SNP (Single Nucleotide Polymorphism) molecular marker related to pig semen quality trait gene KIF26B, primer pair and application of SNP molecular marker

By discovering the SNP molecular marker upstream of the pig KIF26B gene, primer pairs were designed for PCR amplification and sequencing analysis. Undesirable genotypes were screened and eliminated, solving the problem of difficulty in improving boar semen quality. This enabled early screening and breeding of semen quality traits, thus improving breeding results.

CN121674581APending Publication Date: 2026-03-17INST OF ANIMAL SCI & VETERINARY HUBEI ACADEMY OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-22
Publication Date
2026-03-17

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively improve boar semen quality, traditional breeding methods are ineffective in improving semen quality traits, and there is a lack of key genes and molecular markers for marker-assisted breeding.

Method used

By identifying SNP molecular markers upstream of the porcine KIF26B gene, designing primer pairs for PCR amplification and sequencing analysis, individuals carrying the T allele are screened, while individuals carrying the C allele are eliminated, enabling early screening and breeding of semen quality traits.

Benefits of technology

This technology enables early screening and breeding of boar semen quality traits, improving semen volume, sperm density, effective sperm density, forward motility, and reducing sperm abnormality rate, thereby enhancing the economic benefits of pig breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121674581A_ABST
    Figure CN121674581A_ABST
Patent Text Reader

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to a pig semen quality trait gene KIF26B, a primer pair and application of the SNP molecular marker and the primer pair, and relates to the technical field of pig molecular markers. The quality traits of the boar semen are semen volume, sperm density, effective sperm density, forward movement activity, sperm malformation rate and sperm motility traits; the molecular marker is located on the upstream of a pig KIF26B gene, the nucleotide sequence of the molecular marker is shown as SEQ ID NO.1 in a sequence table, and g.58 T gt exists at the 58bp position of the sequence; and C base mutation. The invention also provides a primer pair for amplifying the molecular marker and a method for breeding pigs by using the molecular marker. The SNP molecular marker in the pig KIF26B gene is found to be related to the semen volume, sperm density, effective sperm density, forward movement activity, sperm malformation rate and sperm activity characters of pigs for the first time, so that the SNP molecular marker can be used for marker-assisted selective breeding of the pigs, early screening of the quality characters of the semen of the pigs is realized, and the screening method is simple and rapid.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of porcine molecular marker technology, specifically to an SNP molecular marker, primer pair, and their application related to the porcine semen quality trait gene KIF26B. Background Technology

[0002] China is the world's largest producer and consumer of pork, and has become a major player in the global pork market. Artificial insemination technology plays a crucial role in the development of modern pig farming, serving as an important technical means to improve pork product quality, promote breed improvement, and facilitate large-scale pig farming. The quality of boar semen directly affects the success rate of artificial insemination and the boar's fertility, making it key to successful implementation of artificial insemination in pigs and directly impacting the economic benefits of pig farms. Semen quality traits are of medium to low heritability, and traditional breeding methods are unlikely to effectively improve boar semen quality. Understanding the genetic structure and detecting candidate genes and molecular markers related to semen quality traits can help improve genetic selection and accelerate the genetic process. Currently, there is still a shortage of key genes whose mechanisms of influence on semen quality traits can be utilized and elucidated. Therefore, identifying key molecular genetic markers controlling boar semen quality traits and using them for marker-assisted breeding is of great significance for improving boar semen quality and increasing economic benefits.

[0003] Kinesin family member 26B (KIF26B) encodes an intracellular motor protein believed to transport organelles along microtubules. This protein is essential for kidney development. It may play a crucial role in the tight adhesion between mesenchymal cells near the ureteral bud through interaction with the MYH10 gene. Related research results indicate that knockdown of KIF26B in T24 cells reduces cell proliferation, invasion, and migration.

[0004] Studies have shown that Kif26b can induce mesenchymal fibrosis in a renal fibrosis model by mediating Myh9 migration and myofibroblast differentiation. Other studies have shown that KIF26B can promote cell proliferation and migration through the FGF2 / ERK signaling pathway in breast cancer.

[0005] However, the molecular mechanism by which the KIF26B gene can improve semen quality in boars has not yet been reported. Summary of the Invention

[0006] The purpose of this invention is to overcome the shortcomings of the prior art and provide an SNP molecular marker, primer pair and its application related to the porcine semen quality trait gene KIF26B. This invention discovers an upstream SNP of the porcine KIF26B gene that is associated with porcine semen quality traits and can be used as a molecular marker for screening porcine semen quality traits and for pig breeding.

[0007] In a first aspect, the present invention provides an SNP molecular marker related to the porcine semen quality trait gene KIF26B, wherein the semen quality trait includes semen volume, sperm density, effective sperm density, forward motility, sperm abnormality rate, and sperm motility; the molecular marker is located upstream of the porcine KIF26B gene, and its nucleotide sequence is shown in SEQ ID NO.1 of the sequence listing, wherein there is a T58-C58 base mutation at position 58 bp of the sequence.

[0008] Furthermore, the T or C base polymorphism site at 58 bp in sequence SEQ ID NO.1 exhibits three genotypes: TT, TC, or CC, with the T allele being the dominant allele.

[0009] Secondly, the present invention provides the application of SNP molecular markers as described in the first aspect in the screening of bovine semen quality traits and / or in bovine breeding.

[0010] Thirdly, the present invention provides a primer pair for amplifying the molecular marker as described in the first aspect, the primer pair comprising: the nucleotide sequence of the upstream primer as shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer as shown in SEQ ID NO.3.

[0011] Fourthly, the present invention provides the application of primer pairs as described in the third aspect in the screening of bovine semen quality traits and / or in bovine breeding.

[0012] Fifthly, the present invention provides a kit for rapid breeding of pigs using SNP molecular markers as described in the first aspect, comprising primer pairs as described in the third aspect.

[0013] Sixthly, the present invention provides a method for screening boar semen quality traits and / or breeding boars, comprising the following steps: S1. Extract genomic DNA from pigs; S2. Using the genomic DNA obtained in step S1 as a template, perform PCR amplification using the primer pair as described in claim 4 to obtain the molecular marker as described in claim 1 and purify it. S3. Sequencing analysis was performed on the molecular markers purified in step S2. Individuals carrying the T allele at position 58 bp of the sequence were retained, while individuals carrying the C allele were discarded.

[0014] Furthermore, in step S1, genomic DNA is extracted from the ear margin tissue of the pig to be tested.

[0015] Furthermore, in step S2, the PCR reaction system is 50 μL, and the components of the system are: 100 ng genomic DNA, 25 μL PCR mix, 1 μL each of the above upstream and downstream primers, and ddH2O added to make up to a total volume of 50 μL; the PCR program is as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 59℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 10 min; and storage at 4℃.

[0016] Compared with the prior art, the beneficial effects of the present invention include: The present invention is the first to discover that a SNP molecular marker in the porcine KIF26B gene is associated with porcine semen quality traits, specifically semen volume, sperm density, effective sperm density, linear motility, sperm motility, abnormality rate, and effective sperm count. Therefore, this molecular marker can be used to screen for porcine semen quality traits and for breeding, that is, it provides a new application of a single SNP molecular marker in the porcine KIF26B gene in marker-assisted breeding for porcine semen quality traits, realizing early screening of porcine semen quality traits, and the screening method is simple and fast. Attached Figure Description

[0017] Figure 1 This is an agarose gel electrophoresis detection image of the PCR product in Example 1 of the present invention, where lane M is the DL1000 Marker, and lanes 1-5 are the amplified fragments from pigs, with a fragment size of 193bp. Figure 2 This is the sequencing map of the g.58T>C site in Example 1 of the present invention. Detailed Implementation

[0018] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0019] Example 1: Obtaining the SNP detection fragment of the porcine KIF26B gene and establishing a method for detecting polymorphic sites; 1. Extraction of porcine genomic DNA: The experimental pig breed used in this application was Large White, and the samples were obtained from Aonong Group. Pig genomic DNA was extracted using the Invitrogen Animal Tissue Genomic DNA Extraction Kit (PureLink™ Pro 96 GenomicDNA Purification Kit, K182104A), following the kit's instructions. The extracted DNA was tested for concentration and quality, and stored at -20°C for later use.

[0020] 2. Obtaining the SNP genetic marker fragment of the porcine KIF26B gene. (1) PCR amplification: Based on the SNP genetic marker detection sequence in the genomic sequence of the porcine KIF26B gene, a pair of primers was designed to amplify fragments at polymorphic sites.

[0021] The nucleotide sequence of this SNP genetic marker detection sequence is as follows: TCCGGTTTCCTTGTGTTTCGTGGAGGAAGTGTTGTATACCACATAGAGCTAGATCTGTGAACAAACACAGCCTCCCTGTAATGAACAGCAACAAGAATAACCCCGAGGTCTTGATTTCTTACTCAAAGACCTGGGACACCCAGGACAACTGAATACCATGTTTTTAGTTTACTGTTGCCACTTCTAGGAAGGC, as shown in SEQ ID NO.1.

[0022] The designed primers are as follows: Upstream primer: 5' TCCCCTTTCCTTGTGTTTCGT 3', as shown in SEQ ID NO.2.

[0023] Downstream primer: 5' GCCTTCCTAGAAGTGGCAACAG 3', as shown in SEQ ID NO.3.

[0024] Genomic DNA was extracted from the ear margin tissue of the pigs to be tested as a template. PCR amplification was performed using the primers designed above. The PCR reaction system was 50 μL, and the components of the system were: 100 ng genomic DNA, 25 μL PCR mix, 1 μL each of the above-mentioned upstream and downstream primers, and ddH2O was added to make up to a total volume of 50 μL.

[0025] The PCR procedure was as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 59℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 10 min; storage at 4℃. PCR products were detected by 1.5% agarose gel electrophoresis, and the results are attached. Figure 1 As shown, lane M is the DL1000 Marker, and lanes 1-5 are the amplified fragments from pigs, with a fragment size of 193bp.

[0026] (2) Purification of PCR products: The PCR amplification products were purified using the Gel Extraction Kit from Shanghai Sangon Biotech Co., Ltd. Specific steps are detailed in the kit's instruction manual.

[0027] 3. Detection of molecular markers using direct sequencing of PCR products: The purified PCR product obtained above was sent directly to Beijing Aoke Technology Co., Ltd. for sequencing. The genotype of this locus in the test population was determined based on the sequencing results. Analysis was performed using DNAStar software, and the results are attached. Figure 2 As shown, a T58-C58 allele mutation was found at 58 bp in the sequence shown in SEQ ID NO.1, i.e. g. 58 T > C. The above mutation causes polymorphism in the KIF26B gene.

[0028] Example 2: Detection of polymorphic distribution of molecular markers in pigs: In this embodiment, the polymorphism distribution of the porcine KIF26B gene g.58T>C site was detected in 195 pigs with the first-parity litter size trait. The detection results are shown in Table 1.

[0029] Table 1. Distribution pattern of KIF26B gene g. 58T > C site polymorphism: ; As shown in Table 1, the KIF26B gene at the g.58 T>C site in pigs exhibits three genotypes: TT, TC, and CC. Among them, the TT genotype is more common, and the T allele frequency is 72.8%.

[0030] Example 3: Association Analysis of Molecular Markers and Porcine Semen Quality Traits: To determine whether the porcine KIF26B gene g.58T>C locus is associated with differences in porcine semen quality traits, polymorphism detection was performed using the method established in Example 1. The correlation between different genotypes of this polymorphic locus and semen volume, sperm density, effective sperm density, forward motility, sperm abnormality rate, and sperm motility traits was analyzed. Analysis of variance for different SNP genotype combinations was performed using SAS statistical software (SAS Institute Inc, Version 9.1) GLM program, and significance tests were conducted. The model used was: Y... ij = μ+G i +F j +e ijk ;Y ij Here, μ represents the phenotypic value, and G represents the mean value. i Genotypic effects (including additive and dominant effects); F j For the comprehensive effect of pig farms; e ijk This is due to the residual effect.

[0031] Association analysis was conducted on different genotypes and semen quality traits in pigs. The statistical analysis results are shown in Table 2. Table 2. Association analysis between the KIF26B gene g.58T>C site and porcine semen quality traits: ; Note: The trait means in the table are expressed as mean ± standard deviation. Different values ​​for A and B indicate a significant difference (P < 0.05), * indicates a significant difference (P < 0.05), and ** indicates an extremely significant difference (P < 0.01). The relationship between semen quality traits was investigated using association analysis of the tested population using the GLM program in SAS software. The results are shown in Table 2. In this population, individuals with the TT and TC genotypes (G.58T > C locus of the KIF26B gene) had significantly higher sperm motility and lower sperm abnormality rate compared to individuals with the CC genotype (P < 0.05). The additive effect was significant (P < 0.05), and the additive effect of sperm abnormality rate was extremely significant (P < 0.01). Furthermore, individuals with the TT genotype had higher semen volume and forward motility than the other two genotypes, but this was not significant. Individuals with the TC genotype had higher sperm density and effective sperm density than the other two genotypes, but this was not significant.

[0032] Example 4: Application of KIF26B gene SNP molecular marker in screening for bovine semen quality traits and / or in bovine breeding; The SNP marker g. 58 T > C on the intron of the KIF26B gene is significantly associated with bovine semen quality traits, with significant correlations observed in sperm density, effective sperm count, sperm motility, and sperm abnormality rate (P < 0.05). The additive effects of effective sperm density and sperm motility are significant (P < 0.05), while the additive effect of sperm abnormality rate is highly significant (P < 0.01). Therefore, this SNP marker can be used to assist in selecting TT or TC individuals with good semen quality during pig breeding. Individuals carrying this dominant allele should be retained, while CC individuals should be culled, thereby improving the overall production performance of the herd.

[0033] The specific embodiments of the present invention described above do not constitute a limitation on the scope of protection of the present invention. Any other corresponding changes and modifications made in accordance with the technical concept of the present invention should be included within the scope of protection of the claims of the present invention.

Claims

1. A SNP molecular marker related to the pig semen quality trait gene KIF26B, characterized in that, The pig semen quality traits are semen volume, sperm density, effective sperm density, forward motility, sperm deformity rate and sperm motility traits; the molecular marker is located upstream of the pig KIF26B gene, and has a nucleotide sequence as shown in the sequence table SEQ ID NO. 1, and a T58-C58 base mutation exists at the 58th bp of the sequence.

2. The SNP molecular marker related to the pig semen quality trait gene KIF26B according to claim 1, characterized in that, The T or C base polymorphism site at the 58th bp in the sequence SEQ ID NO. 1 is expressed as three genotypes of TT, TC or CC, wherein the T allele is a dominant allele.

3. The SNP molecular marker according to any one of claims 1 or 2, is applied to screening of pig semen quality traits and / or pig breeding.

4. A primer pair for amplifying the molecular marker of claim 1, characterized in that, The primer pair comprises: the nucleotide sequence of the upstream primer is shown in SEQ ID NO. 2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.

3.

5. The primer pair according to claim 4, is applied to screening of pig semen quality traits and / or pig breeding.

6. A kit for rapid selection using the SNP molecular marker of claim 1, wherein, The primer pair according to claim 4 is comprised.

7. A method for screening of pig semen quality traits and / or pig breeding, characterized by, The method comprises the following steps: S1, extracting the genomic DNA of the pig; S2, using the genomic DNA obtained in step S1 as a template, performing PCR amplification by using the primer pair according to claim 4, obtaining the molecular marker according to claim 1 and purifying; S3, performing sequencing analysis on the purified molecular marker in step S2, retaining the individual carrying the T allele at the 58th bp of the sequence, and eliminating the individual carrying the C allele.

8. The method for screening of pig semen quality traits and / or pig breeding according to claim 7, characterized in that, In step S1, the genomic DNA is extracted from the ear tissue of the pig to be tested.

9. The method for screening of pig semen quality traits and / or pig breeding according to claim 7, characterized in that, In step S2, the PCR reaction system is 50 μL, and the components in the system are: genomic DNA 100 ng, PCR mix 25 μL, the above upstream and downstream primers each 1 μL, and ddH2O is added to a total volume of 50 μL; the running program of PCR is: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 59℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 10 min; 4℃ storage. In step S1, the genomic DNA is extracted from the ear tissue of the pig to be tested.