2 is a DNA fragment inserted between positions 56 and 57 (273 bp insertion), positions 60 and 61 (27 bp insertion), and positions 149 and 150 (11 bp insertion) in the bases shown in the nucleotide sequence SEQ ID NO:1. This is a characteristic marker of individuals with base insertions in the exon region of the spotted sea bream gene.

[0009] The application of a specific marker for DNA insertion variation in the exon region of the spotted sea bream gene, and the application of the specific marker in identifying the genetic sex of the spotted sea bream.

[0010] A method for identifying the genetic sex of spotted sea bream using the aforementioned specific marker.

[0011] 1) PCR amplification: Take the spotted sea bream to be tested and extract genomic DNA; use the obtained genomic DNA as a template and use the specific primers for the exon region of the spotted sea bream gene to perform PCR amplification, and compare the obtained PCR amplification product with the non-insertion and insertion specific markers of the spotted sea bream gene exon region DNA fragment.

[0012] 2) Result interpretation: The genetic sex of the spotted sea bream to be tested is determined by amplified fragments.

[0013] The specific primer is

[0014] Ch exon_F:1 : 5'-GGGGCTAGACCTAAAGCCCTGGT-3';

[0015] Ch exon _R:2 : 5'-CCAGGATTCTAGGAATCTTTTCC-3'.

[0016] The amplification of only a single DNA fragment of 210 bp shown in SEQ ID NO:1 is a non-insertion-specific marker of the DNA fragment in the exon region of the spotted sea bream gene to be detected. The spotted sea bream to be detected is female X1X1X2X2.

[0017] The two DNA fragments, 210bp and 521bp, shown in SEQ ID NO:1 and SEQ ID NO:2, were amplified. These fragments are DNA fragments with specific markers inserted into the exon regions of the spotted sea bream gene to be detected. The spotted sea bream to be detected is a male X1X2Y.

[0018] Advantages of this invention:

[0019] This invention, through analysis of the whole genome sequence of the spotted rock seabream, successfully screened and obtained specific large-fragment DNA insertion marker sequences of homologous regions in the exons of genes on the X and Y chromosomes. Utilizing these rapid and accurate specific markers for DNA insertion variations in spotted rock seabream gene exons, a comparison of genes on the Y fusion chromosome of male spotted rock seabream with homologous genes on the X chromosome of female spotted rock seabream revealed large-fragment sequence insertions in the exons of genes on the Y chromosome. This method has significant application value in accelerating the genetic sex identification of spotted rock seabream germplasm resources, speeding up the genetic breeding process of spotted rock seabream, and improving the efficiency of large-scale production of high-quality seedlings.

[0020] This invention provides a rapid method for detecting the genetic sex of spotted rock seabream germplasm resources. Using a pair of primers, it amplifies two DNA fragments of 521 bp and 210 bp in individuals with DNA insertion, while only the 210 bp fragment is amplified in individuals without insertion. These two cases can be easily distinguished using agarose gel electrophoresis, significantly improving the speed and accuracy of detection, shortening the identification time, and increasing detection efficiency. This method has broad application prospects in spotted rock seabream sex determination, preparation of male seedlings, and family selection, and has significant economic and scientific value for promoting the development of spotted rock seabream aquaculture. Attached Figure Description

[0021] Figure 1 This is a diagram showing the nucleotide sequence alignment of the gene exon region with the X1 chromosome provided in this embodiment of the invention; the modules shown in the diagram represent highly homologous regions of the gene exon region and the X1 chromosome, and the framed region is the target sequence ChrX1 of this invention.exon Location.

[0022] Figure 2 ChrX1 provided for embodiments of the present invention exon and Chry exon Specific location information for homologous sequence alignment; 210bp represents ChrX1. exon The length of the fragment, 521bp represents Chrys. exon Length; Chry exon The middle low region represents the inserted 310bp nucleotide sequence, which is related to ChrX1. exon The fragment has no homologous matching sequence.

[0023] Figure 3 The X chromosome ChrX1 obtained as provided in the embodiments of the present invention exon ChrY with Y chromosome exon Nucleotide sequence alignment diagram, with primer positions at both ends indicated by double black underlines; *: represents ChrX1 exon and Chry exon Sequence consistency: blank areas indicate sequences with inconsistent bases; ------: represents insertion or deletion sequences; black single underline represents the region where the insertion sequence is located.

[0024] Figure 4 The X chromosome ChrX1 provided in the embodiments of the present invention exon ChrY with Y chromosome exon A schematic diagram of differentially inserted DNA fragments with homologous nucleotide sequences; black areas represent homologous regions, and blank areas represent deleted regions and site information.

[0025] Figure 5 The image shows the 1.5% agarose gel electrophoresis results of PCR products from male and female spotted sea bream provided in this embodiment of the invention. M: DL 2000 DNA Maker; ♂: physiological male fish; ♀: physiological female fish. Individuals showing two bands (521bp and 210bp) are individuals with DNA insertion in the exon gene, which are also genetically male fish, and are physiologically male based on histological identification. Individuals showing a single band (210bp) are individuals without DNA insertion in the exon gene, which are also genetically female fish, and are physiologically female based on histological identification. Detailed Implementation

[0026] The following examples further illustrate specific embodiments of the present invention. It should be noted that the specific embodiments described herein are merely for illustration and explanation and are not intended to limit the scope of the present invention.

[0027] This invention utilizes the published genome information of the spotted sea bream (CNP0001488, Li et al., 2021) and, through genomic bioinformatics analysis, discovered that the exon gene on the male Y chromosome exhibits a large DNA sequence insertion variation (e.g., ...) compared to its homologous gene on the female X1 chromosome. Figure 1 and Figure 2 (As shown). This invention selects the 1,114,089bp~1,114,298bp region on the female X1 chromosome containing this gene, and the 34,841,345bp~34,841,865bp region on the male Y chromosome that is homologous to it and contains DNA sequence insertions, as the research target regions. On the X1 chromosome, the DNA fragment is 210bp in length and is named ChrX1. exon Its sequence is shown in SEQ ID NO:1; while on the Y chromosome, the DNA fragment is 521 bp in length and contains a sequence homologous to the gene on the X1 chromosome, named ChrY. exon Its sequence is shown in SEQ ID NO:2. Through analysis of ChryY... exon With ChrX1 exon Alignment with homologous sequences revealed that it was related to ChrX1. exon Three DNA sequence insertions were found between positions 56 and 57 (273 bp insertion), 60 and 61 (27 bp insertion), and 149 and 150 (11 bp insertion), with a total insertion size of 311 bp (e.g., ...). Figure 3 and Figure 4 (As shown). This inserted sequence serves as a DNA marker for detecting whether a base insertion variation has occurred in the exon of the spotted rockfish gene; simultaneously, because this marker is located on the male Y chromosome and exhibits male-linked inheritance characteristics, this fragment is also a DNA marker unique to the Y chromosome of male spotted rockfish, while ChrX1 exon These are DNA markers shared by males and females of the spotted rock sea bream to indicate their genetic sex.

[0028] This invention utilizes a specific long DNA insertion sequence found in the exon region (34,841,345bp~34,841,865bp) of a gene on the Y chromosome of male spotted sea bream as a marker to detect whether DNA insertion variations have occurred in the exons of spotted sea bream genes. This discovery has led to a rapid method for detecting exon variations in spotted sea bream genes and further applied this method to rapidly identify the genetic sex of spotted sea bream. Specifically, the detection method first confirms the presence of a Y chromosome-specific gene nucleotide fragment (521bp) in the spotted sea bream sample to be tested. This step achieves rapid identification by designing specific PCR primers. This invention, through comparative analysis of the gene sequence on the Y chromosome of spotted sea bream with homologous sequences on chromosomes X1 and X2, identifies the gene (ChrX1) on chromosome X1. exon Its sequence is as shown in SEQ ID NO:1) and the sequence on the Y chromosome (ChrY) is homologous to the nucleotide sequence. exon The sequence is shown in SEQ ID NO:2. Based on the characteristic of a large DNA insertion in this homologous exon region on the Y chromosome, we designed a pair of primers. Analysis of the PCR products by 1.5% agarose gel electrophoresis can quickly determine whether DNA insertion variation has occurred in the exon of the spotted rockfish exon gene. Furthermore, since this DNA insertion marker is located on the male Y chromosome and exhibits sex-linked inheritance characteristics, it is also suitable for accurately identifying the genetic sex of the spotted rockfish. The upstream and downstream primer sequences are as follows:

[0029] Ch exon _F:1 : 5'-GGGGCTAGACCTAAAGCCCTGGT-3' (X exon ID No:2 (SEQ ID NO:3)

[0030] Ch exon _R:2: 5'-CCAGGATTCTAGGAATCTTTTCC-3'(X exon ID No:3 (SEQ ID NO:4).

[0031] The steps for identifying exon insertion variations in the *Syngonium spp.* gene using the primers described above mainly include: extracting high-quality whole-genome DNA from *Syngonium spp.*, amplifying specific marker DNA fragments of exon insertion on the Y chromosome gene, and detecting the DNA of the PCR product by agarose gel electrophoresis; among them, two DNA fragments of 521bp and 210bp were amplified in the Y chromosome and X1 chromosome of male *Syngonium spp.*, respectively, with the 521bp fragment being a marker fragment specific to the variant exon gene; while in female *Syngonium spp.* individuals (X1X1X2X2), only a single DNA fragment of 210bp was amplified.

[0032] This invention is based on whole-genome sequencing of male and female spotted sea bream and gene localization and DNA sequence alignment analysis of male and female individuals. It reveals a long-segment DNA insertion mutation in the exon region of a certain gene on the Y chromosome of male spotted sea bream. This mutation serves as a unique DNA marker for exon insertion on the Y chromosome of spotted sea bream, and the sex of spotted sea bream can be rapidly identified using this exon insertion mutation. This method can quickly, accurately, and efficiently distinguish whether the tested spotted sea bream have exon gene insertion mutations. In spotted sea bream individuals with exon gene mutations, two bands, 521 bp and 210 bp, are amplified, with the 521 bp band being the specific target band. In exon gene individuals without mutations, only a single band (210 bp) is amplified. The band patterns of these target bands can be quickly and accurately distinguished using agarose gel electrophoresis, enabling rapid identification of whether or not there is an exon mutation in spotted sea bream genes. Meanwhile, since this specific target band (521bp) is located on the male Y chromosome and has male-linked inheritance characteristics, this fragment is also a DNA marker unique to the Y chromosome of male spotted rockfish, and can be used for rapid identification of the genetic sex of male spotted rockfish.

[0033] Example 1: Screening and Validation of DNA Markers Specific to Exon Base Insertion Variations in the Spotted Rockfish Gene

[0034] Discovery of homologous gene regions on the X and Y chromosomes of the spotted rockfish, containing a large insert target DNA sequence: The DNA sequences of the male neo-Y chromosome and the X1 chromosome of the female were derived from published genome information of the spotted rockfish (CNP0001488, Li et al., 2021). Comparative genomic bioinformatics analysis of the male and female spotted rockfish genome sequences revealed that the gene on the Y chromosome of the male spotted rockfish is homologous to the exon gene on the X1 chromosome of the female spotted rockfish, and a large DNA insert fragment exists. The target DNA fragment of the exon gene on the X1 chromosome is 210 bp in length and is named ChrX1. exon Its sequence is SEQ ID NO:1:

[0035] GGGGCTAGACCTAAAGCCCTGGTAAGCTCTGCACCATCCCATCAGGAGCCCTGGTCTCTGGTCACCACGGGCGAAGAATTCTCCACCGACCGCTCCCCTCCGACCACGCTTATCATCGGAGAATCGATCGTGAGGAATGTGAGGAAAAATGTTATGCTTTCCAGGCCCTAAGGTGACTGACATCCTGGAAAAGATTCCTAGAATCCTGG.

[0036] The target DNA fragment of the exon homologous gene on the male fish's heterochromosome Y is 521 bp in length, and it contains a sequence homologous to X1, named ChrY. exon Its sequence is SEQ ID NO:2:

[0037] GGGGCTAGACCTAAAGCCCTGGTAGGCTCTGCACCATCCCATCAGGAGCCCTGGTCGACGATCGCGGCAAGAGAGGGGGGCGCTCATCTCGTCCACCCTCGCATTACAACATCCAGCTGGAGAACAAGTA TGACATCCTAGATCTTCATGGCTTCTTCCTTTGGCAGTGGAGTCCCAGCCTCCCCGGCCGTCAAGTGGGTCTCACTGTGGGTCCCACTGTCCTCTATTGCCTCCAATCCCTCCACCAGCCAGACCTCGGCA CTTCACTCTCAACAGGGCTCACTGCTCCATACCGCTCTTCACTCCAGCGCCGCGACAAGGTCCTGCTGTCTGCTCGGTCCATCCTTCTCCATCTACTCCGTCACCACGGGCGAAGATTTCTCCACCGACC GTTCCCCCTCCGACCACACTTATCATCAGAGATTCAATTGTGAGGAATGTGAGGAAAAAAACTGCGACGACCGCTATGCTTTCCAGGCCCTAAGGTGACTGACATTCTGGAAAAGATTCCTAGAATCCTGG.

[0038] Whole genome scans of both sexes and gene localization and DNA sequence alignment analysis of male and female individuals showed that the gene segment ChrX located on chromosome X1 is related to this gene segment. exon homologous Chrys exon Three exon DNA sequence insertions occurred on the Y chromosome, corresponding to ChrX1. exon Between positions 56 and 57 (insertion 273bp), 60 and 61 (insertion 27bp), and 149 and 150 (insertion 11bp), the size is 311bp. Figure 3 , Figure 4 Gene target regions on the Y chromosome (ChrY) exon DNA sequence ratio with homologous DNA regions of chromosome X1 (ChrX1) exonA 311bp DNA sequence was inserted, which is a unique DNA marker for exon insertion mutations in the ChrY gene of the spotted rock seabream. Its presence or absence can be used to identify the ChrY gene in spotted rock seabream. exon Whether the gene has undergone exon insertion variation. Furthermore, because this marker is located on the male Y chromosome and exhibits male-linked inheritance characteristics, ChrY... exon This fragment is also a DNA marker unique to the Y chromosome of male spotted rock snapper, and ChrX1 exon These are DNA markers shared by males and females of the spotted rock seabream, such as... Figure 3 As shown.

[0039] Sequence verification of the DNA marker specific to the exon insertion variant of this gene: Based on the nucleotide sequence characteristics of the Y chromosome gene SEQ ID NO:2 and the homologous gene SEQ ID NO:1 on the X1 chromosome, two primers were designed. High-quality DNA was extracted from male and female spotted rockfish of known physiological sex, and Ch... exon _F:1、Ch exon PCR amplification was performed using two primers, _R:2. The reaction conditions and procedure are as follows: The PCR reaction system was 20 µL, including 5.8 µL of 10× Buffer, 4.0 µL of dNTPs, 0.2 µL of rTaq enzyme (5 U / µL), and upstream and downstream primers (Ch exon _F:1、Ch exon _R:2) 0.4µL each, DNA template 2.0µL, ddH2O 7.2µL. Touch-down PCR amplification program: 94℃ 3mins, 63.5℃ (-1℃, 3 cycles) 1min, 72℃ 1min30s, 3 cycles; 94℃ 30s, 60.5℃ 30s, 72℃ 1min30s, 30 cycles; 72℃ 10min, 15℃ storage. PCR products were distinguished by 1.5% agarose gel electrophoresis, revealing differences between exon variants and non-variant exon genes in individuals. The differentially expressed exon variant and non-variant gene fragments were recovered from the gel and transformed into competent cells using the PMD18-T vector. Positive clones were selected for testing. Sequencing results confirmed that the homologous genes of the X and Y chromosomes of the spotted sea bream contained large inserted target DNA sequence fragments, such as... Figure 1 and Figure 2 As shown.

[0040] Example 2: Establishment and Application of Exon Insertion Variation Identification Technology for Spotted Sea Bream Gene

[0041] Genetic identification was conducted on spotted sea bream (12 of which were female and 12 were male) raised by Laizhou Mingbo Aquatic Products Co., Ltd. in Laizhou City, Yantai, Shandong Province.

[0042] High-quality DNA extraction: DNA was extracted from the fin rays of the spotted sea bream using the Tiangen Marine Animal DNA Extraction Kit. The integrity of the genomic DNA was identified by 1.0% agarose gel electrophoresis. The OD value of the DNA supernatant was measured using a UV spectrophotometer. The DNA concentration was adjusted to 70 ng / µL and stored at -20℃ for later use.

[0043] PCR reaction system and PCR amplification identification: Primers specific to the exon insertion variant of the spotted sea bream exon gene were used. exon _F:1 and Ch exon _R:2 The presence or absence of exon variants in the exon gene of the spotted sea bream was detected by PCR. The PCR reaction system was 20 µL, including 5.8 µL of 10× Buffer, 4.0 µL of dNTPs, 0.2 µL of rTaq enzyme (5 U / µL), and upstream and downstream primers (Ch... exon _F:1、Ch exon _R:2) 0.4µL each, DNA template 2.0µL, ddH2O 7.2µL. Touch-down PCR amplification program: 94℃ 3mins, 63.5℃ (-1℃, 3 cycles) 1min, 72℃ 1min30s, 3 cycles; 94℃ 30s, 60.5℃ 30s, 72℃ 1min30s, 30 cycles; 72℃ 10min, 4℃ storage. Electrophoresis on a 1.5% agarose gel at a constant voltage of 110V for 20 minutes clearly distinguished between individuals with inserted and non-inserted DNA genes in the exon formation of *Sinocyclocheilus davidii* (see [link to relevant documentation]). Figure 5 ).

[0044] Depend on Figure 5 It is evident that two target bands (521 bp and 210 bp) are amplified in individuals of spotted rock seabream with DNA insertion in their gene exons. Among them, the 521 bp band is the ChrY band, which is a specific target band for DNA insertion variation in gene exons. exon In individuals where no DNA insertion variants have occurred in the gene exons, only a single band of ChrX1 can be amplified. exon (210bp). Due to ChrY exon The marker is located on the male Y chromosome and exhibits male-linked inheritance characteristics; therefore, ChrY... exon This fragment is also a DNA marker unique to the Y chromosome of male spotted rock snapper, and ChrX1 exon These are DNA characteristic markers shared by male and female spotted sea bream, which can be used to distinguish selected spotted sea bream. The method of this invention can not only quickly, accurately and efficiently identify whether the gene of the spotted sea bream to be tested has undergone gene exon insertion variation, but also has important significance and application value in the sex identification of spotted sea bream, the preparation of high-male seedlings and the selection of family lines.

[0045] As described above, this invention utilizes a pair of primers to amplify 521 bp and 210 bp bands in individuals with DNA insertion mutations, while only a 210 bp band is amplified in individuals without insertion mutations. These bands can be distinguished by agarose gel electrophoresis, thus enabling rapid and accurate identification of DNA insertion mutations in the exons of the spotted rockfish gene. The detection method of this invention significantly shortens the identification time, improves detection efficiency, and has important application value in sex determination, high-male seedling preparation, and family selection of spotted rockfish.

Claims

1. A specific molecular marker for the genetic sex determination of spotted sea bream, characterized in that: The specific molecular markers are DNA fragments with nucleotide sequences as shown in SEQ ID NO:1 and DNA fragments with nucleotide sequences as shown in SEQ ID NO:

2.

2. The application of the specific molecular marker described in claim 1 in identifying the genetic sex of spotted sea bream; characterized in that: Specifically 1) PCR amplification: Genomic DNA was extracted from the spotted sea bream to be tested; using the obtained genomic DNA as a template, PCR amplification was performed using primers, the nucleotide sequences of which are shown in SEQ ID NO:3 and SEQ ID NO:4; 2) Result Interpretation: Only a single DNA fragment of 210 bp as shown in SEQ ID NO:1 was amplified, indicating that the spotted sea bream being tested was female; Two DNA fragments, 210bp and 521bp, as shown in SEQ ID NO:1 and SEQ ID NO:2, were amplified, indicating that the spotted sea bream being tested was male.

3. A method for identifying the genetic sex of spotted sea bream using the specific molecular markers described in claim 1, characterized in that, 1) PCR amplification: Genomic DNA was extracted from the spotted sea bream to be tested; using the obtained genomic DNA as a template, PCR amplification was performed using primers, the nucleotide sequences of which are shown in SEQ ID NO:3 and SEQ ID NO:4; 2) Result Interpretation: Only a single DNA fragment of 210 bp as shown in SEQ ID NO:1 was amplified, indicating that the spotted sea bream being tested was female; Two DNA fragments, 210bp and 521bp, as shown in SEQ ID NO:1 and SEQ ID NO:2, were amplified, indicating that the spotted sea bream being tested was male.

Images