Neuronal methylation features from cell-free DNA and methods of use thereof

Abstract

Disclosed herein is a blood-based two-part diagnostic tool designed to diagnose a pre-symptomatic neurodegenerative disease. The first part consists of assays designed for amplifying and sequencing predetermined regions of cell-free DNA. The second part consists of python-derived conduits that analyze methylation characteristics to identify neuronal-derived DNA and provide a diagnosis of a pre-symptomatic neurodegenerative disease.

Description

Cross Reference to Related Applications

[0001] This application is an international application claiming the benefit of U.S. Provisional Application No. 63 / 517,324, filed August 2, 2023, and U.S. Provisional Application No. 63 / 552,528, filed February 12, 2024, each of which is incorporated by reference herein in its entirety and for all purposes.

[0002] SEQUENCE LISTING The material in the accompanying Sequence Listing is hereby incorporated by reference in its entirety. The accompanying file named “062097-502001WO_SL_ST26.xml” was created on August 2, 2024, and is 8,834 bytes. TECHNICAL FIELD

[0003] Disclosed herein is a blood-based two-part diagnostic tool designed to diagnose pre-symptomatic neurodegenerative conditions. The first part consists of an assay designed to amplify and sequence a predetermined region of cell-free DNA. The second part consists of a python-derived pipeline that analyzes methylation signatures to identify DNA of neuronal origin and provide a diagnosis of a pre-symptomatic neurodegenerative condition. BACKGROUND

[0004] Current standard of care for diagnosing neurodegenerative conditions, such as Alzheimer’s disease and Parkinson’s disease, uses a series of memory and physical tests to identify the onset of any symptoms associated with said conditions. If an associated symptom is identified, it indicates that neuronal cell death has progressed beyond repair. There is currently no known method for diagnosing neurodegenerative conditions prior to the onset of symptoms.

[0005] Research has made significant therapeutic breakthroughs, the results of which show promising evidence of treatments that slow neuronal cell death. However, without a pre-symptomatic diagnosis, treatments cannot be administered prior to irreversible neuronal cell death.

[0006] The present disclosure addresses these and other issues in the art. SUMMARY

[0007] The present technology generally relates to a pre-screening method that can identify neurodegenerative conditions prior to the onset of symptoms. The disclosed method can be used to diagnose pre-symptomatic neurodegenerative diseases and combined with appropriate treatments to prevent or delay the onset of disease in a patient.

[0008] On one hand, this disclosure provides a method for treating a subject who has a neurodegenerative disease or is at risk of developing a neurodegenerative disease, the method comprising: (i) obtaining cell-free DNA from a blood sample from the subject; (ii) analyzing the methylation pattern of a DNA region in the cell-free DNA, wherein the region is selected from the regions listed in Tables 2-5; (iii) determining the percentage of cell-free DNA from neurons; (iv) comparing the percentage of cell-free DNA from neurons with a control; and (v) administering a therapeutic agent for treating or preventing a neurodegenerative disease when the percentage of cell-free DNA from neurons is greater than that of the control.

[0009] In some embodiments, step (ii) includes analyzing the methylation pattern of the entire amplicon of DNA. In some embodiments, the length of the entire amplicon is at least about 50 base pairs (bp). In some embodiments, the length of the entire amplicon is between about 50 and about 500 base pairs.

[0010] In some embodiments, the therapeutic agent is administered when the percentage of cell-free DNA from neurons is greater than about 5%. In some embodiments, the therapeutic agent is administered when the percentage of cell-free DNA from neurons is greater than about 7%. In some embodiments, the therapeutic agent is administered when the percentage of cell-free DNA from neurons is greater than about 9%.

[0011] In another aspect, this disclosure provides a method for treating a subject who has a neurodegenerative disease or is at risk of developing a neurodegenerative disease, the method comprising: (i) obtaining cell-free DNA from a blood sample from the subject; (ii) analyzing the methylation pattern of a DNA region in the cell-free DNA, wherein the region is selected from the regions listed in Tables 2-5; (iii) determining the percentage of cell-free DNA from neurons; and (iv) administering a therapeutic agent for treating or preventing a neurodegenerative disease when the percentage of cell-free DNA from neurons is greater than about 5%.

[0012] In another aspect, this disclosure provides a method for analyzing biological samples of a subject, the method comprising: (i) obtaining cell-free DNA from a blood sample from the subject; (ii) analyzing the methylation pattern of a DNA region in the cell-free DNA, wherein the region is selected from the regions listed in Tables 2-5; (iii) determining the percentage of cell-free DNA from neurons; and (iv) comparing the percentage of cell-free DNA from neurons with a control.

[0013] In another aspect, this disclosure provides a method for measuring neuronal cell death in a subject, the method comprising: (i) obtaining cell-free DNA from a blood sample from the subject; (ii) analyzing the methylation pattern of a DNA region in the cell-free DNA, wherein the region is selected from the regions listed in Tables 2-5; (iii) determining the percentage of cell-free DNA from neurons; and (iv) comparing the percentage of cell-free DNA from neurons with a control.

[0014] In another aspect, this disclosure provides a method for selecting a patient for treatment with a therapeutic agent for treating neurodegenerative diseases or disorders, the method comprising: (i) obtaining cell-free DNA from a blood sample from the subject; (ii) analyzing the methylation pattern of a DNA region in the cell-free DNA, wherein the region is selected from the regions listed in Tables 2-5; (iii) determining the percentage of cell-free DNA from neurons; and (iv) comparing the percentage of cell-free DNA from neurons with a control; wherein the patient is selected for treatment when the percentage of cell-free DNA from neurons is greater than that of the control.

[0015] In some embodiments, step (ii) includes analyzing the methylation pattern of the entire amplicon of DNA. In some embodiments, the length of the entire amplicon is at least about 50 base pairs (bp). In some embodiments, the length of the entire amplicon is between about 50 and about 500 base pairs.

[0016] In some implementations, patients are selected for treatment when the percentage of cell-free DNA from neurons is greater than about 5%. In some implementations, patients are selected for treatment when the percentage of cell-free DNA from neurons is greater than about 7%. In some implementations, patients are selected for treatment when the percentage of cell-free DNA from neurons is greater than about 9%.

[0017] In some implementations, a higher percentage of cell-free DNA from neurons indicates an increased risk of neurodegenerative disorders or traumatic brain injury.

[0018] In another aspect, this disclosure provides a computer product including a non-transitory computer-readable medium storing a plurality of instructions, which, when executed, control a computer system to analyze a biological sample from a subject to determine the subject's risk of neurodegenerative disorders, the biological sample comprising cell-free DNA, the instructions comprising: (i) identifying a first DNA methylation pattern occurring in neurons at a rate above a threshold, wherein the first DNA methylation pattern includes methylation of one or more methylated regions and optionally unmethylation of one or more unmethylated regions; (ii) analyzing a second DNA methylation pattern of the cell-free DNA; and (iii) calculating the relative abundance of one or more methylated regions and optionally one or more unmethylated regions in the cell-free DNA; and (iv) determining the subject's risk of neurodegenerative disorders by comparing the relative abundance with a control.

[0019] In another aspect, this disclosure provides a method for determining the efficacy of a potential treatment for neurodegenerative disorders, the method comprising: (i) obtaining cell-free DNA from blood samples from multiple subjects, wherein the potential treatment has been administered to the subjects; (ii) analyzing the methylation pattern of a DNA region in the cell-free DNA, wherein the region is selected from the regions listed in Tables 2-5; (iii) determining the percentage of cell-free DNA from neurons; and (iv) comparing the percentage of cell-free DNA from neurons with a control; wherein the potential treatment is effective when the percentage of cell-free DNA from neurons is lower than that of the control.

[0020] In some implementations, steps (i)-(iv) are repeated at least once. In some implementations, steps (i)-(iv) are repeated weekly.

[0021] In some implementations, potential treatments include recombinant iduronate 2-sulfatase (IDS) protein, leucine-rich repeatable kinase 2 (LRRK2) inhibitors, recombinant pregranulin protein (PGRN) protein, recombinant N-sulfoglucosamine sulfonylhydrolase (SGSH) protein, recombinant α-L-iduronase (IDUA) recombinant protein, receptor-interacting serine / threonine protein kinase 1 (RIPK1) inhibitors, or eukaryotic translation initiation factor 2B (eIF2B) activators.

[0022] In some implementations, potential treatments include DNL310 (ETV:IDS), BIIB122 / DNL151, TAK-594 / DNL593, DNL126 (ETV:SGSH), DNL622 (ETV:IDUA), SAR443820 / DNL788, DNL343, or SAR443122 / DNL758.

[0023] In some embodiments, determining the percentage of cell-free DNA from neurons includes comparing the methylation pattern of cell-free DNA with the methylation pattern of neuronal DNA, wherein the neuronal DNA methylation pattern includes methylation in one or more methylated regions and optionally includes unmethylation in one or more unmethylated regions.

[0024] In another aspect, this disclosure provides a computer-implemented method for analyzing biological samples, comprising: (i) identifying a first DNA methylation pattern occurring in neurons at a rate above a threshold, wherein the first DNA methylation pattern includes methylation in one or more methylated regions and optionally unmethylation in one or more unmethylated regions; (ii) analyzing a second DNA methylation pattern of the cell-free DNA; and (iii) calculating the relative abundance of one or more methylated regions and optionally one or more unmethylated regions in the cell-free DNA; and (iv) determining the risk of neurodegenerative disease in a subject by comparing the relative abundance with a control.

[0025] In some implementations, step (ii) includes analyzing the methylation pattern of the entire amplicon of DNA.

[0026] In some embodiments, the length of the entire amplicon is at least about 50 base pairs (bp). In some embodiments, the length of the entire amplicon is between about 50 and about 500 base pairs.

[0027] In some embodiments, the control is the percentage of cell-free DNA derived from neurons in a blood sample from an untreated subject, the percentage of cell-free DNA derived from neurons in a blood sample from a subject prior to treatment, or a threshold. In some embodiments, the threshold is a percentage of cell-free DNA derived from neurons greater than about 5%. In some embodiments, the threshold is a percentage of cell-free DNA derived from neurons greater than about 7%. In some embodiments, the threshold is a percentage of cell-free DNA derived from neurons greater than about 9%.

[0028] In some implementations, the neurodegenerative disease is selected from Alzheimer's disease, Huntington's disease, Parkinson's disease, amyotrophic lateral sclerosis (ALS), ataxia, multiple sclerosis, multiple system atrophy, concussion, frontotemporal dementia-granulin, mucopolysaccharidosis type I (MPS I), mucopolysaccharidosis type II (MPS II; Hunt syndrome), or mucopolysaccharidosis type IIIA (MPS IIIA; Sanfilip syndrome).

[0029] In some embodiments, the neurons are motor neurons, spinal motor neurons, sensory neurons, interneurons, dopaminergic neurons, cholinergic neurons, GABAergic neurons, glutamatergic neurons, or cortical neurons. In some embodiments, the neurons originate from the forebrain, midbrain, or hindbrain. In some embodiments, the neurons originate from the frontal lobe, temporal lobe, parietal lobe, occipital lobe, cerebellum, or brainstem.

[0030] In some embodiments, analyzing methylation patterns includes converting 5-methylcytosine in the cell-free DNA into different nucleotides. In some embodiments, the conversion includes bisulfite conversion or enzymatic conversion.

[0031] In some implementations, the subject has mild cognitive impairment. In some implementations, the subject is over 45 years of age. In some implementations, subjects over 45 years of age are selected. In some implementations, the subject does not have symptoms of neurodegenerative disorders. In some implementations, subjects with mild cognitive impairment are selected.

[0032] In another aspect, this disclosure provides a method for treating a subject with mild traumatic brain injury, comprising: (i) selecting a subject at risk of mild traumatic brain injury; (ii) obtaining cell-free DNA from a blood sample from the subject; (iii) analyzing the methylation pattern of a DNA region in the cell-free DNA, wherein the region is selected from the regions listed in Tables 2-5; (iv) determining the percentage of cell-free DNA from neurons; and (v) comparing the percentage of cell-free DNA from neurons with a control; and (vi) treating the subject for mild traumatic brain injury when the percentage of cell-free DNA from neurons is greater than that of the control.

[0033] In some embodiments, treating the subject includes administering a therapeutic agent for one or more symptoms of mild traumatic brain injury. In some embodiments, steps (ii) to (v) are repeated at post-treatment time points. In some embodiments, treatment is interrupted when the percentage of cell-free DNA from neurons at said time point is less than or equal to that of the control. In some embodiments, treatment continues when the percentage of cell-free DNA from neurons at said time point is greater than that of the control.

[0034] On the other hand, this disclosure provides a kit comprising a first plurality of oligonucleotides, wherein each of the first plurality of oligonucleotides is capable of hybridizing with preferentially methylated regions in neuronal cells.

[0035] In some embodiments, a second plurality of oligonucleotides are also included, wherein each of the second plurality of oligonucleotides is capable of hybridizing with preferentially unmethylated regions in neuronal cells.

[0036] In some embodiments, the kit is used to determine the efficacy of a potential treatment for a neurodegenerative disease or disorder. In some embodiments, the neurodegenerative disease or disorder is selected from Alzheimer's disease, Huntington's disease, Parkinson's disease, amyotrophic lateral sclerosis (ALS), ataxia, multiple sclerosis, multiple system atrophy, concussion, frontotemporal dementia-granulin, mucopolysaccharidosis type I (MPS I), mucopolysaccharidosis type II (MPS II; Hunt syndrome), or mucopolysaccharidosis type IIIA (MPS IIIA; Sanfilip syndrome). In some embodiments, the neurons are motor neurons, spinal motor neurons, sensory neurons, interneurons, dopaminergic neurons, cholinergic neurons, GABAergic neurons, glutamatergic neurons, or cortical neurons. In some embodiments, the neurons are derived from the forebrain, midbrain, or hindbrain. In some embodiments, the neurons are derived from the frontal lobe, temporal lobe, parietal lobe, occipital lobe, cerebellum, or brainstem.

[0037] In some embodiments, the plurality of oligonucleotides includes one or more oligonucleotides having a nucleotide sequence having any one of SEQ ID NO: 3-6.

[0038] On the other hand, this disclosure provides a method for detecting cell-free DNA from neurons in a blood sample, comprising: (i) obtaining cell-free DNA from a blood sample from a human subject; and (ii) detecting the presence of cell-free DNA from neurons in the blood sample by methylation analysis, including sequencing the entire amplicon of the cell-free DNA from the blood sample.

[0039] In some embodiments, the length of the entire amplicon is at least about 50 base pairs (bp). In some embodiments, the length of the entire amplicon is between about 50 and about 500 base pairs.

[0040] In some embodiments, the entire amplicon is generated using one or more primers containing a sequence of any one of SEQ ID NO: 3-6. In some embodiments, the entire amplicon is generated using one or more primers targeting a region selected from the regions listed in Table 1.

[0041] In some embodiments, the entire amplicon is generated using one or more primers targeting regions selected from the regions listed in Table 2. In some embodiments, the entire amplicon is generated using one or more primers targeting regions selected from the regions listed in Table 3. In some embodiments, the entire amplicon is generated using one or more primers targeting regions selected from the regions listed in Table 4. In some embodiments, the entire amplicon is generated using one or more primers targeting regions selected from the regions listed in Table 5.

[0042] In another aspect, this disclosure provides a method for determining the methylation state of an amplicon, comprising: (i) obtaining cell-free DNA from a blood sample from a human subject; (ii) converting 5-methylcytosine in the cell-free DNA into different nucleotides to produce transformed cell-free DNA; (iii) amplifying the transformed cell-free DNA to produce an amplicon; and (iv) sequencing the amplicon, wherein the length of the amplicon is between about 50 bp and about 500 bp.

[0043] In some embodiments, the entire amplicon is generated using one or more primers containing a sequence of any one of SEQ ID NO: 3-6. In some embodiments, the entire amplicon is generated using one or more primers targeting regions selected from the regions listed in Table 1. In some embodiments, the entire amplicon is generated using one or more primers targeting regions selected from the regions listed in Table 2. In some embodiments, the entire amplicon is generated using one or more primers targeting regions selected from the regions listed in Table 3. In some embodiments, the entire amplicon is generated using one or more primers targeting regions selected from the regions listed in Table 4. In some embodiments, the entire amplicon is generated using one or more primers targeting regions selected from the regions listed in Table 5. Attached Figure Description

[0044] Figure 1 A heatmap showing the distribution of 37,455 differentially methylated regions (DMRs) between purified neuronal and plasma samples is displayed. The heatmap illustrates the methylation patterns of these DMRs, with red indicating higher methylation levels and blue indicating lower methylation levels. Each row corresponds to a specific DMR, and each column represents a sample. Different clusters of samples based on their methylation patterns highlight significant phenotypic differences between plasma and purified neurons.

[0045] Figures 2A-2B Analysis of 957 sites with differential methylation patterns is shown. Figure 2A The bar chart shows 957 sites where the methylation fraction difference between cortical neurons and plasma was ≥ 0.6. Figure 2B : The Δ value represents the difference in methylation between cortical neurons and plasma at the selected locus. Positive values ​​indicate a higher degree of methylation in neurons, while negative values ​​indicate a lower degree of methylation.

[0046] Figures 3A-3GThe methylation patterns of seven sequencing loci in neuronal and plasma samples are displayed. Each panel shows the average methylation fraction (y-axis) of a single CpG (x-axis). Neuronal DNA shows complete unmethylation, while plasma DNA exhibits almost complete methylation.

[0047] Figure 4 The calculated proportion of neuronal-derived DNA in plasma samples is shown. Using a conservative cutoff of 5% for the proportion of cell-free DNA (cfDNA) derived from neurons, the figure illustrates the sample distribution based on their neuronal-derived cfDNA levels. The x-axis represents a single sample, and the y-axis represents the percentage of neuronal-derived cfDNA. This figure demonstrates that this proportion can accurately identify patients diagnosed with Alzheimer's disease (AD) and distinguish healthy controls from individuals who later developed AD with mild cognitive impairment (MCI).

[0048] Figure 5 A heatmap showing the distribution of 12,443 differentially methylated regions (DMRs) is displayed, distinguishing between cortical neurons, glutamatergic neurons (Glut), GABAergic neurons (GABA), spinal motor neurons (Sp.Motor), dopaminergic neurons (DA), and plasma. The heatmap illustrates the methylation patterns of these DMRs, with red indicating higher methylation levels and blue indicating lower methylation levels. Each row corresponds to a specific DMR, while each column represents a group of samples derived from the same tissue type. Different clusters of samples based on their methylation patterns highlight significant phenotypic differences between each cell type.

[0049] Figures 6A-6D It shows GABAergic neurons ( Figure 6A ), glutamatergic neurons ( Figure 6B ), dopaminergic neurons ( Figure 6C ) and spinal motor neurons ( Figure 6D Differential methylation pattern analysis. Figure 6A Analysis of 449 sites with differential methylation patterns is shown. Bar plots show sites with methylation fraction differences ≥ 0.5 between GABAergic neurons and other plasma-binding neuronal subtypes. Figure 6B Analysis of 212 sites with differential methylation patterns is shown. Bar charts show sites with methylation fraction differences ≥ 0.5 between glutamatergic neurons and other plasma-binding neuronal subtypes. Figure 6C An analysis of 1522 sites with differential methylation patterns is presented. Bar plots show sites with methylation fraction differences ≥ 0.5 between dopaminergic neurons and plasma-binding other neuronal subtypes. Figure 6DAn analysis of 1600 sites with differential methylation patterns is presented. Bar charts show sites with methylation fraction differences ≥ 0.5 between spinal motor neurons and other plasma-binding neuronal subtypes. Detailed Implementation

[0050] After reading this specification, those skilled in the art will understand how this disclosure can be implemented in various alternative embodiments and applications. However, not all various embodiments of the invention will be described herein. It should be understood that the embodiments presented herein are presented by way of example only and not by way of limitation. Therefore, the detailed description of various alternative embodiments should not be construed as limiting the scope or breadth of the disclosure as set forth herein.

[0051] Before disclosing and describing this technology, it should be understood that the aspects described below are not limited to specific compositions, methods of preparing such compositions, or their uses, as these can certainly vary. It should also be understood that the terminology used herein is for the purpose of describing specific aspects only and is not intended to be limiting.

[0052] The detailed descriptions have been divided into different chapters solely for the convenience of the reader, and disclosures found in any chapter may be combined with disclosures in another chapter. Titles or subtitles may be used in this patent specification for the reader's convenience, but this is not intended to affect the scope of this disclosure.

[0053] Definitions Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains. In this specification and the following claims, numerous terms will be referenced and defined as having the following meanings: The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be restrictive. As used herein, the singular forms “a” and “the” are intended to include the plural forms as well, unless the context clearly indicates otherwise.

[0054] "Optional" or "optionally" means that the event or situation described below may or may not occur, and the description includes examples of the event or situation occurring and examples of it not occurring.

[0055] The term "about" when used before numerical names (e.g., temperature, time, quantity, concentration, etc., including range) indicates an approximation that may vary by (+) or (-) 10%, 5%, 1%, or any subrange or subvalue in between. Preferably, when used with respect to a quantity, the term "about" means that the quantity may vary by + / - 10%.

[0056] The term "comprising / including" is intended to mean that the composition and method include the listed elements, but does not exclude other elements. "Substantially composed of" when used to define a composition and method means excluding other elements that are of any essential significance to the combination for the stated purpose. Therefore, a composition substantially composed of the elements as defined herein does not exclude other materials or steps that do not materially affect one or more essential and novel features of the claimed invention. "Composed of" means excluding elements and substantial method steps containing other ingredients in greater than trace amounts. Embodiments defined by these transitional terms are within the scope of this invention.

[0057] As used in this article, “cell-free DNA” refers to short fragments of DNA released into the bloodstream through cell death.

[0058] As used herein, the term "neuron" refers to any neuron or neuronal cell type. As a non-limiting example, a neuron can be a motor neuron, a spinal motor neuron, a dopaminergic neuron, a cortical neuron, a sensory neuron, an interneuron, or a medium-sized polyspinous neuron.

[0059] Methods Due to the inherent complications surrounding biopsies obtained from brain tissue, other tissues must be used when diagnosing diseases in the brain. Previous studies have attempted to use DNA methylation signatures as a diagnostic criterion for possible neurodegenerative diseases, using cerebrospinal fluid (CSF) as the primary liquid biopsy sample. CSF is obtained via spinal cord puncture. This is a painful and expensive procedure, requires a medical degree, and involves many potential health risks to the patient. The advantage of the disclosed method is that it can be performed on blood samples, a tissue that has become a standard liquid biopsy sample in healthcare because its extraction is relatively simple, inexpensive, and poses low risks to the patient.

[0060] This disclosure relates to a two-part blood-based diagnostic tool designed for diagnosing presymptomatic neurodegenerative diseases or disorders. The first part consists of a assay designed to amplify and sequence predetermined regions of cell-free DNA. The second part consists of a computer-implemented analysis (e.g., Python-based) that analyzes methylation signatures to identify neuronal DNA and provide a diagnosis of presymptomatic neurodegenerative diseases or disorders.

[0061] A standard protocol for cell-free DNA extraction based on blood is used, followed by PCR to convert and amplify the DNA at pre-selected sites in the genome using bisulfite conversion. The assay used for PCR amplification is a uniquely designed assay intended to target and amplify pre-selected regions of bisulfite-converted DNA. These pre-selected regions contain methylation signatures unique to neuronal cells, making it easy to identify neuronal-derived DNA from all other cell types that may be found in cell-free DNA from blood. Following amplification, the regions are sequenced using DNA sequencing.

[0062] The methylation signature of each single read is then analyzed. This is done using previously established methylation "blueprints" of neurons and whole blood cells. The computer-implemented analysis of the disclosed invention compares each read to these "blueprints" and predicts which cell type each read originates from. Once neuronal DNA is identified, the analysis can predict presymptomatic neurodegenerative diseases or disorders. This is done by first analyzing the amount of cell-free DNA present in the blood from neurons, and then by comparing the methylation signature to the methylation "blueprints" of patients with neurodegenerative diseases or disorders. The combination of these two methods can ultimately diagnose whether a patient has a presymptomatic neurodegenerative disease or disorder.

[0063] Cell types, such as neurons, possess unique methylation patterns (“blueprints”) that can be used to distinguish them from other cell types. Furthermore, methylation patterns help differentiate individual neuronal types from other neuronal types, such as motor neurons and dopaminergic neurons. Cell-free DNA (such as that found in blood) is a result of systemic cell death. The inventors have discovered that analyzing cell-free DNA from neuronal methylation patterns can predict whether a subject has a neurodegenerative disease or disorder.

[0064] This method can be used to detect neurodegenerative diseases or disorders before the onset of symptoms or in the early stages when symptoms are mild. The method can also be used to determine the incidence, severity, and / or duration (e.g., resolution) of traumatic brain injuries (such as concussion). Furthermore, the method can be used to differentiate between different types of neurodegenerative diseases or disorders. In another aspect, the method can be used to evaluate the efficacy of therapeutic agents in treating neurodegenerative diseases or disorders.

[0065] In some aspects, methods are provided for treating subjects who have or are at risk of developing neurodegenerative diseases or disorders. In implementation methods, the methods include: (i) Obtain cell-free DNA from a blood sample from the subject; (ii) Analyze the methylation patterns of DNA regions in cell-free DNA, where the regions are selected from those listed in Table 2-5; (iii) Determine the percentage of cell-free DNA from neurons; (iv) Compare the percentage of cell-free DNA from neurons to a control; and (v) When the percentage of cell-free DNA from neurons is greater than that of the control, administer a therapeutic agent for the treatment or prevention of neurodegenerative diseases or disorders.

[0066] In the implementation scheme, step (ii) includes analyzing the methylation pattern of the entire amplicon of DNA. In the implementation scheme, the entire amplicon is at least about 50 base pairs (bp) in length.

[0067] In one embodiment, the length of the entire amplicon is between about 50 and about 500 base pairs. In another embodiment, the length of the entire amplicon is between about 60 and about 500 base pairs. In another embodiment, the length of the entire amplicon is between about 70 and about 500 base pairs. In another embodiment, the length of the entire amplicon is between about 80 and about 500 base pairs. In another embodiment, the length of the entire amplicon is between about 90 and about 500 base pairs. In another embodiment, the length of the entire amplicon is between about 100 and about 500 base pairs. In another embodiment, the length of the entire amplicon is between about 150 and about 500 base pairs. In another embodiment, the length of the entire amplicon is between about 200 and about 500 base pairs. In another embodiment, the length of the entire amplicon is between about 250 and about 500 base pairs. In another embodiment, the length of the entire amplicon is between about 300 and about 500 base pairs. In another embodiment, the length of the entire amplicon is between about 350 and about 500 base pairs. In one embodiment, the length of the entire amplicon is between about 400 and about 500 base pairs. In another embodiment, the length of the entire amplicon is between about 450 and about 500 base pairs.

[0068] In one embodiment, the length of the entire amplicon is between about 50 and about 450 base pairs. In another embodiment, the length of the entire amplicon is between about 50 and about 400 base pairs. In another embodiment, the length of the entire amplicon is between about 50 and about 350 base pairs. In another embodiment, the length of the entire amplicon is between about 50 and about 300 base pairs. In another embodiment, the length of the entire amplicon is between about 50 and about 250 base pairs. In another embodiment, the length of the entire amplicon is between about 50 and about 200 base pairs. In another embodiment, the length of the entire amplicon is between about 50 and about 150 base pairs. In another embodiment, the length of the entire amplicon is between about 50 and about 100 base pairs. In another embodiment, the length of the entire amplicon is between about 50 and about 90 base pairs. In another embodiment, the length of the entire amplicon is between about 50 and about 80 base pairs. In another embodiment, the length of the entire amplicon is between about 50 and about 70 base pairs. In this implementation, the length of the entire amplicon is between about 50 and about 60 base pairs. The length of the entire amplicon can be any value or subrange within the listed range, including the endpoints.

[0069] In some aspects, this disclosure relates to methods for treating subjects, wherein the subjects have a neurodegenerative disease or disorder or are at risk of having a neurodegenerative disease or disorder, said methods comprising: (i) Obtain cell-free DNA from a blood sample from the subject; (ii) Analyze the methylation patterns of DNA regions in cell-free DNA, where the regions are selected from those listed in Table 2-5; (iii) Determine the percentage of cell-free DNA derived from neurons; and (iv) When the percentage of cell-free DNA from neurons is greater than about 5%, administer a therapeutic agent for the treatment or prevention of neurodegenerative diseases or disorders.

[0070] In one embodiment, the therapeutic agent is administered when the percentage of cell-free DNA from neurons is between about 3% and about 99%. In another embodiment, the therapeutic agent is administered when the percentage of cell-free DNA from neurons is between about 3% and about 90%. In yet another embodiment, the therapeutic agent is administered when the percentage of cell-free DNA from neurons is between about 3% and about 80%. In yet another embodiment, the therapeutic agent is administered when the percentage of cell-free DNA from neurons is between about 3% and about 70%. In yet another embodiment, the therapeutic agent is administered when the percentage of cell-free DNA from neurons is between about 3% and about 60%. In yet another embodiment, the therapeutic agent is administered when the percentage of cell-free DNA from neurons is between about 3% and about 50%. In yet another embodiment, the therapeutic agent is administered when the percentage of cell-free DNA from neurons is between about 3% and about 40%. In yet another embodiment, the therapeutic agent is administered when the percentage of cell-free DNA from neurons is between about 3% and about 30%. In yet another embodiment, the therapeutic agent is administered when the percentage of cell-free DNA from neurons is between about 3% and about 20%.

[0071] In the implementation scheme, the therapeutic agent is administered when the percentage of cell-free DNA from neurons is greater than about 2%. In the implementation scheme, the therapeutic agent is administered when the percentage of cell-free DNA from neurons is greater than about 3%. In the implementation scheme, the therapeutic agent is administered when the percentage of cell-free DNA from neurons is greater than about 4%. In the implementation scheme, the therapeutic agent is administered when the percentage of cell-free DNA from neurons is greater than about 5%. In the implementation scheme, the therapeutic agent is administered when the percentage of cell-free DNA from neurons is greater than about 6%. In the implementation scheme, the therapeutic agent is administered when the percentage of cell-free DNA from neurons is greater than about 7%. In the implementation scheme, the therapeutic agent is administered when the percentage of cell-free DNA from neurons is greater than about 8%. In the implementation scheme, the therapeutic agent is administered when the percentage of cell-free DNA from neurons is greater than about 9%. In the implementation scheme, the therapeutic agent is administered when the percentage of cell-free DNA from neurons is greater than about 10%. In the implementation scheme, the therapeutic agent is administered when the percentage of cell-free DNA from neurons is greater than about 11%. In the implementation scheme, the therapeutic agent is administered when the percentage of cell-free DNA from neurons is greater than about 12%. In one implementation, the therapeutic agent is administered when the percentage of cell-free DNA from neurons is greater than about 13%. In another implementation, the therapeutic agent is administered when the percentage of cell-free DNA from neurons is greater than about 14%. In yet another implementation, the therapeutic agent is administered when the percentage of cell-free DNA from neurons is greater than about 15%. In yet another implementation, the therapeutic agent is administered when the percentage of cell-free DNA from neurons is greater than about 20%.

[0072] In some aspects, this disclosure relates to a method for selecting a patient for treatment with a therapeutic agent for treating neurodegenerative diseases or disorders, said method comprising: (i) Obtain cell-free DNA from a blood sample from the subject; (ii) Analyze the methylation patterns of DNA regions in cell-free DNA, where the regions are selected from those listed in Table 2-5; (iii) Determine the percentage of cell-free DNA derived from neurons; and (iv) Compare the percentage of cell-free DNA from neurons to a control; Specifically, the patient is selected for treatment when the percentage of cell-free DNA from neurons is greater than that of the control group.

[0073] In this implementation, patients are selected for treatment when the percentage of cell-free DNA from neurons is between about 3% and about 99%. In this implementation, patients are selected for treatment when the percentage of cell-free DNA from neurons is between about 3% and about 90%. In this implementation, patients are selected for treatment when the percentage of cell-free DNA from neurons is between about 3% and about 80%. In this implementation, patients are selected for treatment when the percentage of cell-free DNA from neurons is between about 3% and about 70%. In this implementation, patients are selected for treatment when the percentage of cell-free DNA from neurons is between about 3% and about 60%. In this implementation, patients are selected for treatment when the percentage of cell-free DNA from neurons is between about 3% and about 50%. In this implementation, patients are selected for treatment when the percentage of cell-free DNA from neurons is between about 3% and about 40%. In this implementation, patients are selected for treatment when the percentage of cell-free DNA from neurons is between about 3% and about 30%. In the implementation plan, patients are selected for treatment when the percentage of cell-free DNA from neurons is between about 3% and about 20%.

[0074] In the implementation scheme, a patient is selected for treatment when the percentage of cell-free DNA from neurons is greater than about 3%. In the implementation scheme, a patient is selected for treatment when the percentage of cell-free DNA from neurons is greater than about 5%. In the implementation scheme, a patient is selected for treatment when the percentage of cell-free DNA from neurons is greater than about 6%. In the implementation scheme, a patient is selected for treatment when the percentage of cell-free DNA from neurons is greater than about 7%. In the implementation scheme, a patient is selected for treatment when the percentage of cell-free DNA from neurons is greater than about 8%. In the implementation scheme, a patient is selected for treatment when the percentage of cell-free DNA from neurons is greater than about 9%. In the implementation scheme, a therapeutic agent is administered when the percentage of cell-free DNA from neurons is greater than about 10%. In the implementation scheme, a patient is selected for treatment when the percentage of cell-free DNA from neurons is greater than about 11%. In the implementation scheme, a patient is selected for treatment when the percentage of cell-free DNA from neurons is greater than about 12%. In the implementation scheme, a patient is selected for treatment when the percentage of cell-free DNA from neurons is greater than about 13%. In one implementation, patients are selected for treatment when the percentage of cell-free DNA from neurons is greater than approximately 14%. In another implementation, patients are selected for treatment when the percentage of cell-free DNA from neurons is greater than approximately 15%. In yet another implementation, patients are selected for treatment when the percentage of cell-free DNA from neurons is greater than approximately 20%.

[0075] In the implementation plan, a higher percentage of cell-free DNA from neurons than in the control group indicates an increased risk of neurodegenerative diseases or traumatic brain injury.

[0076] In some aspects, this disclosure relates to methods for analyzing biological samples of subjects. In some embodiments, the subjects suffer from neurodegenerative diseases or disorders, or are at risk of developing such diseases. In some embodiments, the methods include: (i) Obtain cell-free DNA from a blood sample from the subject; (ii) Analyze the methylation patterns of DNA regions in cell-free DNA, where the regions are selected from those listed in Table 2-5; (iii) Determine the percentage of cell-free DNA derived from neurons; and (iv) Compare the percentage of cell-free DNA from neurons to a control.

[0077] In some aspects, this disclosure relates to computer products, including a non-transitory computer-readable medium storing a plurality of instructions, which, when executed, control a computer system to analyze a biological sample from a subject to determine the risk of neurodegenerative diseases or disorders in the subject, wherein the biological sample includes cell-free DNA. In embodiments, the instructions include: (i) Identify a first DNA methylation pattern that occurs in a neuron at a rate above a threshold, wherein the first DNA methylation pattern includes methylation in one or more methylated regions and optionally includes unmethylation in one or more unmethylated regions; (ii) Analyze the second DNA methylation pattern of the cell-free DNA; and (iii) Calculate the relative abundance of one or more methylated regions and optionally one or more unmethylated regions in cell-free DNA; and (iv) Determine the risk of neurodegenerative diseases or disorders in subjects by comparing relative abundance with controls.

[0078] In some aspects, this disclosure relates to computer-implemented methods for analyzing biological samples, including: (i) Identify a first DNA methylation pattern that occurs in a neuron at a rate above a threshold, wherein the first DNA methylation pattern includes methylation in one or more methylated regions and optionally includes unmethylation in one or more unmethylated regions; (ii) Analyze the second DNA methylation pattern of the cell-free DNA; (iii) Calculate the relative abundance of one or more methylated regions and optionally one or more unmethylated regions in cell-free DNA; and (iv) Determine the risk of neurodegenerative diseases or disorders in subjects by comparing relative abundance with controls.

[0079] In the embodiments, a percentage of cell-free DNA from neurons between about 3% and about 99% indicates an increased risk of neurodegenerative diseases or traumatic brain injury. In the embodiments, a percentage of cell-free DNA from neurons between about 3% and about 90% indicates an increased risk of neurodegenerative diseases or traumatic brain injury. In the embodiments, a percentage of cell-free DNA from neurons between about 3% and about 80% indicates an increased risk of neurodegenerative diseases or traumatic brain injury. In the embodiments, a percentage of cell-free DNA from neurons between about 3% and about 70% indicates an increased risk of neurodegenerative diseases or traumatic brain injury. In the embodiments, a percentage of cell-free DNA from neurons between about 3% and about 60% indicates an increased risk of neurodegenerative diseases or traumatic brain injury. In the embodiments, a percentage of cell-free DNA from neurons between about 3% and about 50% indicates an increased risk of neurodegenerative diseases or traumatic brain injury. In the embodiments, a percentage of cell-free DNA from neurons between about 3% and about 40% indicates an increased risk of neurodegenerative diseases or traumatic brain injury. In the implementation scheme, a percentage of cell-free DNA from neurons between about 3% and about 30% indicates an increased risk of neurodegenerative diseases or traumatic brain injury. In the implementation scheme, a percentage of cell-free DNA from neurons between about 3% and about 20% indicates an increased risk of neurodegenerative diseases or traumatic brain injury.

[0080] In the implementation scheme, a percentage of cell-free DNA from neurons greater than approximately 3% indicates an increased risk of neurodegenerative diseases or traumatic brain injury. In the implementation scheme, a percentage of cell-free DNA from neurons greater than approximately 4% indicates an increased risk of neurodegenerative diseases or traumatic brain injury. In the implementation scheme, a percentage of cell-free DNA from neurons greater than approximately 5% indicates an increased risk of neurodegenerative diseases or traumatic brain injury. In the implementation scheme, a percentage of cell-free DNA from neurons greater than approximately 6% indicates an increased risk of neurodegenerative diseases or traumatic brain injury. In the implementation scheme, a percentage of cell-free DNA from neurons greater than approximately 7% indicates an increased risk of neurodegenerative diseases or traumatic brain injury. In the implementation scheme, a percentage of cell-free DNA from neurons greater than approximately 8% indicates an increased risk of neurodegenerative diseases or traumatic brain injury. In the implementation scheme, a percentage of cell-free DNA from neurons greater than approximately 9% indicates an increased risk of neurodegenerative diseases or traumatic brain injury. In the implementation scheme, a percentage of cell-free DNA from neurons greater than approximately 10% indicates an increased risk of neurodegenerative diseases or traumatic brain injury. In the implementation scheme, a percentage of cell-free DNA from neurons greater than approximately 11% indicates an increased risk of neurodegenerative diseases or traumatic brain injury. In the implementation scheme, a percentage of cell-free DNA from neurons greater than approximately 12% indicates an increased risk of neurodegenerative diseases or traumatic brain injury. In the implementation scheme, a percentage of cell-free DNA from neurons greater than approximately 13% indicates an increased risk of neurodegenerative diseases or traumatic brain injury. In the implementation scheme, a percentage of cell-free DNA from neurons greater than approximately 14% indicates an increased risk of neurodegenerative diseases or traumatic brain injury. In the implementation scheme, a percentage of cell-free DNA from neurons greater than approximately 15% indicates an increased risk of neurodegenerative diseases or traumatic brain injury. In the implementation scheme, a percentage of cell-free DNA from neurons greater than approximately 20% indicates an increased risk of neurodegenerative diseases or traumatic brain injury.

[0081] In one embodiment, determining the percentage of cell-free DNA from neurons involves comparing the methylation pattern of cell-free DNA with the methylation pattern of neuronal DNA, wherein the neuronal DNA methylation pattern includes methylation of one or more methylated regions. In another embodiment, the neuronal DNA methylation pattern includes unmethylation of one or more unmethylated regions.

[0082] After sequencing and data processing, the methylation status of each molecule can be assessed.

[0083] In some embodiments, the sequence from the sample is aligned with a reference DNA sequence. In some embodiments, the reference DNA sequence comprises the human genome. In some embodiments, the reference DNA sequence comprises a portion of the human genome. In some embodiments, the reference DNA sequence comprises a region amplified by PCR. In some embodiments, the reference DNA sequence comprises a portion of a PCR product. After alignment, locations identified as having different methylation states between tissues can be analyzed to measure the relative frequency of base calls at said locations, thereby determining the estimated methylation fraction in the library. In some embodiments, this methylation fraction at each location can then be analyzed in conjunction with other locations to find the overall methylation state of the sequenced DNA molecule.

[0084] In some embodiments, sequences from a sample are searched to identify a specific base sequence of length N within the sequenced DNA molecule, where N is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 bases long. In some embodiments, the base sequence is adjacent to the base being evaluated. In some embodiments, the base sequence encompasses the base being evaluated. In some embodiments, two or more versions of the sequence are used to represent the methylated and unmethylated states of the DNA sequence.

[0085] In some implementations, sequences from samples are fed into a machine learning algorithm. In some implementations, the machine learning algorithm includes a neural network. In some implementations, the machine learning algorithm includes a multilayer perceptron. In some implementations, the machine learning algorithm includes a convolutional neural network. In some implementations, the machine learning algorithm uses a DNA sequence with base calls as input. In some implementations, the DNA sequence is broken down into k-mers: and k = 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 bases in length. For example, in one implementation, sequencing data is broken down into overlapping hexamers (k = 6). These hexamers are counted and fed into a multilayer perceptron containing 4096 input neurons (one for each possible hexamer sequence), 8 neurons in the hidden layer, and 1 output neuron that classifies read lengths as methylated or unmethylated. The model was trained using 100,000 reads selected from purified tissue samples containing only methylated or unmethylated DNA at the examined loci. Cross-validation with 20% data showed a final accuracy of 99.8% and a loss of 0.01.

[0086] The control can be any suitable control. In one embodiment, the control is the percentage of cell-free DNA derived from neurons in a blood sample from an untreated subject. In another embodiment, the control is the percentage of cell-free DNA derived from neurons in a blood sample from a healthy subject. In yet another embodiment, the control is a blood sample from a subject prior to treatment. In a specific embodiment, the control is a threshold. In one embodiment, the threshold is greater than about 3% of cell-free DNA derived from neurons. In another embodiment, the threshold is greater than about 4% of cell-free DNA derived from neurons. In another embodiment, the threshold is greater than about 5% of cell-free DNA derived from neurons. In another embodiment, the threshold is greater than about 6% of cell-free DNA derived from neurons. In another embodiment, the threshold is greater than about 7% of cell-free DNA derived from neurons. In another embodiment, the threshold is greater than about 8% of cell-free DNA derived from neurons. In another embodiment, the threshold is greater than about 9% of cell-free DNA derived from neurons. In another embodiment, the threshold is greater than about 10% of cell-free DNA derived from neurons. In another embodiment, the threshold is greater than about 11% of cell-free DNA derived from neurons. In one implementation, the threshold is a percentage greater than approximately 12% of cell-free DNA derived from neurons. In another implementation, the threshold is a percentage greater than approximately 13% of cell-free DNA derived from neurons. In yet another implementation, the threshold is a percentage greater than approximately 14% of cell-free DNA derived from neurons. In yet another implementation, the threshold is a percentage greater than approximately 15% of cell-free DNA derived from neurons. In yet another implementation, the threshold is a percentage greater than approximately 20% of cell-free DNA derived from neurons.

[0087] In the implementation plan, the neurodegenerative disease is Alzheimer's disease. In the implementation plan, the neurodegenerative disease is Huntington's disease. In the implementation plan, the neurodegenerative disease is Parkinson's disease. In the implementation plan, the neurodegenerative disease is amyotrophic lateral sclerosis (ALS). In the implementation plan, the neurodegenerative disease is ataxia. In the implementation plan, the neurodegenerative disease is multiple sclerosis. In the implementation plan, the neurodegenerative disease or disorder is multiple system atrophy. In the implementation plan, the neurodegenerative disorder is mild traumatic brain injury. In the implementation plan, the neurodegenerative disorder is concussion. In the implementation plan, the neurodegenerative disorder is frontotemporal dementia-granulin. In the implementation plan, the neurodegenerative disorder is mucopolysaccharidosis type I (MPS I). In the implementation plan, the neurodegenerative disorder is mucopolysaccharidosis type II (MPS II; Hunt syndrome). In the implementation plan, the neurodegenerative disorder is mucopolysaccharidosis type IIIA (MPS IIIA; Sanfilip syndrome). One or more of these diseases or disorders may be explicitly excluded.

[0088] Neurons can be any type of neuron, or a combination thereof. In one embodiment, the neuron is a motor neuron. In one embodiment, the neuron is a spinal motor neuron. In one embodiment, the neuron is a sensory neuron. In one embodiment, the neuron is an interneuron. In one embodiment, the neuron is a dopaminergic neuron. In one embodiment, the neuron is a GABAergic neuron. In one embodiment, the neuron is a glutamatergic neuron. In one embodiment, the neuron is a cortical neuron.

[0089] In one embodiment, neurons originate from the forebrain. In another embodiment, neurons originate from the midbrain. In another embodiment, neurons originate from the hindbrain. In another embodiment, neurons originate from the frontal lobe. In another embodiment, neurons originate from the temporal lobe. In another embodiment, neurons originate from the parietal lobe. In another embodiment, neurons originate from the occipital lobe. In another embodiment, neurons originate from the cerebellum. In another embodiment, neurons originate from the brainstem.

[0090] In one implementation, analyzing DNA methylation patterns includes determining the methylation status of DNA regions. In another implementation, the DNA is chromosomal DNA. In yet another implementation, the region is a region in a neuron or neuron type that is preferentially methylated (more likely to be methylated) compared to one or more other cell types. Alternatively, the region is a region in a neuron or neuron type that is preferentially unmethylated (more likely to be unmethylated) compared to one or more other cell types.

[0091] In this implementation, the methylation status of one or more regions listed in Table 1 was analyzed. In this implementation, the methylation status of one or more subregions within one or more regions listed in Table 1 was analyzed. In this implementation, the methylation status of chr3:42190679,42191148 was analyzed. In this implementation, the methylation status of chr19_3507867_3507868 was analyzed. In this implementation, an increase in the percentage of methylated cfDNA in one or more regions (or one or more subregions within one or more regions shown in Table 1) compared to the control indicates an increased risk of Alzheimer's disease. In this implementation, an increase in the percentage of unmethylated cfDNA in one or more regions (or one or more subregions within one or more regions shown in Table 1) compared to the control indicates an increased risk of Alzheimer's disease.

[0092] Table 1. Chromosomal Regions - Alzheimer's Disease In this implementation, the methylation status of one or more regions listed in Table 2 was analyzed. In this implementation, the methylation status of one or more subregions within one or more regions listed in Table 2 was analyzed. In this implementation, an increase in the percentage of methylated cfDNA in one or more regions (or one or more subregions within one or more regions shown in Table 2) compared to the control indicates an increased risk of Alzheimer's disease. In this implementation, an increase in the percentage of unmethylated cfDNA in one or more regions (or one or more subregions within one or more regions shown in Table 2) compared to the control indicates an increased risk of neurodegenerative disease. In this implementation, the neurodegenerative disease is Alzheimer's disease or dementia.

[0093] Table 2. Chromosomal Regions – Cortical Glutamate Neurons In this implementation, the methylation status of one or more regions listed in Table 3 was analyzed. In this implementation, the methylation status of one or more subregions within one or more regions listed in Table 3 was analyzed. In this implementation, an increase in the percentage of methylated cfDNA in one or more regions (or one or more subregions within one or more regions shown in Table 3) compared to the control indicates an increased risk of neurodegenerative disease. In this implementation, an increase in the percentage of unmethylated cfDNA in one or more regions (or one or more subregions within one or more regions shown in Table 3) compared to the control indicates an increased risk of neurodegenerative disease. In this implementation, the neurodegenerative disease is Huntington's disease.

[0094] Table 3. Chromosomal Regions – Cortical GABAergic Neurons In this implementation, the methylation status of one or more regions listed in Table 4 was analyzed. In this implementation, the methylation status of one or more subregions within one or more regions listed in Table 4 was analyzed. In this implementation, an increase in the percentage of methylated cfDNA in one or more regions (or one or more subregions within one or more regions shown in Table 4) compared to the control indicates an increased risk of Parkinson's disease. In this implementation, an increase in the percentage of unmethylated cfDNA in one or more regions (or one or more subregions within one or more regions shown in Table 4) compared to the control indicates an increased risk of Parkinson's disease.

[0095] Table 4. Chromosomal Regions – Dopaminergic Neurons In the implementation scheme, the methylation status of one or more regions listed in Table 5 was analyzed. In the implementation scheme, the methylation status of one or more subregions within one or more regions listed in Table 5 was analyzed. In the implementation scheme, an increase in the percentage of methylated cfDNA in one or more regions (or one or more subregions within one or more regions shown in Table 5) compared to the control indicates an increased risk of amyotrophic lateral sclerosis (ALS). In the implementation scheme, an increase in the percentage of unmethylated cfDNA in one or more regions (or one or more subregions within one or more regions shown in Table 5) compared to the control indicates an increased risk of ALS.

[0096] Table 5. Chromosomal regions – spinal motor neurons Any method for analyzing DNA methylation patterns can be used. For example, in one implementation, analyzing methylation patterns includes bisulfite sequencing.

[0097] In the implementation plan, long-read sequencing is used to sequence the DNA.

[0098] In one implementation, the subject had no symptoms of neurodegenerative disease or disorder. In another implementation, the subject had symptoms of neurodegenerative disease or disorder. In yet another implementation, the subject had symptoms of mild neurodegenerative disease or disorder. In yet another implementation, the subject had symptoms of early-stage neurodegenerative disease or disorder. In yet another implementation, the subject had mild cognitive impairment.

[0099] In the implementation plan, the methods described herein can be used for presymptomatic diagnosis of neurodegenerative diseases. For example, the test can be performed on subjects at a clinical appointment, such as an annual physical examination for individuals aged 45-70.

[0100] In one implementation, the method includes selecting subjects with symptoms of neurodegenerative diseases or disorders. In another implementation, the method includes selecting subjects with mild neurodegenerative diseases or disorders. In yet another implementation, the method includes selecting subjects with early-stage neurodegenerative diseases or disorders. Finally, the method includes selecting subjects with mild cognitive impairment.

[0101] On the one hand, it provides methods for treating subjects with mild traumatic brain injury, including: (i) Select subjects who are at risk of mild traumatic brain injury; (ii) Obtain cell-free DNA from a blood sample from the subject; (iii) Analyze the methylation patterns of DNA regions in cell-free DNA, where the regions are selected from those listed in Table 2-5; (iv) Determine the percentage of cell-free DNA from neurons; and (v) Compare the percentage of cell-free DNA from neurons to a control; (vi) When the percentage of cell-free DNA from neurons is greater than that of the control, the subject is treated for mild traumatic brain injury.

[0102] In one implementation, treating the subject includes administering a therapeutic agent to treat one or more symptoms of mild traumatic brain injury. In another implementation, treating the subject includes physical and / or mental rest. In yet another implementation, treating the subject includes interrupting one or more activities, such as physical exercise.

[0103] In one implementation, the method further includes repeating steps (ii) to (v) at post-treatment time points. In another implementation, treatment is interrupted when the percentage of cell-free DNA from neurons at said time point is less than or equal to the control. In yet another implementation, treatment continues when the percentage of cell-free DNA from neurons at said time point is greater than the control.

[0104] On the one hand, it provides methods for monitoring subjects who have or are suspected of having mild traumatic brain injury, including: (i) Select subjects who are at risk of mild traumatic brain injury; (ii) Obtain cell-free DNA from a blood sample from the subject; (iii) Analyze the methylation patterns of DNA regions in cell-free DNA, where the regions are selected from those listed in Table 2-5; (iv) Determine the percentage of cell-free DNA from neurons.

[0105] In one implementation, the method includes comparing the percentage of cell-free DNA from neurons to a control. In another implementation, when the percentage of cell-free DNA from neurons is greater than the control, the subject is determined to have mild traumatic brain injury.

[0106] In the implementation scheme, subjects are monitored over time. In the implementation scheme, the method includes repeating steps (ii) to (iv) at least once. In the implementation scheme, the method includes monitoring subjects until the percentage of cell-free DNA from neurons is less than or equal to that of the control.

[0107] In this implementation, a percentage of cell-free DNA from neurons less than or equal to the control indicates that mTBI has subsided. In this implementation, the control is the initial percentage of cell-free DNA from neurons in the subject (e.g., from the initial assay step). In this implementation, a percentage of cell-free DNA from neurons less than or equal to the control indicates that the subject's brain has recovered from mTBI. In this implementation, a percentage of cell-free DNA from neurons less than or equal to the control indicates a reduction in brain swelling.

[0108] In the implementation plan, steps (ii) to (iv) are repeated daily. In the implementation plan, steps (ii) to (iv) are repeated every 2 days. In the implementation plan, steps (ii) to (iv) are repeated every 3 days. In the implementation plan, steps (ii) to (iv) are repeated every 4 days. In the implementation plan, steps (ii) to (iv) are repeated every 5 days. In the implementation plan, steps (ii) to (iv) are repeated every 6 days. In the implementation plan, steps (ii) to (iv) are repeated weekly. In the implementation plan, steps (ii) to (iv) are repeated every two weeks. In the implementation plan, steps (ii) to (iv) are repeated at least once a week. In the implementation plan, steps (ii) to (iv) are repeated at least twice a week. In the implementation plan, steps (ii) to (iv) are repeated at least three times a week. In the implementation plan, steps (ii) to (iv) are repeated at least four times a week. In the implementation plan, steps (ii) to (iv) are repeated at least five times a week. In the implementation plan, steps (ii) to (iv) are repeated at least six times a week.

[0109] Other methods The methods, compositions, and kits described herein can be used to monitor the effectiveness of therapeutic agents or potential therapeutic agents. For example, the effectiveness of a potential therapeutic agent can be monitored during a clinical trial. In another instance, the effectiveness of a therapeutic agent can be monitored in subjects.

[0110] Currently, over 176 drugs are in clinical trials for the treatment of neurodegenerative diseases. Unbound by theoretical limitations, it is believed that monitoring drug efficacy by tracking current neuronal DNA levels in the blood could significantly accelerate trials. This would allow for periodic (e.g., weekly, monthly) testing to assess drug efficacy over time as blood neuronal DNA levels decrease.

[0111] In some aspects, this disclosure relates to a method for determining the efficacy of a potential treatment for neurodegenerative diseases or disorders, said method comprising: (i) Obtain cell-free DNA from blood samples from multiple subjects in which the potential treatment has been administered; (ii) Analyze the methylation patterns of DNA regions in cell-free DNA, where the regions are selected from those listed in Table 2-5; (iii) Determine the percentage of cell-free DNA from neurons in each subject; and (iv) Compare the percentage of cell-free DNA from neurons in each subject with that in the control group; The potential treatment is effective when the percentage of cell-free DNA from neurons is lower than that of the control.

[0112] In this implementation, the mean percentage of cell-free DNA from neurons is determined by averaging the percentage of cell-free DNA from neurons in each subject. In this implementation, the mean percentage of cell-free DNA from neurons is compared to a control. In this implementation, the potential treatment is effective when the mean percentage of cell-free DNA from neurons is lower than that of the control.

[0113] In some aspects, this disclosure relates to a method for determining the efficacy of a treatment for neurodegenerative diseases or disorders, said method comprising: (i) Obtain cell-free DNA from a blood sample from the subject, wherein the treatment has been administered to the subject; (ii) Analyze the methylation patterns of DNA regions in cell-free DNA, where the regions are selected from those listed in Table 2-5; (iii) Determine the percentage of cell-free DNA derived from neurons; and (iv) Compare the percentage of cell-free DNA from neurons to a control; The treatment is effective when the percentage of cell-free DNA from neurons is lower than that of the control.

[0114] In the implementation plan, steps (ii) to (iv) are repeated daily. In the implementation plan, steps (ii) to (iv) are repeated every 2 days. In the implementation plan, steps (ii) to (iv) are repeated every 3 days. In the implementation plan, steps (ii) to (iv) are repeated every 4 days. In the implementation plan, steps (ii) to (iv) are repeated every 5 days. In the implementation plan, steps (ii) to (iv) are repeated every 6 days. In the implementation plan, steps (ii) to (iv) are repeated weekly. In the implementation plan, steps (ii) to (iv) are repeated every two weeks. In the implementation plan, steps (ii) to (iv) are repeated at least once a week. In the implementation plan, steps (ii) to (iv) are repeated at least twice a week. In the implementation plan, steps (ii) to (iv) are repeated at least three times a week. In the implementation plan, steps (ii) to (iv) are repeated at least four times a week. In the implementation plan, steps (ii) to (iv) are repeated at least five times a week. In the implementation plan, steps (ii) to (iv) are repeated at least six times a week. In the implementation plan, steps (ii) to (iv) are repeated at least once a month. In the implementation plan, steps (ii) to (iv) are repeated at least twice a month. In the implementation plan, steps (ii) to (iv) are repeated at least three times per month. In the implementation plan, steps (ii) to (iv) are repeated at least four times per month. In the implementation plan, steps (ii) to (iv) are repeated at least five times per month. In the implementation plan, steps (ii) to (iv) are repeated at least six times per month. In the implementation plan, steps (ii) to (iv) are repeated at least seven times per month. In the implementation plan, steps (ii) to (iv) are repeated at least eight times per month.

[0115] In some implementations, potential treatments include recombinant iduronate 2-sulfatase (IDS) protein, leucine-rich repeatable kinase 2 (LRRK2) inhibitors, recombinant pregranular protein (PGRN) protein, recombinant N-sulfoglucosamine sulfonylhydrolase (SGSH) protein, recombinant α-L-iduronate (IDUA) recombinant protein, receptor-interacting serine / threonine protein kinase 1 (RIPK1) inhibitors, or eukaryotic translation initiation factor 2B (eIF2B) activators. In some implementations, potential treatments include recombinant iduronate 2-sulfatase (IDS) protein. In some implementations, potential treatments include leucine-rich repeatable kinase 2 (LRRK2) inhibitors. In some implementations, potential treatments include recombinant pregranular protein (PGRN) protein. In some implementations, potential treatments include recombinant N-sulfoglucosamine sulfonylhydrolase (SGSH) protein. In some implementations, potential treatments include recombinant α-L-iduronate (IDUA) recombinant protein. In one implementation, potential treatments include receptor-interacting serine / threonine protein kinase 1 (RIPK1) inhibitors. In another implementation, potential treatments include eukaryotic translation initiation factor 2B (eIF2B) activators.

[0116] In the implementation scheme, potential treatments include DNL310 (ETV:IDS), BIIB122 / DNL151, TAK-594 / DNL593, DNL126 (ETV:SGSH), DNL622 (ETV:IDUA), SAR443820 / DNL788, DNL343, or SAR443122 / DNL758. In the implementation scheme, potential treatments include DNL310 (ETV:IDS). In the implementation scheme, potential treatments include BIIB122 / DNL151. In the implementation scheme, potential treatments include TAK-594 / DNL593. In the implementation scheme, potential treatments include DNL126 (ETV:SGSH). In the implementation scheme, potential treatments include DNL622 (ETV:IDUA). In the implementation scheme, potential treatments include SAR443820 / DNL788. In the implementation scheme, potential treatments include DNL343. In the implementation scheme, potential treatments include SAR443122 / DNL758.

[0117] The methods, compositions, and kits described herein can be used to validate healthy control samples. Many institutions and companies purchase control samples from tissue banks for their research or clinical trials. Statistically, one in nine of these controls has an undetected presymptomatic neurodegenerative disease. Presymptomatic disease testing can be performed on control samples to confirm that they are indeed healthy controls.

[0118] In some aspects, this disclosure relates to a method for validating control samples, said method comprising: (i) Obtaining cell-free DNA from a control sample or from a subject from whom a control sample was obtained; (ii) Analyze the methylation patterns of DNA regions in cell-free DNA, where the regions are selected from those listed in Table 2-5; (iii) Determine the percentage of cell-free DNA from neurons.

[0119] In one implementation, the method further includes comparing the percentage of cell-free DNA from neurons with a control. In another implementation, a control sample is validated when the percentage of cell-free DNA from neurons is less than that of the control.

[0120] The control can be any suitable control. In one embodiment, the control is the percentage of cell-free DNA derived from neurons in a blood sample from one or more untreated (or placebo-treated) subjects. In another embodiment, the control is the percentage of cell-free DNA derived from neurons in a blood sample from one or more healthy subjects. In yet another embodiment, the control is a blood sample from a subject prior to treatment. In yet another embodiment, the control is a threshold. In yet another embodiment, the threshold is a percentage greater than about 3% of cell-free DNA derived from neurons. In yet another embodiment, the threshold is a percentage greater than about 4% of cell-free DNA derived from neurons. In yet another embodiment, the threshold is a percentage greater than about 5% of cell-free DNA derived from neurons. In yet another embodiment, the threshold is a percentage greater than about 6% of cell-free DNA derived from neurons. In yet another embodiment, the threshold is a percentage greater than about 7% of cell-free DNA derived from neurons. In yet another embodiment, the threshold is a percentage greater than about 8% of cell-free DNA derived from neurons. In yet another embodiment, the threshold is a percentage greater than about 9% of cell-free DNA derived from neurons. In yet another embodiment, the threshold is a percentage greater than about 10% of cell-free DNA derived from neurons. In one implementation, the threshold is a percentage greater than approximately 11% of cell-free DNA derived from neurons. In another implementation, the threshold is a percentage greater than approximately 12% of cell-free DNA derived from neurons. In yet another implementation, the threshold is a percentage greater than approximately 13% of cell-free DNA derived from neurons. In yet another implementation, the threshold is a percentage greater than approximately 14% of cell-free DNA derived from neurons. In yet another implementation, the threshold is a percentage greater than approximately 15% of cell-free DNA derived from neurons. In yet another implementation, the threshold is a percentage greater than approximately 20% of cell-free DNA derived from neurons.

[0121] Parkinson's disease In implementation schemes, the methods described herein can be used to determine whether a subject has Parkinson's disease. In implementation schemes, the methods described herein can be used to determine whether a subject is at risk of developing Parkinson's disease. In implementation schemes, the methods described herein can be used to monitor the effectiveness of treatment or potential treatments for Parkinson's disease.

[0122] Parkinson's disease (PD) is one of the most common chronic progressive neurodegenerative diseases in the elderly. The prevalence of PD in individuals aged 65 and older worldwide is reported to be 1%-2%. The disease also affects many younger people. Patients with Parkinson's disease suffer from motor impairments such as bradykinesia, resting tremor, rigidity, postural disturbances, and gait changes, including gait freezing (FOG) and frequent falls. In addition to motor function, patients often suffer from non-motor impairments such as cognitive impairment, sleep disturbances, and depression. The most prominent signs and symptoms of Parkinson's disease occur when nerve cells in the basal ganglia (the area of ​​the brain that controls movement) begin to be damaged and / or die. The motor symptoms of Parkinson's disease (PD) are caused by the death of dopaminergic neurons in the substantia nigra pars compacta (SNc).

[0123] Currently, levodopa (e.g., INBRIJA) is the primary treatment for Parkinson's disease. Levodopa can be taken with carbidopa (e.g., SINEMET, SINEMET-CR, PARCOPA, RYTARY). Carbidopa can prevent or reduce some of the side effects of levodopa treatment (e.g., nausea, vomiting, low blood pressure, and agitation) and reduce the amount of levodopa needed to improve symptoms. Other prescription medications for treating Parkinson's disease symptoms include dopamine agonists (e.g., pramipexole (MIRAPEX)). ER), rotigotine (NEUPRO, ELDEPRYL), apomorphine (APOKYN, KYNMOBI), ropinirole (REQUIP), piribedil, bromocriptine, cabergoline, lisuride, pergolide; enzyme inhibitors (e.g., MAO-B inhibitors (e.g., selegiline (ZELAPAR), rasagiline (AZILECT), safinamide (XADAGO)); COMT inhibitors (e.g., entacapone (COMTAN), opicapone (ONGENTYS), tocapone (TAS) MAR (amantadine) is used to increase dopamine levels by slowing down the enzymes that break down dopamine in the brain; amantadine (SYMMETREL, GOCOVRI, OSMOLEX) helps reduce involuntary movements; anticholinergic drugs (such as benztropine (COGENTIN), benzohexol (ARTANE)) reduce tremors and muscle rigidity; adenosine receptor antagonists (A2A receptor antagonists) (such as itratheline (NOURIANZ); and pimavanserin (NUPLAZID). Other combination therapies include carbidopa-levodopa-entacapone (DUOPA, STALEVO).

[0124] In one embodiment, the percentage of cell-free DNA in affected neurons of Parkinson's disease is determined. In another embodiment, affected neurons in Parkinson's disease include dopaminergic neurons. In yet another embodiment, the entire amplicon is generated using one or more primers targeting regions selected from those listed in Table 4.

[0125] In the implementation plan, one or more therapeutic agents are administered to a subject with an increased amount of cfDNA from neurons for the treatment of Parkinson's disease. In the implementation plan, levodopa is administered to the subject. In the implementation plan, carbidopa is administered to the subject. In the implementation plan, a dopamine agonist is administered to the subject. In the implementation plan, pramipexole is administered to the subject. In the implementation plan, rotigotine is administered to the subject. In the implementation plan, apomorphine is administered to the subject. In the implementation plan, ropinirole is administered to the subject. In the implementation plan, piribedil is administered to the subject. In the implementation plan, bromocriptine is administered to the subject. In the implementation plan, cabergoline is administered to the subject. In the implementation plan, ergoestradiol is administered to the subject. In the implementation plan, pergolide is administered to the subject. In the implementation plan, an enzyme inhibitor is administered to the subject. In the implementation plan, an MAO-B inhibitor is administered to the subject. In the implementation plan, selegiline is administered to the subject. In the implementation plan, rasagiline is administered to the subject. In the implementation plan, safenamide is administered to the subject. In the implementation plan, an OMT inhibitor is administered to the subject. In the implementation plan, entacapone is administered to the subject. In the implementation plan, octopcapone is administered to the subject. In the implementation plan, tocapone is administered to the subject. In the implementation plan, amantadine is administered to the subject. In the implementation plan, an anticholinergic drug is administered to the subject. In the implementation plan, benzalkonium chloride is administered to the subject. In the implementation plan, trihexyphenidyl is administered to the subject. In the implementation plan, an adenosine receptor antagonist (A2A receptor antagonist) is administered to the subject. In the implementation plan, itratheline is administered to the subject. In the implementation plan, pimovaserine is administered to the subject. In the implementation plan, carbidopa and levodopa are administered to the subject. In the implementation plan, carbidopa, levodopa, and entacapone are administered to the subject. In the implementation plan, one or more drugs are explicitly excluded.

[0126] Alzheimer's disease In implementation schemes, the methods described herein can be used to determine whether a subject has Alzheimer's disease. In implementation schemes, the methods described herein can be used to determine whether a subject is at risk for Alzheimer's disease. In implementation schemes, the methods described herein can be used to monitor the effectiveness of treatment or potential treatments for Alzheimer's disease.

[0127] Alzheimer's disease is a chronic neurodegenerative disease that damages brain cells, causing brain function to deteriorate over time. Common symptoms of Alzheimer's disease include memory loss, language problems, and impulsive or unpredictable behavior. The main characteristics of the disease are the presence of plaques and tangles in the brain, and the loss of connections between neurons. Alzheimer's disease accounts for approximately 60–80% of dementia cases in the United States.

[0128] While there is currently no known cure for Alzheimer's disease, various medications can be used to reduce or slow the progression of cognitive symptoms. The FDA has approved several cholinesterase inhibitors for this purpose, including donepezil (ARICEPT), galantamine (RAZADYNE), and rivastigmine (EXELON). Other treatments include meimantan (NAMENDA), aducanumab, and lenkanemab (lenkanemab-irmb; LEQEMBI).

[0129] In one implementation, the percentage of cell-free DNA in affected neurons of Alzheimer's disease is determined. In another implementation, affected neurons of Alzheimer's disease include cortical glutamatergic neurons. In yet another implementation, the entire amplicon is generated using one or more primers targeting regions selected from those listed in Table 1 or 2.

[0130] In the implementation plan, a cholinesterase inhibitor is administered to the subject. In the implementation plan, donepezil is administered to the subject. In the implementation plan, galantamine is administered to the subject. In the implementation plan, rivastigmine is administered to the subject. In the implementation plan, memantine is administered to the subject. In the implementation plan, aducanumab is administered to the subject. In the implementation plan, lencanemab is administered to the subject.

[0131] Other treatments are being used in clinical trials to treat Alzheimer's disease. These include, but are not limited to: aducanumab; AGB101 (low-dose levetiracetam); Atuzaginstat (COR388); AVP-786; AXS-05; Blarcamesine (ANAVEX2-73); BPDO-1603; buripiperazole; caffeine; donepemab; donepemab and aducanumab; donepezil; escitalopram; gantenurumab; gantenurumab and solanezumab; guanifacin; GV-971; hydralazine; ethyl eicosapentaenoate (IPE); losartan, amlodipine, and atorvastatin; metformin; nabilone; NE3107; nilotinib BE; octohydroaminoacridine succinate; ω-3 (DHA+EPA); Smegglutinin; Simufilam (PTI-125); Solanezumab; Tricaprilin; TRx0237; Valiltramiprosate (ALZ-801). ABvac40; ACI-35; AD-35; AL002; Allopregnanolone; APH-1105; Baricitinib; Bepraneemab; BCG vaccine; BPN14770; Bromocriptine; Lichenstatin 1; BXCL-501; Canakinumab; CORT108297; Crenezumab; CST-2032; Curcumin; CY6463; DAOIB; Dapagliflozin; Daratumumab; Dasatinib and Quercetin; Deferiphenone; DHA; Drowanediol; E2814; Edonerpic (T-817MA); Elayta (CT1812); ExPlas (sports plasma); Fosgonimeton (ATH-1017); Brain Shuttle Gantinruumab (RO7126209); GB301; Grape Seed Extract; GV1001; Intranasal Insulin; Intranasal Insulin and Empagliflozin; IONIS MAPTRx (BIIB080); JNJ-63733657; Lamivudine (3TC); Lenalidomide; Levetiracetam; L-Serine; Lupron (Leuprolide Acetate Depot); LY3372689; Memantine; Metabolic Cofactor Supplement; MIB-626; Montelukast; MW150; Neflamapimod (VX-745); Nicotinamide; Nicotine Transdermal Patch;Obicetrapib; ω-3 PUFA; Pepinemab (VX15); Posiphen; Prazosin; PU-AD; Rapamycin (Sirolimus); Saxaglastine; Semorinemab (RO7105705); Senicapoc; Sovateltide (PMZ-1620); Simufilam (PTI-125); Suvorexant; T3D-959; TB006; Telmisartan and Perindopril; Tdap vaccine; THC-free CBD oil; Thiethylperazine (TEP); Troluzole (BHV4157); Valacyclovir; Varoglutamstat (PQ912); VGH-AD1; Xanamem; Yangxue Qingnao Pill pills); AAV-Htert; ACU193; ASN51; BEY2153; BMS-984923; BDPP (bioactive dietary polyphenol preparation); Contraloid acetate; COR588; Dabigatran; Edicotinib (JNJ-40346527); Efavirenz; Emtricitabine; IGC AD1; LuAF87908; LX1001; LY3372993; MK-1942 and Donepezil; NNI-362; REM0046127; Disalicylates; SHR-1707; TB006; Telmisartan; Trehalose; Tricaprilin (AC-1202); Vorinostat; VT301; XPro1595. Other treatments being tested include: allogeneic human MSCs; SNK01 (autologous natural killer cells); allogeneic adipose-derived MSCs-exosomes; CB-AC-02 (placental-derived MSCs); human umbilical cord blood-derived MSCs (NEUROSTEM); allogeneic human MSCs; and AstroStem (autologous adipose-derived MSCs). In the implementation plan, one or more of the listed agents are administered to the subject. In the implementation plan, one or more agents are explicitly excluded.

[0132] Huntington's disease In the implementation scheme, the methods described herein can be used to monitor disease progression in subjects diagnosed with Huntington's disease. In the implementation scheme, the methods described herein can be used to monitor the effectiveness of treatment or potential treatments for Huntington's disease.

[0133] Huntington's disease is a genetic disorder that causes progressive degeneration of nerve cells in the brain. Huntington's disease typically leads to motor, cognitive, and psychiatric disorders.

[0134] Currently, there is no treatment that can stop or slow the progression of Huntington's disease. Patients can mitigate the effects through prescription treatments, including antidepressants (such as selective serotonin reuptake inhibitors), antipsychotics, psychotropic drugs (olanzapine, buphenazine, aripiprazole), and exercise therapy. Experimental treatments include, but are not limited to, valbenazine, deuterated buphenazine, bevanolol hydrochloride, pridopidine, tominersen, WVE-003, and ANX-005.

[0135] In this embodiment, the percentage of cell-free DNA in affected neurons of Huntington's disease is determined. In this embodiment, affected neurons of Huntington's disease include GABAergic neurons. In this embodiment, the entire amplicon is generated using one or more primers targeting regions selected from those listed in Table 3.

[0136] In the implementation plan, an antidepressant is administered to the subject. In the implementation plan, an antipsychotic is administered to the subject. In the implementation plan, a psychotropic agent is administered to the subject. In the implementation plan, olanzapine is administered to the subject. In the implementation plan, buphenazine is administered to the subject. In the implementation plan, aripiprazole is administered to the subject. In the implementation plan, exercise therapy is administered to the subject. In the implementation plan, valbenazine is administered to the subject. In the implementation plan, deuterated buphenazine is administered to the subject. In the implementation plan, bevanol hydrochloride is administered to the subject. In the implementation plan, pridopidine is administered to the subject. In the implementation plan, tominersen is administered to the subject. In the implementation plan, WVE-003 is administered to the subject. In the implementation plan, ANX-005 is administered to the subject.

[0137] Amyotrophic Lateral Sclerosis (ALS) In implementation schemes, the methods described herein can be used to determine whether a subject has ALS. In implementation schemes, the methods described herein can be used to determine whether a subject is at risk for ALS. In implementation schemes, the methods described herein can be used to monitor the effectiveness of treatment or potential treatments for ALS.

[0138] ALS is a progressive neurological disorder that affects nerve cells in the brain and spinal cord, leading to loss of muscle control. In practice, ALS affects motor neurons in the brain and spinal motor neurons in the spinal cord. Symptoms may include: difficulty walking or performing normal daily activities, tripping and falling, weakness in the legs, feet, or ankles, weakness or clumsiness in the hands, slurred speech or difficulty swallowing, painful spasms and twitching of the muscles in the arms, shoulders, and tongue, inappropriate crying, laughing, or yawning, and / or cognitive and behavioral changes.

[0139] Approved medications for the treatment of ALS include riluzole (RILUTEK, EXSERVAN, TIGLUTIK), edaravone (RADICAVA), sodium chlorate, and taurursodiol (RELYVRIO). Dextromethorphan HBr and quinidine sulfate (NUEDEXTA) can be prescribed for the treatment of pseudobulbar affective disorder (PBA), characterized by frequent, involuntary, and often sudden episodes of exaggerated and / or dissimilar crying and / or laughing.

[0140] In this implementation, the percentage of cell-free DNA in the affected neurons of ALS is determined. In this implementation, the affected neurons in ALS include motor neurons and spinal motor neurons. In this implementation, the entire amplicon is generated using one or more primers targeting regions selected from those listed in Table 5.

[0141] In one implementation plan, riluzole is administered to the subject. In another implementation plan, edaravone is administered to the subject. In yet another implementation plan, sodium chlorate and taurine glycol are administered to the subject. In yet another implementation plan, dextromethorphan is administered to the subject. In yet another implementation plan, quinidine sulfate is administered to the subject.

[0142] Ataxia In implementation schemes, the methods described herein can be used to determine whether a subject has ataxia. In implementation schemes, the methods described herein can be used to determine whether a subject is at risk of ataxia. In implementation schemes, the methods described herein can be used to monitor the effectiveness of treatment or potential treatments for ataxia.

[0143] Ataxia is an abnormal lack of coordination that can lead to a staggering gait, difficulty with fine motor skills, and vision problems, as well as speech problems. Ataxia can also be a symptom of another health problem, such as malnutrition or a hereditary condition.

[0144] Multiple sclerosis (MS) In implementation schemes, the methods described herein can be used to determine whether a subject has MS. In implementation schemes, the methods described herein can be used to determine whether a subject is at risk for MS. In implementation schemes, the methods described herein can be used to monitor the effectiveness of treatment or potential treatments for MS.

[0145] Multiple sclerosis (MS) occurs when the immune system attacks the myelin sheath that protects nerve fibers. Ultimately, the disease can lead to permanent damage or deterioration of nerve fibers. Treatments include corticosteroids (e.g., glucocorticoids such as prednisone, methylprednisolone), adrenocorticotropic hormone (ACTH), plasmapheresis, and interferon beta drugs (AVONEX®, REBIF® (interferon beta-1a), BETASERON®, EXTAVIA®). (Interferon β-1b), PLEGRIDY® (pegylated interferon β-1a)), glatiramer acetate (COPAXONE, GLATOPA), monoclonal antibodies (okatumumab (KESIMPTA, ARZERRA), rituximab, alentozumab (LEMTRADA®), ocrevus, natezabiri (TYSABRI)), teriflunomide (AUBAGIO), monomethyl fumarate (BAFIERTAM™), dimethyl fumarate (TECFIDERA), diloxime fumarate (VUMERITY), fingolimod (GILENYA), cladribine (MAVENCLAD), sinimod (MAYZENT), ponesimod (PONVORY), ozamod (ZEPOSIA), mitoxantrone.

[0146] In the implementation plan, the percentage of cell-free DNA in the affected neurons in MS is determined.

[0147] In the implementation plan, a corticosteroid is administered to the subject. In the implementation plan, the corticosteroid is a glucocorticoid. In the implementation plan, prednisone is administered to the subject. In the implementation plan, methylprednisolone is administered to the subject. In the implementation plan, ACTH is administered to the subject. In the implementation plan, plasma apheresis is administered to the subject. In the implementation plan, interferon beta is administered to the subject. In the implementation plan, interferon beta-1a is administered to the subject. In the implementation plan, interferon beta-1b is administered to the subject. In the implementation plan, pegylated interferon beta-1a is administered to the subject. In the implementation plan, glatiramer acetate is administered to the subject. In the implementation plan, a monoclonal antibody is administered to the subject. In the implementation plan, oftatumab is administered to the subject. In the implementation plan, rituximab is administered to the subject. In the implementation plan, alentozumab is administered to the subject. In the implementation plan, oligrizumab is administered to the subject. In the implementation plan, natezumab is administered to the subject. In the implementation plan, teriflunomide is administered to the subject. In the implementation plan, monomethyl fumarate is administered to the subject. In the implementation plan, dimethyl fumarate is administered to the subject. In the implementation plan, diloximate fumarate is administered to the subject. In the implementation plan, fingolimod is administered to the subject. In the implementation plan, cladribine is administered to the subject. In the implementation plan, sinimod is administered to the subject. In the implementation plan, bonesimod is administered to the subject. In the implementation plan, ozamod is administered to the subject. In the implementation plan, mitoxantrone is administered to the subject.

[0148] Multiple system atrophy (MSA) In implementation schemes, the methods described herein can be used to determine whether a subject has MSA. In implementation schemes, the methods described herein can be used to determine whether a subject is at risk for MSA. In implementation schemes, the methods described herein can be used to monitor the effectiveness of treatment or potential treatments for MSA.

[0149] Multiple system atrophy (MSA) is a rare, degenerative neurological disorder that affects autonomic function (such as blood pressure) and motor control. Based on symptoms, MSA is classified into two types: Parkinsonian and cerebellar. Parkinsonian symptoms may include muscle rigidity, difficulty bending the limbs, bradykinesia, tremor, a soft voice, and balance and postural problems. Cerebellar symptoms may include ataxia, motor and coordination impairments, dysarthria, visual disturbances, dysphagia, and speech changes.

[0150] There is no known cure for MSA. Symptoms can be treated with medications that raise blood pressure and medications that relieve Parkinson's-like symptoms (see Treatment of Parkinson's Disease).

[0151] In the implementation plan, the percentage of cell-free DNA in the affected neurons of the MSA is determined.

[0152] Mild traumatic brain injury and other brain injuries In implementation schemes, the methods described herein can be used to determine whether a subject has mTBI. In implementation schemes, the methods described herein can be used to determine the severity of mTBI. In implementation schemes, the methods described herein can be used to monitor a subject's recovery from mTBI. In implementation schemes, the methods described herein can be used to monitor the effectiveness of treatment or potential treatments for mTBI.

[0153] In implementations, the methods described herein can be used to determine whether a subject has a brain injury. In implementations, the methods described herein can be used to determine the severity of the brain injury. In implementations, the methods described herein can be used to monitor a subject's recovery from a brain injury. In implementations, the methods described herein can be used to monitor the effectiveness of treatment or potential treatments for the brain injury. In implementations, brain injury includes brain swelling. In implementations, a reduction in neuronal cfDNA indicates a reduction in brain swelling.

[0154] Mild traumatic brain injury (mTBI), typically including concussion, is damage to the brain that can cause long-term damage / injury. It most commonly occurs due to direct contact with the head, but can also be caused by indirect injury (e.g., whiplash injury or violent head shaking). Individuals who have experienced a brain injury are at greater risk of a second injury and are more susceptible to subsequent damage. The damage from consecutive mTBIs is considered cumulative.

[0155] Long-term impairment caused by mTBI includes deterioration in cognitive and motor skills, such as psychomotor slowing, poor concentration and attention retrieval, leading to increased performance variability, overall executive dysfunction, as well as sleep disturbances and mood / behavioral changes. Common examples of the long-term effects of mTBI are seen in soldiers, boxers, American football players, and soccer players. There are well-documented individual cases where, long after the onset of mTBI, cumulative brain damage begins to manifest through the loss of one or more cognitive and / or motor skills.

[0156] In this embodiment, the percentage of cell-free DNA in the affected neurons of the mTBI is determined. In this embodiment, the affected neurons in the mTBI include glutamatergic neurons, GABAergic neurons, dopaminergic neurons, motor neurons, or spinal motor neurons. In this embodiment, the entire amplicon is generated using one or more primers targeting regions selected from those listed in Tables 1-5.

[0157] There are no approved therapeutic agents for treating mild traumatic brain injury (e.g., concussion). Generally, patients are advised to rest both physically and mentally, and may be prescribed pain medication (e.g., anti-inflammatory analgesics). Ghrelin is currently being used in clinical trials for the treatment of concussion. In the implementation plan, pain medication is administered to the subjects. In the implementation plan, anti-inflammatory analgesics are administered to the subjects. In the implementation plan, ghrelin is administered to the subjects.

[0158] It should be understood that the embodiments and implementations described herein are for illustrative purposes only, and various modifications or variations based on the invention will occur to those skilled in the art, all of which are included within the spirit and scope of this application and the appended claims. All publications, patents, and patent applications cited herein are incorporated herein by reference in their entirety for all purposes.

[0159] Example Those skilled in the art will understand that the examples described herein are for illustrative purposes only, and this disclosure is not limited thereto.

[0160] Example 1. Methylation analysis of cfDNA Following the manufacturer's instructions with some modifications, cfDNA was extracted from human patient plasma using the QIAamp MinElute ccfDNA Mini Kit (catalog number 55204). In short, the magnetic beads were warmed to 37°C before use. The plasma, proteinase K, magnetic beads, and buffer were incubated together with shaking for approximately 20 min, then rotated twice (30 s each time at 200 xg), and the supernatant was removed. The beads were resuspended in elution buffer and incubated at room temperature with shaking for 10 min. The supernatant was removed, buffer was added, and the mixture was run through a MinElute column, eluting the cfDNA from the column.

[0161] Then, the cfDNA was converted to bisulfite (EZ DNA Methylation-Lightning Kit, ZymoResearch; catalog number 69506) or enzymatically converted (NEBNext Methyl-Seq Conversion Module, New England Biolabs; catalog number D5002) to convert the methylated bases.

[0162] Following bisulfite transformation, the region of interest was amplified. In short, bisulfite-transformed cfDNA (2 µl), forward and reverse primers, and ZymoTaq premix (25 µl, Zymo Research), along with RNase / DNase-free water, were mixed and run on a thermal cycler under the following conditions: 95℃, one cycle lasting 10 minutes; 38 cycles: 95℃ for 30 seconds, 55℃ for 40 seconds, 72℃ for 40 seconds; 72℃ for 7 minutes per cycle, then incubate at 4℃.

[0163] After amplification, the samples were used to prepare libraries, which were then sequenced (using the SQK-NBD114.96 nanopore sequencer kit). A modification was made to the protocol by using 1.0X AmpureXP magnetic beads instead of the recommended 0.4X to better target highly fragmented reads. The prepared libraries were then sequenced for 72 hours on a MinION MK1C nanopore sequencer following the flow cell loading protocol provided with the SQK-NBD114.96 kit.

[0164] For Alzheimer's disease, amplification of chr3:42190679 and 42191148 was targeted. This region was chosen because of the significant difference in methylation between purified neurons and plasma. The mean signal in plasma was a methylation β value of .9. The mean signal in purified neuronal DNA was a methylation β value of .04. These values ​​indicate that the neuronal molecules in this region will be completely unmethylated. Amplification of chr19_3507867_3507868 was also targeted.

[0165] The actual nucleotide sequence of the said region is: CTGACGTCACCCTCTAGGCGTCTGGATAGGACGATCCTGGCTACTCCCATTCAGGGCTGCTGTCCAGTGCTGCTTTATTGGCAGTGCTGCCAGGGTCTCCGTTAGCTCTCTGCAAATTGCCTTCCTTTCTGCTCCTCCTACTCCCTCCTTCCCCCATAGAATTTTTCTTTTCATTGCCCACTTTACTGTTTTGGCTCCAGACTGTCGTTAAGAATGTACAGCCTAATTCTGGTGTGTTTCGGGATATTCTTCTGTCCAGTATTCTGGAAGGGCGGGGAGGCATGGCAGCGTTTTACTTGACGTTGATGGTGCTGTGAAGTCCATTCTTTCCTCTGCAAGACTACTGACTATGCAGAAATTTATCGAAGCGGATTATTATGAACTAGACTGGTATTATGAAGAATGCTCGGATGGTAATTATGGCCCCTGCAAAACAGAGCCGGGATGTATAGGGGTATTGTCTCCTTCTG (chr3:42190679,42191148)(SEQ ID NO:1).The bisulfite conversion form in the region is: TTGACGTTATTTTTTAGGCGTTTGGATAGGACGATTTTGGTTATTTTTATTTAGGGTTGTTGTTTAGTGTTGTTTTATTGGTAGTGTTGTTTTAGGGTTTTCGTTAGTTTTTTGTAAATTGTTTTTTTTTTTTTGTTTTTTTTTTATTTTTTTTTTTTTATAGAATTTTTTTTTTTTTTTATTGTTTATTTTTTATTGTTTTGGTTTTAGATTGTCGTTAAGAATGTATAGTTTAAT TTTGGTGTGTTTCGGGATATTTTTTTGTTTAGTATTTTGGAAGGGCGGGGAGGTATGGTAGCGTTTTATTTGACGTTGATGGTGTTGTGAAGTTTTATTTTTTTTTTTGTAAGATTGATTATGTAGAAATTTATCGAAGCGGATTATTATGAATTAGATTGGTATTATGAAGAATGTTCGGATGGTAATTATGGTTTTTGTAAAATAGAGTCGGGATGTATAGGGGTATTGTTTTTTTTG (chr3:42190679,42191148) (SEQ ID NO:2). These were amplified using TTTATTGTTTTGGTTTTAGATTGT (chr3:42190859,42190884)(SEQ ID NO: 3) and GTTATGGTGTTGTGAAGTTTATTT (chr3:42190979,42191004)(SEQ ID NO: 4) as forward primers, and AATAAACTTCACAACACCATCAAC (chr3:42190859,42190884)(SEQ ID NO: 5) and ACAATCTAAAACCAAAACAATAAAA (chr3:42190979,42191004)(SEQ ID NO: 6) as reverse primers. The primers for chr19_3507867_3507868 are GGTATTATTTAGGTTTGGTTTT (forward) (SEQ ID NO:7) and TACCTTTAAATAAATATCTACTCCCTTAAC (reverse) (SEQ ID NO:8).

[0166] All samples were sequenced using a MinION MK1C instrument equipped with a version 14 flow cell. Pore activity of all flow cells was checked prior to sequencing to ensure optimal performance. Reads with a quality score below 9 were marked as unacceptable, and reads shorter than 200 bp were excluded from analysis. Fastq files from each sample were analyzed using the microseq package in R. To focus on fully amplified molecules and avoid fragmented reads, only reads representing fully amplified molecules were used for subsequent analysis. Bisulfite conversion errors were checked manually for the presence of any Cs outside the CG range. Any reads containing unconverted Cs outside the CG context were removed from the analysis. Whole-molecule analysis was then performed for each read from each sample by calculating the average methylation between molecules. Based on methylation levels, reads were categorized as blood-derived DNA (whole-molecule methylation > 0.75), neuronal-derived DNA (whole-molecule methylation = 0), or unknown reads (whole-molecule methylation between 0 and 0.75). The proportion of neuronal-derived DNA in each sample was calculated by dividing the number of neuronal-derived reads by the total number of reads in the sample.

[0167] Example 2. Results of methylation analysis of cfDNA A total of 37,455 differentially methylated regions (DMRs) were identified between purified neurons and plasma samples, demonstrating significant phenotypic differences (p-value ≤ 0.0001). To visualize the distribution of these DMRs, a heatmap was generated, highlighting the significant contrast between plasma and purified neurons. Figure 1 Further narrowing down the identified DMR range, 957 sites showed an absolute mean difference in methylation β values ​​of 0.6 or greater. Figures 2A-2B From this subset, the first 25 target sites were selected, and primers were designed specifically for each site.

[0168] To verify the successful amplification of the designed primers, electrophoresis gels were used. Of the 25 primers tested, 7 showed appropriate amplification, indicating their suitability for subsequent analysis. Figures 3A-3G Next, we sequenced equal portions of four DNA samples from plasma and purified cortical neurons at all seven selected loci.

[0169] Of the sequenced loci, two showed substantially differentially methylated molecules across cortical neurons and plasma. Specifically, neuronal DNA reads were completely unmethylated at all CpG sites, while plasma DNA showed almost complete methylation at these CpG sites. These highly differentially methylated loci were identified as the most promising biomarkers and were used for comprehensive analysis of plasma samples in the acquired dataset.

[0170] The results showed that by using a 5% conservative cutoff value for the proportion of cell-free DNA (cfDNA) derived from neurons in plasma, we were able to accurately identify 100% of patients diagnosed with Alzheimer's disease. Figure 4 In contrast, the young control cohort showed low or negligible levels of neuronal-derived cfDNA, indicating the absence of neurodegeneration.

[0171] Notably, all patients initially diagnosed with mild cognitive impairment (MCI) who later developed Alzheimer's disease exhibited elevated levels of neuronal-derived cfDNA (>5% of total cfDNA). Among MCI patients who were not diagnosed with Alzheimer's disease within 5 years, 75% showed normal or low levels of neuronal-derived cfDNA, while 25% had elevated levels.

[0172] In the group of elderly healthy donors, approximately 90% showed normal levels of neuronal-derived cfDNA, while approximately 10% showed elevated levels. Statistical analysis comparing repeated samples from the two groups revealed no significant differences, confirming the reproducibility and reliability of the experimental procedure.

[0173] This study presents a novel method for detecting neurodegenerative changes in cell-free DNA (cfDNA) derived from neurons in plasma. By analyzing differentially methylated regions (DMRs) between purified cortical neurons and plasma samples, we identified robust biomarkers capable of accurately distinguishing neuronal and non-neuronal cfDNA. Utilizing cfDNA as a non-invasive biomarker offers several advantages over protein-based assays commonly used for the diagnosis of neurodegenerative diseases.

[0174] First, compared to cerebrospinal fluid or tissue biopsies, the use of cfDNA allows for convenient and minimally invasive sample collection. Plasma samples are readily available, making this diagnostic method more accessible and less burdensome for patients. Furthermore, cfDNA analysis provides a broader representation of the molecular changes occurring in the brain, as it reflects cumulative changes across various cell types, including neurons.

[0175] In this study, we initially identified a large number of DMRs (37,455) between purified neuronal and plasma samples, indicating significant phenotypic differences. To enhance the practicality of this diagnostic approach, we further narrowed the selection to 957 sites with significant average methylation differences. From this subset, the top 25 target sites were selected and validated through primer design and amplification. Seven of the 25 primers successfully amplified the sites, demonstrating the feasibility of using specific loci as potential biomarkers.

[0176] Example 3. Methylation analysis of cfDNA in Parkinson’s disease Differentially methylated regions (DMRs) will be identified between purified dopaminergic neurons and plasma samples. To visualize the distribution of these DMRs, a heatmap will be generated highlighting the significant contrast between plasma and purified dopaminergic neurons. We will select target sites with an absolute mean difference of 0.6 or higher in methylation β values ​​for further investigation and will design primers specifically for each site.

[0177] To verify the successful amplification of the designed primers, electrophoresis gels will be used to determine which primers amplified correctly. Among the sequenced loci, those exhibiting substantially differential methylation across the entire molecule between dopaminergic neurons and plasma will be selected. These highly differentially methylated loci will be identified as the most promising biomarkers and used for comprehensive analysis of plasma samples in the obtained dataset.

[0178] The results will demonstrate that by using a conservative cutoff of 5% for the proportion of cell-free DNA (cfDNA) derived from dopaminergic neurons in plasma, we will be able to accurately identify 100% of patients diagnosed with neurodegenerative diseases such as Parkinson's disease. In contrast, the young control cohort will show low or negligible levels of cfDNA derived from dopaminergic neurons, indicating the absence of neurodegeneration.

[0179] Example 4. Methylation analysis of cfDNA in ALS We will identify differentially methylated regions (DMRs) between purified motor neurons or spinal motor neurons and plasma samples. To visualize the distribution of these DMRs, a heatmap will be generated highlighting the significant contrast between plasma and purified motor neurons. We will select target sites with an absolute mean difference in methylation β values ​​of 0.6 or higher for further investigation and will design primers specifically for each site.

[0180] To verify the successful amplification of the designed primers, electrophoresis gels will be used to determine which primers amplified correctly. Among the sequenced loci, those exhibiting substantially differential methylation across the entire molecule between motor neurons and plasma will be selected. Specifically, motor neuron DNA reads will show complete unmethylation at all CpG sites, while plasma DNA will show almost complete methylation at these CpG sites. These highly differentially methylated loci will be identified as the most promising biomarkers and used for comprehensive analysis of plasma samples in the obtained dataset.

[0181] The results will demonstrate that by using a conservative cutoff of 5% for the proportion of cell-free DNA (cfDNA) derived from motor neurons in plasma, we will be able to accurately identify 100% of patients diagnosed with neurodegenerative diseases (such as ALS). In contrast, the young control cohort will show low or negligible levels of cfDNA derived from motor neurons, indicating the absence of neurodegeneration.

[0182] Example 5. Methylation analysis of cfDNA in cortical glutamatergic neurons Differentially methylated regions (DMRs) will be identified between purified cortical glutamatergic neurons and plasma samples. To visualize the distribution of these DMRs, a heatmap will be generated highlighting the significant contrast between plasma and purified cortical glutamatergic neurons. We will select target sites with an absolute mean difference in methylation β values ​​of 0.6 or higher for further investigation and will design primers specifically for each site.

[0183] To verify the successful amplification of the designed primers, electrophoresis gels will be used to determine which primers amplified correctly. Among the sequenced loci, those exhibiting substantially differential methylation across the entire molecule between cortical glutamatergic neurons and plasma will be selected. These highly differentially methylated loci will be identified as the most promising biomarkers and used for comprehensive analysis of plasma samples in the obtained dataset.

[0184] The results will demonstrate that by using a conservative cutoff of 5% for the proportion of cell-free DNA (cfDNA) derived from corticoglutamatergic neurons in plasma, we will be able to accurately identify 100% of patients diagnosed with neurodegenerative diseases such as Alzheimer's disease or dementia. In contrast, the young control cohort will show low or negligible levels of cfDNA derived from corticoglutamatergic neurons, indicating the absence of neurodegeneration.

[0185] Example 6. Methylation analysis of cfDNA in cortical GABAergic neurons We will identify differentially methylated regions (DMRs) between purified cortical GABAergic neurons and plasma samples. To visualize the distribution of these DMRs, a heatmap will be generated, highlighting the significant contrast between plasma and purified cortical GABAergic neurons. We will select target sites with an absolute mean difference in methylation β values ​​of 0.6 or higher for further investigation, and primers will be specifically designed for each site.

[0186] To verify the successful amplification of the designed primers, electrophoresis gels will be used to determine which primers amplified correctly. Among the sequenced loci, those exhibiting substantially differential methylation across the entire molecule between cortical GABAergic neurons and plasma will be selected. These highly differentially methylated loci will be identified as the most promising biomarkers and used for comprehensive analysis of plasma samples in the obtained dataset.

[0187] The results will demonstrate that by using a conservative cutoff of 5% for the proportion of cell-free DNA (cfDNA) derived from cortical GABAergic neurons in plasma, we will be able to accurately identify 100% of patients diagnosed with neurodegenerative diseases (such as Huntington's disease). In contrast, the young control cohort will show low or negligible levels of cfDNA derived from cortical GABAergic neurons, indicating the absence of neurodegeneration.

[0188] Example 7. Results of methylation analysis of cfDNA in patients with neurodegenerative disease We conducted an extensive analysis of methylation patterns in 295 patients, including healthy donors and those diagnosed with Parkinson's disease, amyotrophic lateral sclerosis (ALS), Alzheimer's disease, and mild cognitive impairment. Each patient underwent whole-genome sequencing using Oxford Nanopore sequencing to ensure comprehensive coverage of methylation patterns.

[0189] For each patient sample, a dataset containing data on cortical neurons was generated. Figures 6A-6B ), dopaminergic neurons ( Figure 6C ) and spinal motor neurons ( Figure 6D Data frames containing sequencing reads specific to unique, previously identified differentially methylated regions (DMRs). These reads were then classified using a machine learning model into the following categories: cortical, spinal cord, dopaminergic, blood, or unknown.

[0190] The categorized read lengths were quantified, and the proportion of each neuronal subtype was calculated. These percentages were then correlated with the corresponding disease conditions. Elevated levels of cfDNA from dopaminergic neurons were associated with Parkinson's disease, elevated levels from spinal motor neurons were associated with ALS, and elevated levels from cortical neurons were associated with Alzheimer's disease. These findings not only provide a detailed characterization of the distribution of neuronal subtypes in neurodegenerative diseases but also allow for the differentiation of disease types using a single blood sample.

Claims

1. A method of treating a subject, wherein the subject has a neurodegenerative disorder or is at risk of developing a neurodegenerative disorder, the method comprising: (i) Obtain cell-free DNA from a blood sample from the subject; (ii) Analyze the methylation patterns of DNA regions in cell-free DNA, where the regions are selected from those listed in Table 2-5; (iii) Determine the percentage of cell-free DNA from neurons; (iv) Compare the percentage of cell-free DNA from neurons to a control; and (v) When the percentage of cell-free DNA from neurons is greater than that of the control, administer a therapeutic agent for treating or preventing the neurodegenerative disease.

2. The method of claim 1, wherein step (ii) comprises analyzing the methylation pattern of the entire amplicon of DNA.

3. The method of claim 2, wherein the length of the entire amplicon is at least about 50 base pairs (bp).

4. The method of claim 3, wherein the length of the entire amplicon is between about 50 and about 500 base pairs.

5. The method of any one of claims 1 to 4, wherein the therapeutic agent is administered when the percentage of cell-free DNA from the neurons is greater than about 5%.

6. The method of any one of claims 1 to 4, wherein the therapeutic agent is administered when the percentage of cell-free DNA from the neurons is greater than about 7%.

7. The method of any one of claims 1 to 4, wherein the therapeutic agent is administered when the percentage of cell-free DNA from the neurons is greater than about 9%.

8. A method of treating a subject, wherein the subject has a neurodegenerative disorder or is at risk of developing a neurodegenerative disorder, the method comprising: (i) Obtain cell-free DNA from a blood sample from the subject; (ii) Analyze the methylation patterns of DNA regions in cell-free DNA, where the regions are selected from those listed in Table 2-5; (iii) Determine the percentage of cell-free DNA from neurons; and (iv) When the percentage of cell-free DNA from neurons is greater than about 5%, administer a therapeutic agent for treating or preventing the neurodegenerative disease.

9. A method for analyzing biological samples of a subject, the method comprising: (i) Obtain cell-free DNA from a blood sample from the subject; (ii) Analyze the methylation patterns of DNA regions in cell-free DNA, where the regions are selected from those listed in Table 2-5; (iii) Determine the percentage of cell-free DNA from neurons; and (iv) Compare the percentage of cell-free DNA from neurons to a control.

10. A method for measuring neuronal cell death in a subject, the method comprising: (i) Obtain cell-free DNA from a blood sample from the subject; (ii) Analyze the methylation patterns of DNA regions in cell-free DNA, where the regions are selected from those listed in Table 2-5; (iii) Determine the percentage of cell-free DNA from neurons; and (iv) Compare the percentage of cell-free DNA from neurons to a control.

11. A method for selecting a patient to be treated with a therapeutic agent for treating neurodegenerative disorders, the method comprising: (i) Obtain cell-free DNA from a blood sample from the subject; (ii) Analyze the methylation patterns of DNA regions in cell-free DNA, where the regions are selected from those listed in Table 2-5; (iii) Determine the percentage of cell-free DNA from neurons; and (iv) Compare the percentage of cell-free DNA from neurons to a control; Specifically, the patient is selected for treatment when the percentage of cell-free DNA from neurons is greater than that of the control group.

12. The method of any one of claims 8 to 11, wherein step (ii) comprises analyzing the methylation pattern of the entire amplicon of DNA.

13. The method of claim 12, wherein the length of the entire amplicon is at least about 50 base pairs (bp).

14. The method of claim 13, wherein the length of the entire amplicon is between about 50 and about 500 base pairs.

15. The method of any one of claims 10 to 14, wherein the patient is selected for treatment when the percentage of cell-free DNA from neurons is greater than about 5%.

16. The method of claim 15, wherein the patient is selected for treatment when the percentage of cell-free DNA from neurons is greater than about 7%.

17. The method of claim 15, wherein the patient is selected for treatment when the percentage of cell-free DNA from neurons is greater than about 9%.

18. The method of any one of claims 1 to 17, wherein a higher percentage of cell-free DNA from neurons indicates an increased risk of neurodegenerative disorders or traumatic brain injury than the control.

19. A computer product comprising a non-transitory computer-readable medium storing a plurality of instructions, said instructions, when executed, controlling a computer system to analyze a biological sample from a subject to determine the risk of a neurodegenerative disorder in said subject, said biological sample comprising cell-free DNA, said instructions comprising: (i) Identify a first DNA methylation pattern that occurs in a neuron at a rate above a threshold, wherein the first DNA methylation pattern includes methylation in one or more methylated regions and optionally includes unmethylation in one or more unmethylated regions; (i) Analyze the methylation patterns of DNA regions in cell-free DNA, where the regions are selected from those listed in Table 2-5; as well as (iii) Calculate the relative abundance of one or more methylated regions and optionally one or more unmethylated regions in cell-free DNA; as well as (iv) Determine the risk of neurodegenerative disorders in the subject by comparing the relative abundance with a control.

20. A method for determining the efficacy of a potential treatment for a neurodegenerative disorder, the method comprising: (i) Obtain cell-free DNA from blood samples from multiple subjects in which the potential treatment has been administered; (ii) Analyze the methylation patterns of DNA regions in cell-free DNA, where the regions are selected from those listed in Table 2-5; (iii) Determine the percentage of cell-free DNA from neurons; and (iv) Compare the percentage of cell-free DNA from neurons to a control; The potential treatment is effective when the percentage of cell-free DNA from neurons is lower than that of the control.

21. The method of claim 20, wherein steps (i)-(iv) are repeated at least once.

22. The method of claim 21, wherein steps (i)-(iv) are repeated weekly.

23. The method of any one of claims 20-22, wherein the potential treatment comprises recombinant iduronate 2-sulfatase (IDS) protein, leucine-rich repeatable kinase 2 (LRRK2) inhibitor, recombinant pregranule protein (PGRN) protein, recombinant N-sulfoglucosamine sulfonylhydrolase (SGSH) protein, recombinant α-L-iduronase (IDUA) recombinant protein, receptor-interacting serine / threonine protein kinase 1 (RIPK1) inhibitor, or eukaryotic translation initiation factor 2B (eIF2B) activator.

24. The method of any one of claims 20-23, wherein the potential processing includes DNL310 (ETV:IDS), BIIB122 / DNL151, TAK-594 / DNL593, DNL126 (ETV:SGSH), DNL622 (ETV:IDUA), SAR443820 / DNL788, DNL343, or SAR443122 / DNL758.

25. The method of any of the preceding claims, wherein determining the percentage of cell-free DNA from neurons comprises comparing the methylation pattern of the cell-free DNA with the methylation pattern of neuronal DNA, wherein the neuronal DNA methylation pattern comprises methylation of one or more methylated regions and optionally includes unmethylation of one or more unmethylated regions.

26. A computer-implemented method for analyzing biological samples, comprising: (i) Identify a first DNA methylation pattern that occurs in a neuron at a rate above a threshold, wherein the first DNA methylation pattern includes methylation in one or more methylated regions and optionally includes unmethylation in one or more unmethylated regions; (ii) Analyze the methylation patterns of DNA regions in cell-free DNA, where the regions are selected from those listed in Table 2-5; as well as (iii) Calculate the relative abundance of one or more methylated regions and optionally one or more unmethylated regions in cell-free DNA; as well as (iv) Determine the risk of neurodegenerative diseases in the subjects by comparing relative abundance with controls.

27. The method of any one of claims 20 to 26, wherein step (ii) comprises analyzing the methylation pattern of the entire amplicon of DNA.

28. The method of claim 27, wherein the length of the entire amplicon is at least about 50 base pairs (bp).

29. The method of claim 28, wherein the length of the entire amplicon is between about 50 and about 500 base pairs.

30. The method of any of the preceding claims, wherein the control is the percentage of cell-free DNA from neurons in a blood sample from an untreated subject, the percentage of cell-free DNA from neurons in a blood sample from the subject prior to treatment, or a threshold.

31. The method of claim 30, wherein the threshold is a percentage greater than about 5% of cell-free DNA from neurons.

32. The method of claim 30, wherein the threshold is a percentage greater than about 7% of cell-free DNA from neurons.

33. The method of claim 30, wherein the threshold is a percentage greater than about 9% of cell-free DNA from neurons.

34. The method of any of the preceding claims, wherein the neurodegenerative disease is selected from Huntington's disease, Parkinson's disease, amyotrophic lateral sclerosis (ALS), ataxia, multiple sclerosis, multiple system atrophy, concussion, frontotemporal dementia-granulin, mucopolysaccharidosis type I (MPS I), mucopolysaccharidosis type II (MPS II; Hunt syndrome) or mucopolysaccharidosis type IIIA (MPS IIIA; Sanfilip syndrome).

35. The method of any of the preceding claims, wherein the neuron is a motor neuron, a spinal motor neuron, a sensory neuron, an interneuron, a dopaminergic neuron, a cholinergic neuron, a GABAergic neuron, a glutamatergic neuron, or a cortical neuron.

36. The method of any of the preceding claims, wherein the neurons are derived from the forebrain, midbrain, or hindbrain.

37. The method of any of the preceding claims, wherein the neuron is derived from the frontal lobe, temporal lobe, parietal lobe, occipital lobe, cerebellum, or brainstem.

38. The method of any of the preceding claims, wherein analyzing the methylation pattern comprises converting 5-methylcytosine in the cell-free DNA into different nucleotides.

39. The method of claim 38, wherein the conversion comprises bisulfite conversion or enzymatic conversion.

40. The method of any of the preceding claims, wherein the subject suffers from mild cognitive impairment.

41. The method of any of the preceding claims, wherein the subject is older than 45 years.

42. The method as claimed in any of the preceding claims, comprising selecting subjects aged 45 years or older.

43. The method of claim 42, wherein the subject has no symptoms of neurodegenerative disease.

44. The method as claimed in any of the preceding claims, comprising selecting a subject with mild cognitive impairment.

45. A method for treating a subject with mild traumatic brain injury, comprising: (i) Select subjects who are at risk of mild traumatic brain injury; (ii) Obtain cell-free DNA from a blood sample from the subject; (iii) Analyze the methylation patterns of DNA regions in cell-free DNA, where the regions are selected from those listed in Table 2-5; (iv) Determine the percentage of cell-free DNA from neurons; and (v) Compare the percentage of cell-free DNA from neurons to a control; (vi) When the percentage of cell-free DNA from neurons is greater than that of the control, the subject is treated for mild traumatic brain injury.

46. ​​The method of claim 45, wherein treating the subject comprises administering a therapeutic agent for treating one or more symptoms of mild traumatic brain injury.

47. The method of claim 45 or 46 further comprises repeating steps (ii) to (v) at a post-treatment time point.

48. The method of claim 47, wherein treatment is interrupted when the percentage of cell-free DNA from neurons at the time point is less than or equal to the control.

49. The method of claim 48, wherein treatment continues when the percentage of cell-free DNA from neurons at the time point is greater than that of the control.

50. A kit comprising a first plurality of oligonucleotides, wherein each of the first plurality of oligonucleotides is capable of hybridizing with a region preferentially methylated in a neuronal cell, wherein the region is selected from the regions listed in Tables 2-5.

51. The kit of claim 50, further comprising a second plurality of oligonucleotides, wherein each of the second plurality of oligonucleotides is capable of hybridizing with preferentially unmethylated regions in neuronal cells.

52. The kit of claim 50 or 51, wherein the kit is used to determine the efficacy of a potential treatment for neurodegenerative diseases or disorders.

53. The kit of claim 52, wherein the neurodegenerative disease or disorder is selected from Huntington's disease, Parkinson's disease, amyotrophic lateral sclerosis (ALS), ataxia, multiple sclerosis, multiple system atrophy, concussion, frontotemporal dementia-granulin, mucopolysaccharidosis type I (MPS I), mucopolysaccharidosis type II (MPS II; Hunt syndrome) or mucopolysaccharidosis type IIIA (MPS IIIA; Sanfilip syndrome).

54. The kit according to any one of claims 50 to 53, wherein the neuron is a motor neuron, spinal motor neuron, sensory neuron, interneuron, dopaminergic neuron, cholinergic neuron, GABAergic neuron, glutamatergic neuron, or cortical neuron.

55. The kit according to any one of claims 50 to 54, wherein the neurons are derived from the forebrain, midbrain, or hindbrain.

56. The kit according to any one of claims 50 to 55, wherein the neurons are derived from the frontal lobe, temporal lobe, parietal lobe, occipital lobe, cerebellum, or brainstem.

57. The kit of any one of claims 50 to 56, wherein the potential treatment comprises recombinant iduronate 2-sulfatase (IDS) protein, a leucine-rich repeatable kinase 2 (LRRK2) inhibitor, recombinant pregranulin protein (PGRN) protein, recombinant N-sulfoglucosamine sulfonylhydrolase (SGSH) protein, recombinant α-L-iduronase (IDUA) recombinant protein, receptor-interacting serine / threonine protein kinase 1 (RIPK1) inhibitor, or eukaryotic translation initiation factor 2B (eIF2B) activator.

58. The kit according to any one of claims 50 to 57, wherein the potential treatment includes DNL310 (ETV:IDS), BIIB122 / DNL151, TAK-594 / DNL593, DNL126 (ETV:SGSH), DNL622 (ETV:IDUA), SAR443820 / DNL788, DNL343, or SAR443122 / DNL758.

59. A method for detecting cell-free DNA derived from neurons in a blood sample, comprising: (i) Obtaining cell-free DNA from blood samples from human subjects; as well as (ii) Detecting the presence of cell-free DNA from neurons in the blood sample by methylation analysis, including sequencing the entire amplicon of the cell-free DNA from the blood sample. The entire amplicon is generated using one or more primers that target regions selected from those listed in Tables 2-5.

60. The method of claim 59, wherein the length of the entire amplicon is at least about 50 base pairs (bp).

61. The method of claim 60, wherein the length of the entire amplicon is between about 50 and about 500 base pairs.

62. A method for determining the methylation state of an amplicon, comprising: (i) Obtaining cell-free DNA from blood samples from human subjects; (ii) Converting 5-methylcytosine in the cell-free DNA into different nucleotides to produce transformed cell-free DNA; (iii) Amplifying the transformed cell-free DNA to generate an amplicon; and (iv) Sequencing the amplicon, wherein the length of the amplicon is between approximately 50 bp and approximately 500 bp. The amplicon is generated using one or more primers that target regions selected from those listed in Tables 2-5.

Images