SNP (Single Nucleotide Polymorphism) molecular marker related to disease resistance character of Tibetan sheep, amplification primer and application of SNP molecular marker

By identifying and applying the SNP site at 14,274,133 bases on chromosome 13 of the international sheep reference genome Oar_v4.0 in Tibetan sheep populations, and designing specific primer pairs, the problem of identifying disease resistance traits in Tibetan sheep was solved, achieving efficient and accurate marker-assisted selection for disease resistance traits and improving breeding efficiency.

CN121674580APending Publication Date: 2026-03-17LANZHOU INST OF ANIMAL SCI & VETERINARY PHARMA OF CAAS +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-16
Publication Date
2026-03-17

AI Technical Summary

Technical Problem

Existing technologies are insufficient for efficiently identifying SNP markers for disease resistance traits in Tibetan sheep. The lack of stable and specific molecular markers and detection tools leads to low efficiency in traditional phenotypic breeding and makes it difficult to accurately identify superior disease-resistant gene resources in the early stages.

Method used

A genome-wide association study (GWAS) identified a SNP locus (g14274133C>G) on chromosome 13 of the Oar_v4.0 international sheep reference genome in Tibetan sheep populations. Specific primer pairs (F: 5'-CTGACTTTACAATGAGTAGGGG-3', R: 5'-TCCTTCAAGTTCTAGAGCCTA-3') were designed, and detection kits and assisted breeding methods were developed. Association analysis between different genotypes and the levels of IL-1α, IL-1β, IL-6, TNF-α, TNF-β, IL-1Ra, and IL-10 was used to provide non-diagnostic markers for disease resistance selection.

Benefits of technology

This study enabled the precise identification of disease resistance traits in Tibetan sheep, provided new SNP molecular marker resources, and significantly determined the immune status and disease resistance potential of individual Tibetan sheep, thereby improving breeding efficiency and accuracy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121674580A_ABST
    Figure CN121674580A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of molecular markers, in particular to an SNP (Single Nucleotide Polymorphism) molecular marker related to disease resistance characters of Tibetan sheep, an amplification primer and application of the SNP molecular marker. The invention provides an SNP (Single Nucleotide Polymorphism) molecular marker related to disease resistance characters of Tibetan sheep. The SNP molecular marker is positioned at the 14274133 basic group on the 13th chromosome of an international sheep reference genome Oarv4.0 version; the mutant basic group is C or G. The content of IL-1alpha, IL-1beta, IL-6, TNF-alpha, TNF-beta, IL-1Ra and IL-10 of a Tibetan sheep individual can be judged by detecting the basic group of the 14274133 nucleotide site on the No.13 chromosome of the Tibetan sheep, and a new SNP molecular marker resource is provided for non-diagnostic Tibetan sheep immune trait marker-assisted selection.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular marker technology, and in particular to SNP molecular markers, amplification primers and their applications related to disease resistance traits in Tibetan sheep. Background Technology

[0002] Tibetan sheep, a unique livestock resource of the Qinghai-Tibet Plateau, have developed strong resistance to diseases and excellent environmental adaptability through long-term natural and artificial selection in the harsh, high-altitude, and oxygen-deficient environment. This unique disease resistance trait is of paramount value for sheep breeding and even for research on livestock disease resistance mechanisms. However, as a complex quantitative trait controlled by multiple genes, traditional phenotypic breeding methods suffer from bottlenecks such as long cycles, low efficiency, and difficulty in early and accurate identification, severely restricting the efficient discovery and breeding utilization of its superior disease-resistant gene resources.

[0003] With the rapid development of molecular biology and genomics technologies, assisted selection through the search for molecular markers closely linked to specific economic traits has become a core strategy in modern animal breeding. Among these, single nucleotide polymorphisms (SNPs) are widely used for constructing high-density genetic maps and association analysis of important economic traits due to their wide distribution, abundance, high stability, and suitability for high-throughput genotyping. Currently, although some studies have conducted genetic assessments of traits such as production and reproduction in Tibetan sheep, systematic SNP marker discovery specifically targeting their core advantage—disease resistance—remains relatively weak, lacking sufficiently validated dedicated markers and detection tools suitable for molecular breeding practices.

[0004] Studies have shown that serum levels of pro-inflammatory cytokines (such as IL-1α, IL-1β, IL-6, TNF-α, and TNF-β) and anti-inflammatory cytokines (such as IL-1Ra and IL-10) are closely related to the body's immune status and disease resistance. Pro-inflammatory cytokines rapidly increase upon pathogen invasion, initiating an inflammatory response and clearing pathogens; while anti-inflammatory cytokines regulate the degree of inflammatory response and prevent excessive immune damage. Therefore, changes in the levels of these cytokines can serve as important biochemical indicators for evaluating an individual's immune regulatory capacity and disease resistance potential. By detecting the levels of these factors in the serum of Tibetan sheep, the strength of their immune response and disease resistance can be indirectly assessed, providing a reliable phenotypic basis for establishing a molecular marker-based disease resistance evaluation system.

[0005] Therefore, it is urgent to accurately identify SNP loci significantly associated with key disease resistance traits in Tibetan sheep populations using advanced technologies such as genome-wide association studies (GWAS), and to develop stable and specific amplification primers accordingly. This is not only the scientific basis for elucidating the unique disease resistance genetic mechanism of Tibetan sheep, but also a crucial step in effectively transforming its disease resistance gene resources into breeding advantages, which is of great significance for breeding new breeds of highly disease-resistant sheep and ensuring the healthy and sustainable development of animal husbandry. Summary of the Invention

[0006] The purpose of this invention is to provide SNP molecular markers, amplification primers and their applications related to disease resistance traits in Tibetan sheep.

[0007] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides a SNP molecular marker associated with disease resistance in Tibetan sheep. The SNP molecular marker is located at the 14,274,133rd base on chromosome 13 of the International Sheep Reference Genome Oar_v4.0 version; the mutated base is C or G.

[0008] Preferably, when the base of the SNP molecular marker site is C, the genotype is CC or CG; when the base of the SNP molecular marker site is G, the genotype is GG; the disease resistance trait is the content of IL-1α, IL-1β, IL-6, TNF-α, TNF-β, IL-1Ra, and IL-10; the IL-1α, IL-6, and TNF-β content of Tibetan sheep individuals with CC and CG genotypes is significantly lower than that of individuals with GG genotype, the IL-1β and TNF-α content of Tibetan sheep individuals with CC genotype is significantly lower than that of individuals with GG genotype, the IL-1Ra content of Tibetan sheep individuals with CC genotype is significantly lower than that of individuals with CG and GG genotypes, and the IL-10 content of Tibetan sheep individuals with CC genotype is significantly higher than that of individuals with GG genotype.

[0009] This invention provides the application of the aforementioned SNP molecular marker in the preparation of products for detecting the disease resistance of Tibetan sheep or products for assisted breeding of Tibetan sheep.

[0010] This invention provides primer pairs for amplifying the aforementioned SNP molecular markers, the nucleotide sequences of which are shown in SEQ ID No: 2~3.

[0011] This invention provides the application of the primer pair described above in the preparation of products for detecting the disease resistance of Tibetan sheep or products for assisted breeding of Tibetan sheep.

[0012] This invention provides a kit for detecting the disease resistance of Tibetan sheep, comprising a reagent for detecting the SNP molecular marker or the primer pair.

[0013] This invention provides a kit for assisted breeding of Tibetan sheep, comprising reagents for detecting the SNP molecular markers or the primer pairs.

[0014] This invention provides a method for marker-assisted selection of disease resistance traits in Tibetan sheep for non-diagnostic purposes, comprising the following steps: (1) Extracting genomic DNA from Tibetan sheep; (2) Using the Tibetan sheep genomic DNA obtained in step (1) as a template, amplification is performed using the primer pair to obtain the amplification product; (3) Perform genotyping analysis on the amplification products to obtain Tibetan sheep with different genotypes; associate the genotypes of Tibetan sheep with disease resistance indicators; the disease resistance indicators are the contents of IL-1α, IL-1β, IL-6, TNF-α, TNF-β, IL-1Ra and IL-10.

[0015] Preferably, the amplification system in step (2) consists of 25 μL of PCR enzyme, 1 μL each of upstream and downstream primers, and 1 μL of template DNA.

[0016] Preferably, the amplification program in step (2) is: 98℃ for 2 min; 98℃ for 10 s, 56℃ for 10 s, 72℃ for 10 s, for a total of 40 cycles; and 72℃ extension for 2 min.

[0017] Compared with the prior art, the present invention has the following beneficial effects: The SNP molecular marker described in this invention is located at position 14,274,133 on chromosome 13 of the International Sheep Reference Genome Oar_v4.0; the variant type is C / G, named g14274133C>G, and there are three genotypes. When position 14,274,133 on chromosome 13 is C, the genotype is CC or CG; when position 14,274,133 on chromosome 13 is G, the genotype is GG. Different genotypes are correlated with IL-1α, IL-1β, and IL-1... 6. Association analysis of TNF-α, TNF-β, IL-1Ra, and IL-10 levels revealed that Tibetan sheep individuals with CC and CG genotypes had significantly lower levels of IL-1α, IL-6, and TNF-β than those with the GG genotype; Tibetan sheep individuals with the CC genotype had significantly lower levels of IL-1β and TNF-α than those with the GG genotype; Tibetan sheep individuals with the CC genotype had significantly lower levels of IL-1Ra than those with the CG and GG genotypes; and Tibetan sheep individuals with the CC genotype had significantly higher levels of IL-10 than those with the GG genotype. This invention demonstrates that the bases at the g14274133C>GSNP site on Tibetan sheep chromosome 13 are SNP markers related to IL-1α, IL-1β, IL-6, TNF-α, TNF-β, IL-1Ra, and IL-10 in Tibetan sheep. By detecting the bases at the 14274133rd nucleotide site on Tibetan sheep chromosome 13, the levels of IL-1α, IL-1β, IL-6, TNF-α, TNF-β, IL-1Ra, and IL-10 in an individual Tibetan sheep can be determined. This invention provides a new SNP molecular marker resource for the selection of immune trait markers in Tibetan sheep for non-diagnostic purposes. Attached Figure Description

[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0019] Figure 1 This is an agarose gel electrophoresis image of the PCR amplification products.

[0020] Figure 2 This is a sequencing peak diagram. Detailed Implementation

[0021] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0022] Example 1

[0023] 1. Sample collection

[0024] The samples were collected from Tibetan sheep populations under natural grazing conditions, including 76 samples from Gannan Tibetan Autonomous Prefecture in Gansu Province, 54 samples from Yushu Tibetan Autonomous Prefecture in Qinghai Province, and 57 samples from Shigatse City in Tibet Autonomous Region. 5 mL of blood samples were collected from 187 fasting Tibetan sheep in clean, anticoagulant vacuum blood collection tubes. The tubes were allowed to stand for 30 min, then centrifuged at 3500 rpm for 15 min. The supernatant was collected into clean PE tubes, sealed, and stored at -20°C. Another 5 mL blood sample was collected in blood collection tubes containing EDTA-K2 anticoagulant. After collection, the samples were quickly mixed and temporarily stored in a sampling box containing ice packs. After being transported back to the laboratory, the samples were frozen at -20°C for genomic DNA extraction.

[0025] 2. Main Reagents and Instruments

[0026] EDTA-K2 vacuum blood collection tubes were purchased from Jiangsu Yuli Medical Instrument Co., Ltd.; the blood genomics extraction kit was purchased from Tiangen Biotech (Beijing) Co., Ltd.; the NanoDrop2000 spectrophotometer was purchased from Thermo Fisher Scientific, USA; DL1000 markers, agarose, and nucleic acid dyes were purchased from Beijing Solarbio Science & Technology Co., Ltd.; the gold-labeled mix (green) was purchased from Beijing Qingke Biotechnology Co., Ltd.; the electrophoresis apparatus was purchased from Beijing Liuyi Instrument Factory; and the PCR instrument was purchased from BioRad. The IL-1α, IL-1β, IL-6, TNF-α, TNF-β, IL-1Ra, and IL-10 detection kits were purchased from Nanjing Jiancheng Bioengineering Institute.

[0027] 3 Methods

[0028] 3.1 Detection of IL-1α, IL-1β, IL-6, TNF-α, TNF-β, IL-1Ra and IL-10

[0029] The assay was performed using an enzyme-linked immunosorbent assay (ELISA) according to the test kit from Nanjing Jiancheng Biotechnology Research Institute. The assay steps were as follows: (1) Serial dilution of the standard according to the instructions; (2) Add 100 μL of antibody to each well, coat for 2 hours, discard the liquid and spin dry; (3) Add 300 μL of diluted washing buffer to each well, shake for 30 seconds, discard the washing buffer and pat dry with absorbent paper, repeat 5 times; (4) Add 200 μL of blocking buffer to each well, gently shake to mix, let stand at room temperature for 30 minutes, discard the liquid and spin dry; (5) Add 300 μL of diluted washing buffer to each well, shake for 30 seconds, discard the washing buffer and pat dry with absorbent paper, repeat 5 times; (6) Add 25 μL of coating buffer, 25 μL of sample and 50 μL of standard to each well, gently shake to mix; (7) Add 100 μL of HRP to each well, gently shake to mix, let stand at room temperature for 60 min, then discard the liquid and spin dry; (8) Add 300 μL of diluted washing solution to each well, shake for 30 s, then discard the washing solution and pat dry with absorbent paper, repeat 5 times; (9) Add 100 μL of color developing solution to each well, gently shake to mix, and develop color for 15 min; (10) Add 100 μL of stop solution to each well to stop the reaction (at this time, the blue color immediately turns yellow); (11) Zero the blank well and measure the OD value of each well at a wavelength of 450 nm; (12) Make a standard curve using the OD value of the standard and obtain the curve formula, then substitute the OD value measured by the sample test tube into the calculation formula to obtain the result.

[0030] 3.2 Extraction of genomic DNA from blood

[0031] Genomic DNA was extracted from blood samples using the blood genome extraction kit from Tiangen Biotech (Beijing) Co., Ltd. The concentration and purity of the extracted DNA were detected by ultraviolet spectrophotometer. A concentration >20 ng / μL and an OD260 / OD280 between 1.7 and 1.9 met the experimental requirements. The DNA was stored at -20℃ for later use.

[0032] 3.3 Primer Design

[0033] Based on the gene sequence of chromosome 13 in the Oar_v4.0 version of the international sheep genome (GenBank accession number: NC_019470.2), a pair of specific primers containing the g14274133C>G SNP site was designed using Primer Premier 5.0 software.

[0034] Primer sequences: F: 5'-CTGACTTTACAATGAGTAGGGG-3'; R: 5'-TCCCTTCAAGTTCTAGAGCCTA-3'.

[0035] As shown in SEQ ID No: 2 and 3.

[0036] The amplified fragment was 186 bp in length, and the primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0037] 3.4 PCR amplification and sequencing

[0038] PCR amplification system 25μL: Gold Mix (green) 22μL, upstream and downstream primers 1μL each, template 1μL.

[0039] PCR amplification program: 98℃ for 2 min; 98℃ for 10 s, 56℃ for 10 s, 72℃ for 10 s, for a total of 40 cycles; extension at 72℃ for 2 min.

[0040] PCR products were detected by 1.5% agarose gel electrophoresis. After passing the agarose gel electrophoresis test, the PCR products were sequenced using direct sequencing, which was performed by Beijing Qingke Biotechnology Co., Ltd. The amplified nucleotide sequence is shown in SEQ ID No. 1, and the SNP marker is located at position 75 of the nucleotide sequence shown in SEQ ID No. 1.

[0041] SEQ ID No.1

[0042] CTGACTTTACAATGAGTAGGGGGTCCTTAAAAGTCTAATATTTGATGCTTCTCAAATAATATGAAAAAGACGACGAGAAATCACTGAGCGGAGCTTCAGTTCCAGAGACAGTCATATTCATCCGCTCATTCCCTACTCCATCCTAGTTTCTACTGAGGAAGAGAGTAGGCTCTAGAACTTGAAGGA

[0043] The sequencing results of PCR products were compared using the bioanalysis software MEGA 6.0, and the sequencing peak diagrams were analyzed to complete the typing.

[0044] 4. Statistical Analysis

[0045] Based on the genotyping results, the number of individuals with different genotypes at each locus was counted. Popgen32 software was used to calculate the gene frequency, genotype frequency, effective allele count (Ne), locus heterozygosity (He), and Hardy-Weinberg equilibrium test. Polymorphism information content (PIC) was calculated using PIC software. IBM SPSS Statistics 22 software was used to analyze the association between different genotypes in Tibetan sheep and IL-1α, IL-1β, IL-6, TNF-α, TNF-β, IL-1Ra, and IL-10 using a general linear model. Results are expressed as mean ± standard error.

[0046] 5 Results

[0047] 5.1 PCR amplification and sequencing results

[0048] The amplification products of the g14274133C>G SNP site on chromosome 13 of Tibetan sheep were detected using 1.5% agarose gel electrophoresis (see [link to article]). Figure 1 The bands were clear and free of impurities, indicating good specificity. The PCR product fragment size was 186 bp, which met the expected size, and the next step of the experiment could be carried out.

[0049] The peak chromatogram and sequence obtained after purification and sequencing of the PCR product are shown below. Figure 2 .Depend on Figure 2 It can be seen that the CG mutation occurs at the g14274133C>GSNP site, resulting in three genotypes: CC, CG, and GG.

[0050] 5.2 Statistical Analysis Results

[0051] Genotype and allele frequencies of the g14274133C>G SNP locus on chromosome 13 of Tibetan sheep were analyzed from a population genetics perspective. Table 1 shows that the CC genotype had the highest frequency at the g14274133C>G SNP locus, indicating it was the dominant genotype, while the C allele frequency was 65.2%, also indicating it was the dominant allele. The χ² fitness test showed that the SNP locus significantly deviated from Hardy-Weinberg equilibrium (P<0.05) (Table 1). The expected heterozygosity of this locus was 0.454, and the PIC was 0.351, indicating moderate polymorphism.

[0052] Table 1. Polymorphism of SNP site g14274133C>G on chromosome 13 of Tibetan sheep

[0053] 5.3 Association analysis between different genotypes and IL-1α, IL-1β, IL-6, TNF-α, TNF-β, IL-1Ra, and IL-10

[0054] The association between different genotypes of Tibetan sheep and the levels of IL-1α, IL-1β, IL-6, TNF-α, TNF-β, IL-1Ra, and IL-10 was analyzed using a general linear model in IBM SPSS Statistics 22 software. The results showed that the levels of IL-1α, IL-6, and TNF-β in Tibetan sheep with the CC and CG genotypes were significantly lower than those with the GG genotype (p<0.05). The levels of IL-1β and TNF-α in Tibetan sheep with the CC genotype were significantly lower than those with the GG genotype (p<0.05). The level of IL-1Ra in Tibetan sheep with the CC genotype was significantly lower than that in those with the CG and GG genotypes (p<0.05). The level of IL-10 in Tibetan sheep with the CC genotype was significantly higher than that in those with the GG genotype (p<0.05). This indicates that the IL-1Ra level on chromosome 13 of Tibetan sheep is g14274133C>G. The bases at the SNP sites were SNP markers related to Tibetan sheep IL-1α, IL-1β, IL-6, TNF-α, TNF-β, IL-1Ra, and IL-10. The results are shown in Table 2.

[0055] Table 2. Correlation analysis between different genotypes and IL-1α, IL-1β, IL-6, TNF-α, TNF-β, IL-1Ra, and IL-10.

[0056] Note: Different lowercase letters in the intercalation of data in the same row indicate significant differences (P < 0.05).

[0057] In summary, the SNP molecular marker described in this invention is located at the 14,274,133rd base on chromosome 13 of the International Sheep Reference Genome Oar_v4.0; the variant type is C / G, named g14274133C>G, and there are three genotypes. When the 14,274,133rd base on chromosome 13 is C, the genotype is CC or CG; when the 14,274,133rd base on chromosome 13 is G, the genotype is GG. Different genotypes are associated with IL-1α, IL-1β, IL-6, TNF-α, TNF-β, and... Association analysis of IL-1Ra and IL-10 levels revealed that Tibetan sheep individuals with CC and CG genotypes had significantly lower levels of IL-1α, IL-6, and TNF-β than those with the GG genotype (p<0.05), Tibetan sheep individuals with the CC genotype had significantly lower levels of IL-1β and TNF-α than those with the GG genotype (p<0.05), Tibetan sheep individuals with the CC genotype had significantly lower levels of IL-1Ra than those with the CG and GG genotypes (p<0.05), and Tibetan sheep individuals with the CC genotype had significantly higher levels of IL-10 than those with the GG genotype (p<0.05). This invention demonstrates that the bases at the g14274133C>G SNP site on Tibetan sheep chromosome 13 are SNP markers related to IL-1α, IL-1β, IL-6, TNF-α, TNF-β, IL-1Ra, and IL-10 in Tibetan sheep. By detecting the bases at the 14274133rd nucleotide site on Tibetan sheep chromosome 13, the levels of IL-1α, IL-1β, IL-6, TNF-α, TNF-β, IL-1Ra, and IL-10 in individual Tibetan sheep can be determined. This invention provides a new SNP molecular marker resource for marker-assisted selection of disease resistance traits in Tibetan sheep for non-diagnostic purposes.

[0058] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A SNP molecular marker related to disease resistance traits of Tibetan sheep, characterized in that, The SNP molecular marker is located at base 14274133 of chromosome 13 of the international sheep reference genome Oar_v4.0 version; the mutation base is C or G.

2. The SNP molecular marker of claim 1, wherein, When the base of the SNP molecular marker site is C, the genotype is CC or CG; when the base of the SNP molecular marker site is G, the genotype is GG; the disease resistance trait is the content of IL-1α, IL-1β, IL-6, TNF-α, TNF-β, IL-1Ra and IL-10; the contents of IL-1α, IL-6 and TNF-β of the Tibetan sheep individual with the CC and CG genotypes are significantly lower than those of the individual with the GG genotype, the content of IL-1β and TNF-α of the Tibetan sheep individual with the CC genotype is significantly lower than that of the individual with the GG genotype, the content of IL-1Ra of the Tibetan sheep individual with the CC genotype is significantly lower than that of the individual with the CG and GG genotypes, and the content of IL-10 of the Tibetan sheep individual with the CC genotype is significantly higher than that of the individual with the GG genotype.

3. The SNP molecular marker of claim 1 or 2 is applied to the preparation of a product for detecting the disease resistance of Tibetan sheep or a product for assisting the breeding of Tibetan sheep.

4. A primer pair for amplifying the SNP molecular marker of claim 1 or 2, characterized in that, The nucleotide sequence of the primer pair is shown in SEQ ID No: 2~3.

5. The primer pair of claim 4 is applied to the preparation of a product for detecting the disease resistance of Tibetan sheep or a product for assisting the breeding of Tibetan sheep.

6. A kit for detecting the resistance of Tibetan sheep to disease, characterized by, The reagent for detecting the SNP molecular marker of claim 1 or 2 or the primer pair of claim 4.

7. A kit for assisted breeding of Tibetan sheep, characterized in that, The reagent for detecting the SNP molecular marker of claim 1 or 2 or the primer pair of claim 4.

8. A method of marker assisted selection of disease resistance traits in Tibetan sheep for non-diagnostic purposes, characterized in that, The method comprises the following steps: (1) extracting the genomic DNA of Tibetan sheep; (2) using the genomic DNA of Tibetan sheep obtained in step (1) as a template, amplifying by using the primer pair of claim 4 to obtain an amplification product; (3) performing genotype analysis on the amplification product to obtain Tibetan sheep with different genotypes; correlating the genotype of Tibetan sheep with the disease resistance index; the disease resistance index is the content of IL-1α, IL-1β, IL-6, TNF-α, TNF-β, IL-1Ra and IL-10.

9. The method of claim 8, wherein, The amplification system of step (2) is 25 μL in total and comprises: 22 μL of PCR enzyme, 1 μL of each of the upstream and downstream primers, and 1 μL of template DNA.

10. The method of claim 8, wherein, The amplification program of step (2) is: 98℃ for 2 min; 98℃ for 10 s, 56℃ for 10 s, 72℃ for 10 s, for a total of 40 cycles; 72℃ for 2 min for extension.