Application of CA9 inhibitor in preparation of medicine for preventing and treating esophageal squamous carcinoma

By using deoxylabaquinone as a CA9 inhibitor to target the alkalosis mechanism of esophageal squamous cell carcinoma cells, the problems of large side effects and strong drug resistance in existing treatments have been solved, achieving a highly effective and low-toxicity treatment effect for esophageal squamous cell carcinoma.

CN121714548APending Publication Date: 2026-03-24SHIHEZI UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-02-04
Publication Date
2026-03-24

AI Technical Summary

Technical Problem

Current chemotherapy methods for treating advanced or metastatic esophageal squamous cell carcinoma (ESCC) suffer from significant side effects, strong drug resistance, and a lack of precise targeted drugs. Existing immune checkpoint inhibitors have limited response rates and lack effective predictive biomarkers.

Method used

Deoxylapachol (DEO) was used as a CA9 inhibitor to target the alkalosis mechanism, inhibit the activity of carbonic anhydrase 9 (CA9), disrupt the internal base and external acid pH homeostasis of tumor cells, and induce alkalosis, thus developing a drug for the prevention and treatment of esophageal squamous cell carcinoma.

Benefits of technology

It achieves highly effective and low-toxicity treatment for esophageal squamous cell carcinoma, overcomes the side effects of traditional chemotherapy, provides a wider treatment window and more precise treatment options, and reduces damage to normal tissues.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention relates to the technical field of biological medicines, in particular to application of a CA9 inhibitor in preparation of a medicine for preventing and treating esophageal squamous carcinoma. The invention provides an application of deoxidized labaquinone in preparation of a CA9 inhibitor, and further provides an application of deoxidized labaquinone or the CA9 inhibitor in preparation of a medicine for preventing and treating esophageal squamous cell carcinoma. According to the application, DEO can be used as a novel CA9 inhibitor, the effect of resisting esophageal squamous cell carcinoma is achieved by inducing alkali death, a brand new theoretical basis is provided for developing the novel inhibitor aiming at CA9 and clinical application of DEO, and the application has important theoretical value and wide clinical application prospects in efficient and low-toxicity treatment of esophageal squamous cell carcinoma.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to the application of a CA9 inhibitor in the preparation of a drug for the prevention and treatment of esophageal squamous cell carcinoma. Background Technology

[0002] Esophageal cancer is mainly divided into two histological subtypes: esophageal squamous cell carcinoma (ESCC) and esophageal adenocarcinoma (EAC). These two subtypes differ significantly in their epidemiological distribution and pathogenic mechanisms. Currently, systemic treatment for advanced or metastatic ESCC primarily relies on platinum-based or paclitaxel (PTX) combination chemotherapy. However, treatment efficacy has plateaued, with median overall survival typically less than 15 months, accompanied by significant hematologic and neurotoxic side effects. Furthermore, primary or acquired resistance of tumor cells to traditional chemotherapy (especially apoptosis-inducing therapies) is a key reason for treatment failure.

[0003] Although the use of immune checkpoint inhibitors (such as anti-PD-1 antibodies) has brought survival benefits to some ESCC patients in recent years, their overall response rate is limited, and there is a lack of precise and effective predictive biomarkers. In the field of targeted therapy, apart from HER2-positive patients, there is a lack of mature driver gene targets and corresponding highly effective targeted drugs for ESCC. Therefore, there is an urgent clinical need to explore drugs with novel mechanisms of action to overcome the limitations of existing treatments and achieve more precise, efficient, and toxicity-controlled treatment for ESCC. Summary of the Invention

[0004] Based on the above, the present invention provides the application of a CA9 inhibitor in the preparation of a drug for the prevention and treatment of esophageal squamous cell carcinoma.

[0005] To achieve the above objectives, the present invention provides the following solution: One of the technical solutions of this invention is the application of deoxylabaquinone in the preparation of CA9 inhibitors.

[0006] The second technical solution of the present invention is a CA9 inhibitor, the active ingredient of which includes deoxylabaquinone.

[0007] In a preferred embodiment of the present invention, the CA9 inhibitor further includes pharmaceutically acceptable excipients.

[0008] The third technical solution of the present invention is the application of deoxylabaquinone or the above-mentioned CA9 inhibitor in the preparation of a drug for the prevention and treatment of esophageal squamous cell carcinoma.

[0009] The fourth technical solution of the present invention is a drug for preventing and treating esophageal squamous cell carcinoma, the active ingredient of which includes deoxylabaquinone or the above-mentioned CA9 inhibitor.

[0010] In a preferred embodiment of the invention, pharmaceutically acceptable excipients are also included.

[0011] In a preferred embodiment of the present invention, the dosage form of the drug is a solid dosage form, a liquid dosage form, a paste dosage form, or an emulsion dosage form.

[0012] Compared with the prior art, the present invention has the following beneficial effects: This invention clarifies that deoxylapachol (DEO) can serve as a novel CA9 inhibitor and exert its anti-esophageal squamous cell carcinoma effect by inducing alkalosis. This provides a new theoretical basis for the development of novel CA9 inhibitors and the clinical application of DEO, and has significant theoretical value and broad clinical application prospects for achieving highly effective and low-toxicity treatment of esophageal squamous cell carcinoma. Attached Figure Description

[0013] Figure 1 The effect of small molecule compounds on the proliferation of esophageal squamous cell carcinoma cells.

[0014] Figure 2 The names and structural formulas of the candidate natural small molecule compounds are given.

[0015] Figure 3 To investigate the effect of DEO on CA9 protein expression using proteomics.

[0016] Figure 4 The effect of DEO on CA9 protein expression in KYSE150 and KYSE410 cells.

[0017] Figure 5 The docking fractions of DEO and small molecule inhibitors with CA9 molecules.

[0018] Figure 6 Molecular dynamics simulations of the CA9-DEO complex are shown below; where A is the RMSD value of the CA9-DEO complex over time; B is the Rg value of the CA9-DEO complex over time; C is the SASA value of the CA9-DEO complex over time; D is the HBonds value of the CA9-DEO complex over time; and E is the RMSF value of the CA9-DEO complex.

[0019] Figure 7 The stability of DEO binding to CA9 was determined using GEAST.

[0020] Figure 8 A lentivirus knockdown-shCA9 profile.

[0021] Figure 9 A map of lentivirus overexpression of oeCA9.

[0022] Figure 10The shCA9-KYSE150 and shCA9KYSE410 cell lines were constructed.

[0023] Figure 11 The oeCA9-KYSE150 and oeCA9-KYSE410 cell lines were constructed.

[0024] Figure 12 The effect of DEO on CA9 protein expression in oeCA9-KYSE150 and oeCA9-KYSE410 cell lines.

[0025] Figure 13 The effect of DEO on CA9 protein expression in shCA9-KYSE-150 and shCA9-KYSE-410 cell lines.

[0026] Figure 14 The effect of DEO on the cytotoxicity of KYSE150 and KYSE410 cells.

[0027] Figure 15 DEO induces S-cycle arrest in KYSE-150 and KYSE-410 cells.

[0028] Figure 16 The effect of DEO on the expression of cell cycle-related proteins in esophageal squamous cell carcinoma cells.

[0029] Figure 17 The effect of DEO on alkalization of KYSE150 and KYSE410 cytoplasm.

[0030] Figure 18 To observe the effect of DEO on the morphology of KYSE150 cells using transmission electron microscopy.

[0031] Figure 19 To observe the effect of DEO on the morphology of KYSE410 cells using transmission electron microscopy.

[0032] Figure 20 The effect of DEO on ROS content in KYSE150 and KYSE410 cells.

[0033] Figure 21 To investigate the effects of DEO combined with lentivirus knockdown and CA9 overexpression on the in vitro proliferation of esophageal squamous cell carcinoma cells 410 using a plate cloning assay.

[0034] Figure 22 To investigate the effects of DEO combined with lentivirus knockdown and CA9 overexpression on the in vitro proliferation of esophageal squamous cell carcinoma cells 150 using a plate cloning assay.

[0035] Figure 23 DEO induces alkalization in oeCA9-KYSE150 and oeCA9-KYSE410 cells. Detailed Implementation

[0036] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0037] Unless otherwise specified, the technical solutions described in this invention are all conventional solutions in the field, and the reagents or raw materials used are all purchased from commercial channels or are publicly available unless otherwise specified.

[0038] The reagents used in the embodiments of this invention are as follows: Deoxylapachol (DEO) and isorhamnetin were purchased from MCE (MedChemExpress). Fraxin, esculetin, ginsenoside Rg1, phytol, L-menthol, and astragalin were purchased from Shanghai Yuanye Biotechnology Co., Ltd. KYSE150 and KYSE410 cells were purchased from Wuhan Saikang Biotechnology Co., Ltd. CCK-8 reagent was purchased from Baisha Biotechnology Co., Ltd. CA9 antibody was purchased from Wuhan Saikang Biotechnology Co., Ltd. pH probes BCECF-AM and DCFH-DA probe were purchased from Thermo Fisher Scientific.

[0039] Traditional chemotherapy drugs often suffer from severe systemic toxicity due to their lack of tumor selectivity, limiting their clinical application. Carbonic anhydrase 9 (CA9) is specifically highly expressed in esophageal squamous cell carcinoma (ESCC) but expressed at extremely low levels in normal tissues. This characteristic provides an ideal molecular target for developing highly selective antitumor drugs. Based on this, this invention screened and identified a natural small molecule compound that targets CA9. This compound can specifically inhibit CA9 activity, disrupting the "internal base, external acid" pH homeostasis essential for the survival of ESCC tumor cells, leading to excessive alkalization within the cells and selectively inducing alkalosis in tumor cells. Since normal tissues hardly rely on CA9 to maintain pH balance, this strategy can significantly reduce damage to normal tissues while efficiently killing tumors.

[0040] This invention provides a CA9-targeted therapy strategy for ESCC based on a novel mechanism of action (induction of alkalosis). It not only has the potential to overcome the problems of large side effects of traditional chemotherapy, but also provides a potentially safe and effective new option for achieving a wider treatment window and more precise clinical treatment due to its high tumor selectivity.

[0041] Example 1 1. Screening of natural compounds against esophageal squamous cell carcinoma based on the MTT assay The steps are as follows: (1) Cell Culture and Preparation: Cell Line Selection: Select 2-3 representative human esophageal squamous cell carcinoma cell lines (e.g., KYSE-150, Eca-109) to evaluate compound selectivity. Cell Culture: Cells were cultured in a constant temperature and humidity incubator at 37°C and 5% CO2. RPMI-1640 or DMEM complete medium containing 10% fetal bovine serum, 100 U / mL penicillin, and 100 μg / mL streptomycin was used. Cells were routinely passaged every 2-3 days at a ratio of 1:3 to 1:5, and cells in the logarithmic growth phase were used for experiments.

[0042] (2) Preparation of test compound solution: Preparation of mother liquor: Prepare the test solution of the candidate natural small molecule compound (structural formula as shown in the figure) Figure 2 As shown, (purity ≥ 98%), DMSO stock solutions of 10 mM or 20 mM were prepared using high-purity dimethyl sulfoxide. Working solution dilution: On the day of the experiment, the DMSO stock solution was serially diluted with serum-free basal medium to ensure that the final concentration of DMSO in each well did not exceed 0.1%, and a solvent control group with the same DMSO concentration was set up.

[0043] (3) MTT assay procedure: Cell plating: esophageal squamous cell carcinoma cells in logarithmic growth phase were digested, counted, and the cell suspension density was adjusted with complete culture medium. 5 × 10⁶ cells per well. 3 Up to 1×10 4Cells at a density determined in preliminary experiments to ensure that control cells did not reach the plateau phase at the end of the experiment were seeded into 96-well plates with 100 μL of culture medium per well. The 96-well plates were pre-cultured in an incubator for 24 hours to allow cells to fully adhere and enter the exponential growth phase. Compound treatment: The original culture medium was discarded, and 100 μL of fresh complete culture medium containing different concentrations of the test compound was added to each well. At least five replicates were set for each concentration. Concentration gradients were set for deoxylapachol (DEO) (0, 20, 40, 60, 80 μM), isorhamnetin (0, 15, 30, 45, 60 μM), fraxin (0, 15, 30, 60, 90 μM), esculetin (0, 25, 50, 100, 200, 400 μM), and ginsenoside Rg1. Rg1 (0, 100, 200, 400, 800 μM), Phytol (0, 50, 100, 200, 400 μM), L-Menthol (0, 200, 400, 800, 1600 μM), Astragalin (0, 50, 100, 150, 200, 250 μM). Intervention: The DEO stock solution was diluted according to the calculated ratio, and DEO-containing medium was added to each well of a 96-well plate. The plates were then incubated for 24 h. After the predetermined time, 10 μL of MTT solution was carefully added to each well to achieve a final concentration of 0.5 mg / mL. The plates were then incubated in the dark for another 4 h. Carefully aspirate the supernatant, add 100-150 μL of DMSO to each well, and shake on a horizontal shaker at low speed for 10-15 minutes to fully dissolve the purple formazan crystals generated in the cells.

[0044] (4) Data measurement and analysis: OD value determination: First, take out the 96-well plate that has been incubated for 2 hours and put it into the microplate reader to measure the OD value at 450 nm. If the OD value is not within the reference range of the instruction manual, put the plate back into the incubator and continue to incubate for half an hour, and then measure the OD value again.

[0045] Data calculation: Measure the OD value and calculate the ESCC cell viability according to the standard formula.

[0046] Calculate cell viability: Cell viability (%) = [(OD value of drug group - OD value of blank group) / (OD value of solvent control group - OD value of blank group)] × 100% The half-maximal inhibitory concentration (IC50) of this compound against a specific esophageal squamous cell carcinoma line was calculated using a fitted curve. 50 IC value. 50 The smaller the value, the stronger the in vitro antiproliferative activity of the compound.

[0047] The results are as follows: Figure 1 The results show the effects of eight candidate natural small molecule compounds on the proliferation of esophageal squamous cell carcinoma (Eca109 / KYSE150 cells). CCK8 assays revealed that three compounds significantly inhibited the proliferation of esophageal squamous cell carcinoma cells. Compared to the control group, esculetin (Esculetin) significantly inhibited the proliferation of KYSE150 esophageal squamous cell carcinoma cells at 200 μm and 400 μm, phytol (Phytol) significantly inhibited the proliferation of KYSE150 esophageal squamous cell carcinoma cells at 200 μm and 400 μm, and deoxylapachol significantly inhibited the proliferation of both Eca109 and KYSE150 esophageal squamous cell carcinoma cells at 20, 40, 60, and 80 μM. While esculetin and phytol showed inhibitory effects on esophageal squamous cell carcinoma cells, their concentrations were at or above 200 μm; therefore, deoxylapachol was selected as a subsequent candidate compound.

[0048] 2. Validation of natural small molecule targeting CA9 ① The steps for predicting the effect of the natural small molecule compound deoxylabaquinone-DEO on CA9 protein expression using proteomics are as follows: (1) Sample preparation: KYSE-150 cells were evenly seeded in 96-well plates at a density of 8000 cells per well, with 5 replicates per group. A ring of PBS was placed around the outermost well to prevent evaporation of the cell-containing culture medium. Cells were cultured normally in an incubator. After cell adhesion, 40 μM DEO was added for 24 hours. The cells were washed twice with PBS, lysis buffer was added, and the cells were incubated on ice for 15 minutes, followed by sonication in ice water. Protein concentration was quantified using the BCA method. 100 µg of protein was reduced with 5 mM dithiothreitol and alkylated with 15 mM iodoacetamide, followed by trypsin digestion overnight using the FASP method. The resulting peptides were desalted using the C18 StageTip and then lyophilized for later use.

[0049] (2) TMT labeling and fractionation: Equal amounts of peptides were labeled with 10-plex TMT reagent, with a labeling efficiency >99%. All labeled samples were then mixed in equal volumes. The mixed peptides were pre-fractionated using high-pH reversed-phase chromatography and collected into 8 fractions.

[0050] (3) Liquid Chromatography-Mass Spectrometry (LC-MS): Each component was redissolved and separated using an EASY-nLC 1200 nanoliter liquid chromatography system. The chromatographic column was a self-packed C18 reversed-phase column. The separated peptides were analyzed using a Q Exactive HF-X mass spectrometer. The mass spectrometry was run in DDA mode: full scan resolution 120,000, scan range 350-1500 m / z; subsequently, the top 20 precursor ions with the highest intensity were selected for HCD fragmentation and MS2 scan.

[0051] Data Analysis: Raw files were searched using MaxQuant software. The database was UniProt Human. Key search parameters included: precursor ion and mass tolerance of 10 ppm and 0.02 Da, respectively; a maximum of two missed cleavage sites allowed; fixed modifications of TMT labeling and cysteine ​​alkylation; and variable modifications of methionine oxidation and N-terminal acetylation of proteins. False discovery rates for both proteins and peptides were set to 1%. Protein quantification was based on the intensity of the TMT reporter ion, and data were normalized to median. The screening threshold for differentially expressed proteins was a fold change >1.5 and an adjusted p-value <0.05. Enrichment analysis was performed using ClusterProfiler software.

[0052] The experimental results are as follows: like Figure 3 As shown, compared with the esophageal squamous cell carcinoma group, DEO significantly upregulated 306 proteins and downregulated 288 proteins, including downregulating CA9 protein, FDR=0.1425, P value=0.024.

[0053] ② Cellular level validation: Western blot detection of CA9 protein expression The steps are as follows: (1) Sample preparation: Log-phase KYSE-150 and KYSE-410 cell suspensions were seeded into 6-well plates at 2 mL / well and cultured for 24 h. Different final concentrations of DEO (0, 20, 30, 40 μM) were added to the experimental groups, and an equal volume of fresh culture medium was added to the control group. After 24 h of culture, the culture medium was discarded, and the cells were washed twice with 1 mL PBS for later use.

[0054] (2) Extraction of cell proteins: KYSE-150 and KYSE-410 cells from each treatment group were centrifuged, washed with PBS, centrifuged again, and transferred to EP tubes. 80µL of the prepared lysis buffer (RIPA lysis buffer: Cocktail: Protease inhibitor: PMSF = 100:2:2:1) was added. The cells were blown evenly and lysed on ice for 30 min on a shaker. Then, the cells were centrifuged at 12000 rpm and 4℃ for 15 min. The supernatant was collected and a quarter volume of protein loading buffer was added. After mixing, the cells were collected by boiling in a water bath for 10 min and stored at -20℃.

[0055] (3) SDS-PAGE electrophoresis: Place the matching electrophoresis glass plate on the stand, prepare 10% separating gel, add 4.6 mL of separating gel along the plate seam, add water seal gel to press the separating gel together, wait 45 min, pour off the upper layer of water, fill the upper layer with 5% stacking gel, insert the comb vertically, wait 1 h for the gel to solidify, pour in the electrophoresis solution and remove the comb, add the protein sample into the sample well to start electrophoresis, keep the voltage constant at 70V until the sample is pressed together, then adjust the voltage to 120V, stop electrophoresis when the bromophenol blue reaches the bottom.

[0056] (4) Transfer: Immerse the transfer clamp, sponge and transfer filter paper in the transfer solution. First, press repeatedly in one direction to remove air bubbles. Then transfer the run-out gel onto the transfer filter paper. Cover the gel with a PVDF membrane activated by methanol. Close the clamp and place it in the transfer apparatus. The transfer is completed at a constant current of 300mA for 40 minutes. At this time, the protein has been transferred onto the PVDF membrane.

[0057] (5) Immunological reaction: Transfer the PVDF membrane to an incubation box, add 5% skim milk, and place it on a decolorizing shaker for 1 hour with slow shaking. Discard the milk in the incubation box, add the prepared primary antibody, and incubate overnight at 4°C. Wash the membrane 4 times with TBST for 5 minutes each time, then add the secondary antibody diluted with TBST and incubate with slow shaking for 30 minutes. Wash 4 times with TBST for 5 minutes each time.

[0058] (6) Chemiluminescence: Mix ECL luminescent liquid A and liquid B in equal volumes at a ratio of 1:1, then spread the prepared mixture evenly over the PVDF film and place it in an exposure instrument. Adjust the parameters to expose.

[0059] (7) Gel image analysis: The optical density value of the target band was analyzed using ImageJ software for the Western blotting strips obtained by exposure.

[0060] The experimental results are as follows: like Figure 4 As shown, compared with the control group, DEO can reduce CA9 protein expression in KYSE410 and KYSE150 cells in a concentration-dependent manner.

[0061] ③ Molecular docking assessment of the binding energy between CA9 and small molecule active compounds The steps are as follows: (1) Target protein (CA9) structure preparation. Structure acquisition: The crystal structure of CA9 was downloaded from the Protein Database (PDB, https: / / www.rcsb.org / ), PDB ID: 8UFW, a high-resolution (1.22.0 Å) structure containing ligands and highly homologous to human proteins. Pretreatment: Water molecules, existing ligands, and irrelevant ions were removed from the structure using PyMOL. Essential cofactors (such as zinc ions Zn²⁺ and their coordinating histidine residues, which are crucial for CA9 activity) were retained. Hydrogen atoms were added, and charges were calculated.

[0062] (2) Preparation of small molecule ligand (DEO) structure. Obtain the structure: Search for "Deoxylapachol" from PubChem (https: / / pubchem.ncbi.nlm.nih.gov / ) to obtain its 3D structure file (SDF or MOL format). Use Open Babel to minimize energy, optimize the 3D conformation, add Gasteiger charges, and set rotatable bonds (for flexible docking).

[0063] (3) Define the docking box (active site). Based on the position of the native ligand in the CA9 crystal structure or the known active site in the literature, determine the center coordinates (X, Y, Z) and box size (Size X, Y, Z) of the docking. Usually, the zinc ion is the center, and the box size can cover the entire active pocket.

[0064] (4) Perform molecular docking between DEO and CA9, and save the processed target protein as CA9.pdbqt format. Also save the processed small molecule DEO as DEO.pdbqt format (containing charge and rotatable bond information).

[0065] (5) Check the generated docking.log file, which lists the binding free energy (ΔG, in kcal / mol) for each docking conformation. The more negative the binding energy, the more likely the bond is to be stable.

[0066] (6) Interaction visualization and analysis: Use PyMOL software to open the docking result file (DEO_CA9_complex.pdbqt, which can be converted to .pdb format).

[0067] The experimental results are as follows: like Figure 5 As shown, the binding effect between DEO and the key target CA9 was verified through molecular docking, and the stability of the binding between DEO and the key target was determined based on the binding energy. The docking results are as follows. Figure 5As shown in Table 1, DEO can bind to CA9 by forming hydrogen bonds with two amino acids, HIS-64 and MET-1, with a minimum binding energy of −8.8 kcal / mol, which is significantly better than that of small molecule inhibitors (-6 kcal / mol).

[0068] Table 1. Docking scores of DEO and small molecule inhibitors with CA9 molecules

[0069] ④ Molecular dynamics assessment of the binding stability of CA9 with small molecule active compounds The steps are as follows: The crystal structure of the target protein (CA9) and the structure of the small molecule ligand (DEO) were prepared in advance, and molecular dynamics simulations were performed using Gromacs 2022. Force field parameters were obtained using the pdb2gmx tool in Gromacs and the AutoFF webpage. During the simulation, the molecular parameters of the receptor protein were calculated using the amber14sb force field, and the molecular parameters of the ligand were calculated using the GAFF2 force field. A 1 nm TIP3P cubic water box was added around the system for solvation. Ions were added to the system using the gmx genion tool to achieve electroneutrality. Long-range electrostatic interactions were handled using the Particle Mesh Ewald (PME) method with a cutoff distance of 1 nm. All bond constraints were performed using the SHAKE algorithm, and the Verlet frog-leap algorithm was used to set the integration step size to 1 fs during the molecular dynamics simulation. The system underwent energy optimization before the molecular dynamics simulation. The energy minimization process included 3000 steps of steepest descent optimization followed by 2000 steps of conjugate gradient optimization. The optimization steps are as follows: First, constrain the solute and minimize the energy of water molecules; then constrain the counter ions and minimize their energy; finally, minimize the energy of the entire system under unconstrained conditions. The simulation was conducted on an NPT system at a temperature of 310 K and constant pressure for 100 ns. During the simulation, the root mean square deviation (RMSD), root mean square fluctuation (RMSF), radius of gyration (Rg), and solvent accessible surface area (SASA) were calculated using the g-rmsd, g-rmsf, ​​g-Rg, and g-sasa tools, respectively.

[0070] The experimental results are as follows: Root mean square deviation (RMSD) is a good indicator of conformational stability of proteins and ligands, and also measures the degree of deviation of atomic positions from their initial positions. The smaller the deviation, the better the conformational stability. Therefore, RMSD was used to evaluate the balance of the simulation system. Figure 6As shown in Figure A, the DEO-CA9 system exhibits fluctuations during its movement, reaching equilibrium after 90 ns, and ultimately fluctuating around 1.7 Å. Therefore, this small molecule demonstrates high stability when binding to the target protein.

[0071] The radius of gyration (Rg) can be used to describe changes in the overall structure and characterize the tightness of the protein structure. The complex exhibits relatively stable fluctuations during movement. This indicates that the DEO small molecule-CA9 target protein complex did not undergo significant expansion or contraction during movement. Figure 6 (B)

[0072] Solvent-accessible surface area (SASA) is an indicator for assessing protein surface area. This simulation calculated the solvent-accessible surface area between the target protein and the small molecule. Figure 6 The results showed that after the receptor and ligand bound, the SASA of DEO-CA9 did not change significantly, indicating that the binding of the ligand had little effect on the protein structure.

[0073] Hydrogen bonds play a crucial role in the binding of ligands to proteins. The number of hydrogen bonds between small molecules and target proteins during kinetic processes is as follows: Figure 6 As shown in Figure D, the number of hydrogen bonds between the small molecule and the target protein ranges from 0 to 2, with the complex having approximately 1 hydrogen bond in most cases. This indicates that the ligand has a good hydrogen bond interaction with the target protein (DEO-CA9).

[0074] Root mean square fuctuation (RMSF) can represent the flexibility of amino acid residues in a protein. For example... Figure 6 As shown in Figure E, the RMSF value of this DEO-CA9 complex is relatively low (mostly below 3 Å), indicating lower flexibility but higher stability. In summary, the DEO-CA9 complex system exhibits stable binding and good hydrogen bonding. Therefore, the small molecule binds well to the target protein.

[0075] ⑤ GEAST verification of the stability of CA9 binding to small molecule active compounds The steps are as follows: (1) Cell culture and drug treatment: Culture a sufficient number of KYSE-150 and KYSE-410 cells in culture dishes or flasks (1×10⁻⁶ cells per temperature point). 8 (Cells). When the cell density reaches approximately 80%, replace with fresh culture medium and add DEO or the control compound (DMSO). Ensure that the final DMSO concentration is consistent across all treatment groups (usually ≤0.1%). Return the cells to the incubator and incubate at 37°C and 5% CO2 for the predetermined time (e.g., 2 hours).

[0076] (2) Preparation of cell lysis buffer: After incubation, gently wash the cells twice with pre-chilled PBS. Collect the cells using a cell scraper or trypsin digestion, place them in a pre-chilled centrifuge tube, and centrifuge at 1000 rpm for 5 minutes at 4°C to collect the cell pellet. Discard the supernatant, resuspend the cells once with pre-chilled PBS, centrifuge again, and discard the PBS completely. Add an appropriate amount of pre-chilled lysis buffer (e.g., per 1×10⁻⁶ cells) according to the amount of cell pellet. 6 Add 100 μL of cells. Incubate on ice for 15-30 minutes, gently vortexing several times during incubation. Centrifuge at 14000-20000 g for 15 minutes at 4°C. Key step: Carefully transfer the supernatant (i.e., cell lysis buffer) to a new pre-chilled centrifuge tube. Place on ice and immediately proceed to the next heating experiment. At this point, a small amount of lysis buffer can be used to determine protein concentration to ensure consistency across samples.

[0077] (3) Thermal denaturation treatment (core step): Divide the cell lysis buffer into multiple portions (approximately 20-50 μL each) and place them into PCR tubes or thin-walled centrifuge tubes. Using a PCR instrument or a precisely temperature-controlled metal bath, heat each sample tube at different preset temperatures (e.g., 37, 42, 47, 52, 57, 62, 67℃) for 3 minutes. Note: The heating time must be strictly uniform. After heating, immediately transfer the sample tubes to ice and cool for at least 3 minutes to terminate the thermal denaturation process. Control group: Set up one group of samples always kept at 4℃ (without heating) as the total protein control; another group is heated at the highest temperature (e.g., 65℃) as the negative control.

[0078] (4) Precipitation of insoluble proteins and sample preparation: Centrifuge the cooled sample at 20,000 g for 15-20 minutes at 4°C. Carefully aspirate the supernatant (soluble protein fraction) into a new pre-chilled centrifuge tube. Add 4X protein loading buffer to the supernatant and mix thoroughly. Heat the sample at 95°C - 100°C for 5-10 minutes to denature the proteins.

[0079] (5) Detection and analysis, Western Blot: Perform SDS-PAGE electrophoresis on all prepared samples. Transfer to PVDF or NC membrane. Block with 5% skim milk or BSA at room temperature for 1 hour. Incubate overnight at 4°C with primary antibody against CA9. After washing, incubate with the corresponding secondary antibody at room temperature for 1 hour. Develop with ECL chemiluminescence.

[0080] (6) Data Analysis: ImageJ and other software were used to perform grayscale analysis on the Western Blot bands. For each temperature point, the ratio of the CA9 band signal intensity to the corresponding internal control protein band signal intensity was calculated. The signal ratios of the DMSO control group and the DEO treatment group at each temperature point were normalized (usually the signal ratio of the unheated sample at 4℃ was 100%). The protein thermal stability curve (thermal migration curve) was plotted with temperature as the x-axis and the normalized relative protein amount as the y-axis.

[0081] The experimental results are as follows: like Figure 7 As shown, with increasing temperature (37, 42, 47, 52, 57, 62, 67℃), DEO can reduce CA9 protein expression over time, indicating that DEO has a stable binding with CA9.

[0082] ⑥ Lentiviral construction of esophageal squamous cell carcinoma cell lines with knockdown of shCA9 and overexpression of oeCA9 The steps are as follows: Virus construction and preparation: Construction of human CA9 gene shRNA lentiviral vector: hRNA1:GGAGGATCTACCTGAAGTTAATTCAAGAGATTAACTTCAGGTAGATCCTCCTTTTTT shRNA2:GCTGTCTCGCTTGGAAGAAATTTCAAGAGAATTTCTTCCAAGCGAGACAGCTTTTTT shRNA3:AGGTCCCAGGACTGGACATATTTCAAGAGAATATGTCCAGTCCTGGGACCTTTTTTTT Construction of human CA9 gene overexpression vector for oeCA9: 5' sequencing primer: GTGCAGGGGAAAGAATAGTAG 3' sequencing primers: CTAATGACCCCGTAATTG The experimental results are as follows: Construct KYSE150 and KYSE410 cell lines that overexpress CA9 (oeCA9) and knockdown (shCA9). (1) Plating and grouping: 6 × 10³ KYSE150 and KYSE410 cells were seeded in each well of a 96-well plate, maintaining a 100 μL culture medium system. The seeding density was adjusted according to the cell growth rate to ensure that the confluence at infection reached 40%~60%. Two experimental groups (±Polybrene) were set up, with MOI gradients (0, 10, 20, 40, 80, 100) in each group, and 3 replicates for each gradient.

[0083] (2) Lentiviral infection: Calculate the amount of virus used according to the formula: Virus volume (μL) = MOI × number of cells / virus titer × 10³. Thaw the lentivirus stored at -80℃ in an ice bath, remove the cell supernatant before infection, add the corresponding MOI virus solution and add culture medium to 100 μL. Add 5 μg / mL polybrene to the designated experimental group, mix well and continue culturing.

[0084] (3) Monitoring the effect after infection: Observe the changes in cell morphology 8-12 hours after infection. If there is no significant difference, continue culturing until 24 hours and change the medium. Observe the expression of fluorescent protein under a fluorescence microscope 72-96 hours later. For cells with slow growth, the observation period can be extended and the medium can be changed appropriately.

[0085] (4) Control group cell culture: Uninfected cells were cultured in 6 cm culture dishes until 80%~90% confluence, washed twice with PBS, and then 3 mL of medium containing 10% FBS was added to digest and disperse into a single cell suspension.

[0086] (5) Puromycin sensitivity assay: Cells were incubated at 2-5 × 10⁻⁶ cells / day. 5 Seeds were planted at a density of 0.5 μg / mL in 12-well or 6-well plates and incubated at 37°C with 5% CO2 for 24 hours. Preliminary experiments were conducted using a puromycin concentration gradient of 0, 1, 2, 3, and 5 μg / mL, maintaining the drug concentration with medium changes every other day. The lowest puromycin concentration that completely killed uninfected cells was selected as the screening concentration, and the effect was confirmed by continuous observation for 4 days. Finally, fluorescence imaging was used to determine the transfection rate. (6) Western Blot detection of CA9 protein expression: All prepared samples were subjected to SDS-PAGE electrophoresis. Transferred to PVDF or NC membranes. Blocked with 5% skim milk or BSA at room temperature for 1 hour. Incubated overnight at 4°C with primary antibody against CA9. After washing, incubated with the corresponding secondary antibody at room temperature for 1 hour. Developed using ECL chemiluminescence.

[0087] The experimental results are as follows: KYSE-150 and KYSE-410 cell lines were infected with lentiviruses. Stable CA9-interfering cell lines (shCA9 and oeCA9) were selected using puromycin. Fluorescence intensity was observed under a microscope to determine the optimal infection conditions (Multiplicity of infection number / cell, MOI). Results are as follows: Figures 10-11 As shown, compared with the control group, the fluorescence intensity was strongest after transfection with 100 MOI, so 100 MOI was selected to construct a stable cell line.

[0088] ⑦ Validation of CA9 protein expression using lentivirus combined with DEO The steps are as follows: (1) Sample preparation: Log-phase KYSE-150 and KYSE-410 cell suspensions were seeded into 6-well plates at 2 mL / well and cultured for 24 h. Different final concentrations of DEO (0, 20, 30, 40 μM) were added to the experimental groups, and an equal volume of fresh culture medium was added to the control group. After 24 h of culture, the culture medium was discarded, and the cells were washed twice with 1 mL PBS for later use.

[0089] (2) Extraction of cell proteins: KYSE-150 and KYSE-410 cells from each treatment group were centrifuged, washed with PBS, centrifuged again, and transferred to EP tubes. 80µL of the prepared lysis buffer (RIPA lysis buffer: Cocktail: Protease inhibitor: PMSF = 100:2:2:1) was added. The cells were blown evenly and lysed on ice for 30 min on a shaker. Then, the cells were centrifuged at 12000 rpm and 4℃ for 15 min. The supernatant was collected and a quarter volume of protein loading buffer was added. After mixing, the cells were collected by boiling in a water bath for 10 min and stored at -20℃.

[0090] (3) SDS-PAGE electrophoresis: Place the matching electrophoresis glass plate on the stand, prepare 10% separating gel, add 4.6 mL of separating gel along the plate seam, add water seal gel to press the separating gel together, wait 45 min, pour off the upper layer of water, fill the upper layer with 5% stacking gel, insert the comb vertically, wait 1 h for the gel to solidify, pour in the electrophoresis solution and remove the comb, add the protein sample into the sample well to start electrophoresis, keep the voltage constant at 70V until the sample is pressed together, then adjust the voltage to 120V, stop electrophoresis when the bromophenol blue reaches the bottom.

[0091] (4) Transfer: Immerse the transfer clamp, sponge and transfer filter paper in the transfer solution. First, press repeatedly in one direction to remove air bubbles. Then transfer the run-out gel onto the transfer filter paper. Cover the gel with a PVDF membrane activated by methanol. Close the clamp and place it in the transfer apparatus. The transfer is completed at a constant current of 300mA for 40 minutes. At this time, the protein has been transferred onto the PVDF membrane.

[0092] (5) Immunological reaction: Transfer the PVDF membrane to an incubation box, add 5% skim milk, and place it on a decolorizing shaker for 1 hour with slow shaking. Discard the milk in the incubation box, add the prepared primary antibody, and incubate overnight at 4°C. Wash the membrane 4 times with TBST for 5 minutes each time, then add the secondary antibody diluted with TBST and incubate with slow shaking for 30 minutes. Wash 4 times with TBST for 5 minutes each time.

[0093] (6) Chemiluminescence: Mix ECL luminescent liquid A and liquid B in equal volumes at a ratio of 1:1, then spread the prepared mixture evenly over the PVDF film and place it in an exposure instrument. Adjust the parameters to expose.

[0094] (7) Gel image analysis: The optical density value of the target band was analyzed using ImageJ software for the Western blotting strips obtained by exposure.

[0095] The experimental results are as follows: Western blot analysis was used to detect the effect of DEO on CA9 protein expression in oeCA9-KYSE-150 and oeCA9-KYSE-410 cell lines. Western blot results ( Figure 12 The results showed that, compared with the oeNC group, CA9 protein expression was significantly reduced after DEO administration. Compared with oeCA9-KYSE-150 and oeCA9-KYSE-410, the inhibitory effect of DEO on CA9 protein expression was significantly reversed.

[0096] Western blot analysis was used to detect the effect of DEO on CA9 protein expression in shCA9-KYSE-150 and shCA9-KYSE-410 cell lines. Western blot results ( Figure 13 The results showed that, compared with the shNC group, the expression of CA9 protein in the shCA9, shNC+DEO and shCA9+DEO groups was inhibited after DEO administration.

[0097] 3. In vitro efficacy of natural small molecule compounds against esophageal squamous cell carcinoma ① CCK8 assay to observe the in vitro proliferation ability of esophageal squamous cell carcinoma cells The specific steps are as follows: (1) Cell preparation: Take KYSE-150 and KYSE-410 cells and evenly spread them in a six-well plate at a density of 2000 cells per well. Culture the cells normally in an incubator.

[0098] (2) DEO intervention: Dilute the DEO stock solution according to the formula (0, 5, 10, 20, 30, 40, 50 μM), add DEO-containing medium to each well of a 6-well plate, and continue to incubate for 24 h.

[0099] (3) Culture medium change: After culturing for 24 h, wash with PBS 2-3 times and then replace with normal culture medium. Observe the cell status and density under a microscope every day and change the medium on the plate every 3 days.

[0100] (4) Fixation and staining: When the cell colony density is 50-60%, take out the 6-well plate, fix the cells with 4% paraformaldehyde and then stain with 0.1% crystal violet for 15 minutes.

[0101] (5) Photographing the results: Observe and photograph the staining results and compile statistics.

[0102] Experimental results are as follows Figure 14 As shown, by Figure 14It can be seen that the cell activity of KYSE-150 and KYSE-410 cells was inhibited in a concentration-dependent manner with increasing DEO drug concentration, indicating that DEO can significantly inhibit the proliferation of the two types of esophageal squamous cell carcinoma cells.

[0103] ② Detection method for cell cycle arrest effect of natural small molecule compounds on esophageal squamous cell carcinoma cells based on flow cytometry (1) Cell preparation and intervention: KYSE-150 and KYSE-410 cells were evenly seeded in six-well plates at a density of 2000 cells per well and cultured normally in an incubator. The DEO stock solution was diluted according to the calculated ratio (0, 20, 30, 40 μM), and DEO-containing medium was added to each well of the six-well plate. The plates were then incubated for another 24 h.

[0104] (2) Cell collection: After processing, carefully collect the supernatant culture medium from each well into the corresponding centrifuge tube (containing detached cells). Gently wash the adherent cells once with PBS and collect the wash solution into the corresponding centrifuge tube. Add an appropriate amount of EDTA-free trypsin to each well for digestion. Once the cells become rounded, add an equal volume of serum-containing culture medium to stop digestion and repeatedly pipette to completely detach the cells. Combine all cell suspensions (supernatant, wash solution, and digestion solution) into the same centrifuge tube, centrifuge at 1000 rpm for 5 minutes, and discard the supernatant.

[0105] (3) Cell fixation: Gently resuspend the cell pellet in pre-chilled PBS, and centrifuge and wash once more, discarding the supernatant. Key step: While vortexing at low speed, slowly add 1 mL of pre-chilled 70% ice-cold ethanol dropwise to the cell pellet (vortexing continuously to prevent cell clumping). Place the fixed cell suspension in a -20°C freezer overnight (at least 4 hours). The fixed sample can be stored at -20°C for one week.

[0106] (4) Staining and Flow Cytometry: Sample Preparation: Remove the fixed cells, centrifuge at 1500 rpm for 5 minutes, and carefully discard the ethanol. Washing: Resuspend the cells in 1 mL of pre-cooled PBS, centrifuge and discard the supernatant, repeat once to thoroughly remove residual ethanol. RNase Digestion: Add 500 μL of PBS solution containing RNase A (50 μg / mL) to the cell pellet, gently pipette to resuspend, and incubate in a 37°C water bath in the dark for 30 minutes to degrade RNA and avoid PI binding to RNA interfering with the results. PI Staining: After incubation, add propidium iodide staining solution to each sample tube to make the final PI concentration 50 μg / mL. After mixing by pipetting, stain in a 4°C refrigerator in the dark for 30 minutes. Filtration and Flow Cytometry: Before flow cytometry, filter the sample through a 300-mesh (or 40 μm) cell sieve to remove possible cell clumps. Flow Cytometry Detection: Use a flow cytometer for detection. The excitation wavelength was set to 488 nm, and the fluorescence emission of the PI was detected (typically using the FL2 or PE channel, approximately 575 nm). At least 1 × 10⁻⁶ samples were collected from each tube. 4 Each cell.

[0107] (5) Data analysis and result determination: Data acquisition: Data is collected using flow cytometer software (such as FlowJo, ModFitLT).

[0108] Gating and parameter setting: The target cell population was circled in the FSC-A / SSC-A scatter plot to exclude debris and aggregates. Adhesive bodies were further excluded using the FL2-A / FL2-W scatter plot. Cell cycle fitting analysis: Cell cycle fitting analysis was performed on the PI fluorescence intensity histogram (FL2-A). The software fitted the distribution ratios of the three peaks in G0 / G1, S, and G2 / M phases. Result calculation and expression: The mean ± standard deviation of the cell percentages at each time point in the experimental and control groups were calculated. Statistical analysis: Differences between groups were compared using t-tests or one-way ANOVA. P A value <0.05 was considered statistically significant. Activity assessment: If, compared to the solvent control group, the percentage of cells in G0 / G1 phase significantly increased, and the number of cells in S and G2 / M phases decreased, then the compound was considered to have arrested cells in G0 / G1 phase. If the percentage of cells in G2 / M phase significantly increased, then G2 / M phase arrest was determined. If the percentage of cells in S phase significantly increased, then S phase arrest was determined. Experimental results are as follows: like Figure 15 As shown, compared with the control group, the proportion of S phase cells increased in both KYSE-150 and KYSE-410 cell lines after 24 h of DEO treatment. P <0.05 or P<0.01). DEO may effectively inhibit the proliferation of KYSE-150 and KYSE-410 cells by interfering with the synthesis of DNA replication-related proteins and disrupting the normal cell cycle progression from G1 to S phase.

[0109] ③ Western blotting (WB) was used to detect the effect of DEO on cyclin expression in esophageal squamous cell carcinoma. The steps are as follows: (1) Sample preparation: Log-phase KYSE-150 and KYSE-410 cell suspensions were seeded into 6-well plates at 2 mL / well and cultured for 24 h. Different final concentrations of DEO (0, 20, 30, 40 μM) were added to the experimental groups, and an equal volume of fresh culture medium was added to the control group. After 24 h of culture, the culture medium was discarded, and the cells were washed twice with 1 mL PBS for later use.

[0110] (2) Extraction of cell proteins: KYSE-150 and KYSE-410 cells from each treatment group were centrifuged, washed with PBS, centrifuged again, and transferred to EP tubes. 80µL of the prepared lysis buffer (RIPA lysis buffer: Cocktail: Protease inhibitor: PMSF = 100:2:2:1) was added. The cells were blown evenly and lysed on ice for 30 min on a shaker. Then, the cells were centrifuged at 12000 rpm and 4℃ for 15 min. The supernatant was collected and a quarter volume of protein loading buffer was added. After mixing, the cells were collected by boiling in a water bath for 10 min and stored at -20℃.

[0111] (3) SDS-PAGE electrophoresis: Place the matching electrophoresis glass plate on the stand, prepare 10% separating gel, add 4.6 mL of separating gel along the plate seam, add water seal gel to press the separating gel together, wait 45 min, pour off the upper layer of water, fill the upper layer with 5% stacking gel, insert the comb vertically, wait 1 h for the gel to solidify, pour in the electrophoresis solution and remove the comb, add the protein sample into the sample well to start electrophoresis, keep the voltage constant at 70V until the sample is pressed together, then adjust the voltage to 120V, stop electrophoresis when the bromophenol blue reaches the bottom.

[0112] (4) Transfer: Immerse the transfer clamp, sponge and transfer filter paper in the transfer solution. First, press repeatedly in one direction to remove air bubbles. Then transfer the run-out gel onto the transfer filter paper. Cover the gel with a PVDF membrane activated by methanol. Close the clamp and place it in the transfer apparatus. The transfer is completed at a constant current of 300mA for 40 minutes. At this time, the protein has been transferred onto the PVDF membrane.

[0113] (5) Immunological reaction: Transfer the PVDF membrane to an incubation box, add 5% skim milk, and place it on a decolorizing shaker for 1 hour with slow shaking. Discard the milk in the incubation box, add the prepared primary antibody, and incubate overnight at 4°C. Wash the membrane 4 times with TBST for 5 minutes each time, then add the secondary antibody diluted with TBST and incubate with slow shaking for 30 minutes. Wash 4 times with TBST for 5 minutes each time.

[0114] (6) Chemiluminescence: Mix ECL luminescent liquid A and liquid B in equal volumes at a ratio of 1:1, then spread the prepared mixture evenly over the PVDF film and place it in an exposure instrument. Adjust the parameters to expose.

[0115] (7) Gel image analysis: The optical density value of the target band was analyzed using ImageJ software for the Western blotting strips obtained by exposure.

[0116] The experimental results are as follows: like Figure 16 As shown, the protein expression levels of Cyclin A1 and CDK2, key regulators of S phase, in KYSE-150 and KYSE-410 cells treated with different concentrations of DEO for 24 hours were quantitatively analyzed by Western blotting. The immunoblotting results showed that, compared to the untreated control group, the protein expression of Cyclin A1 and CDK2 in both cell lines decreased in a dose-dependent manner. P <0.05 or P <0.01). The above results demonstrate that DEO effectively induces cell cycle arrest in the S phase by inhibiting the expression of cyclins related to the S phase process, thereby exerting an anti-proliferative effect on esophageal squamous cell carcinoma cells.

[0117] 4. DEO-targeted inhibition of CA9-induced basal cell death in esophageal squamous cell carcinoma cells ① pH probe to detect cytoplasmic pH The steps are as follows: (1) Cell culture and intervention: KYSE150 and KYSE410 cells were digested and counted. For microplate reader detection: cells were cultured at 1-2 × 10⁻⁶ cells / mL. 4 Seeds were placed at a density of cells / well in 96-well black transparent plates with 100 μL of complete culture medium per well. Sufficient replicates were provided (at least 3-5 replicates per group). For microscopic imaging: Cells were seeded at an appropriate density in glass-bottomed culture dishes. Cells were then returned to the incubator and cultured for 16-24 hours to allow them to adhere and enter the logarithmic growth phase.

[0118] (2) Preparation of probe working solution: Before the experiment, remove the BCECF-AM stock solution and thaw it at room temperature in the dark. Dilute BCECF-AM to a working concentration of 2-5 μM using pre-warmed, serum- and phenol red-free HBSS or basal medium. Note: The working solution should be prepared fresh before use. Washing cells: Aspirate the medium from the 96-well plate and gently wash the cells twice with pre-warmed HBSS to remove esterases from the serum.

[0119] (3) Probe loading: Add 100 μL of prepared BCECF-AM working solution to each well. Place the cell plate in a 37℃, 5% CO2 incubator and incubate in the dark for 20-30 minutes. Remove excess probe: After incubation, aspirate the probe working solution. Wash the cells thoroughly three times with preheated HBSS or basal medium to remove any extracellular BCECF-AM that has not entered the cells. (4) Equilibration: Finally, add 100 μL of fresh, preheated HBSS (without probe) to each well, put the cell plate back into the incubator and equilibrate for 15-20 minutes to allow the intracellular esterase to fully hydrolyze AM ester and stabilize the fluorescence signal.

[0120] (5) Fluorescence detection: Excitation wavelength: set to 490 nm (pH sensitive) and 440 nm (pH insensitive, used as internal reference), respectively. Emission wavelength: set to 535 nm. Gain: manually set according to the fluorescence value of the negative control well to keep the signal in the upper-middle part of the linear range and avoid saturation. Temperature: set to 37℃.

[0121] Read fluorescence values: Place the 96-well plate into the microplate reader and start reading immediately. Record the fluorescence intensity (RFU) of each well at Ex490 / Em535 and Ex440 / Em535, respectively. Calculate the ratio: For each well, calculate Ratio = RFU(490nm) / RFU(440nm). This ratio is positively correlated with intracellular pH.

[0122] Experimental results are as follows Figure 17 As shown: Changes in cytoplasmic pH in KYSE150 and KYSE410 cells were detected using the BCECF-AM fluorescent probe. Compared to the control, DEO-induced concentration-dependent increases in intracellular fluorescence intensity indicated that DEO-induced concentration-dependent promotion of cytoplasmic alkalization.

[0123] ② Observation of the effects of natural small molecule compounds on the ultrastructure of esophageal squamous cell carcinoma cells using transmission electron microscopy The steps are as follows: (1) Experimental preparation Cells and Treatment: Cell lines: Human esophageal squamous cell carcinoma cells (KYSE-150, KYSE410). DEO treatment: Logarithmic growth phase cells were harvested and treated with IC50. 50Treat the test compound at the specified concentration for 24-48 hours. Set up a solvent control group (containing an equal volume of DMSO). Main reagents: Fixative: 2.5% glutaraldehyde (prepared with 0.1 M phosphate buffer, pH 7.4), 1% osmium tetroxide. Dehydrating agents: graded ethanol (30%, 50%, 70%, 80%, 90%, 95%, 100%), acetone. Embedding medium: epoxy resin (e.g., Epon 812) embedding kit. Staining agents: uranyl acetate (uranium stain), lead citrate (lead stain). Others: 0.1 M phosphate buffer, propylene oxide. Instruments and equipment: transmission electron microscope, ultramicrotome, scalpel maker, copper mesh, constant temperature oven.

[0124] (2) Cell collection and initial fixation: Gently scrape off the treated cells with a cell scraper (avoiding trypsin digestion from damaging the membrane structure). Transfer the cell suspension to a centrifuge tube and centrifuge at 1000 rpm for 10 minutes to form cell clumps. Carefully aspirate the supernatant and slowly add pre-cooled 2.5% glutaraldehyde fixative along the tube wall. Fix at 4°C for 4 hours or overnight.

[0125] (3) Rinsing: Rinse the cell clumps three times with 0.1 M phosphate buffer (pH 7.4) for 15 minutes each time to remove residual glutaraldehyde. Post-fixation: Add 1% osmium tetroxide fixative and fix at 4°C in the dark for 1-2 hours. Osmium tetroxide can fix lipids and enhance the contrast of membrane structure.

[0126] (4) Dehydration: After rinsing three times with phosphate buffer, perform gradient dehydration: dehydrate with 30%, 50%, 70%, 80%, 90%, and 95% ethanol for 15 minutes each. Then dehydrate twice with 100% ethanol for 20 minutes each time. Transfer to 100% acetone for 20 minutes to replace the ethanol.

[0127] (5) Infiltration and embedding: Infiltration: Place the cell clumps in a 1:1 mixture of acetone and epoxy resin embedding agent and infiltrate at room temperature for 2-4 hours. Then transfer them to pure embedding agent and infiltrate overnight at room temperature or 37°C. Embedding: Place the fully infiltrated cell clumps into an embedding plate filled with fresh embedding agent and adjust their position. (6) Polymerization: Place in a 60℃ constant temperature oven for 48 hours to polymerize and allow the resin to harden completely.

[0128] Ultrathin sectioning: Trim the embedding block into small pyramidal regions using an ultramicrotome. Cut ultrathin sections with a thickness of approximately 60-80 nm using a glass or diamond scalpel. Retrieve the sections using a copper mesh coated with a support film.

[0129] (7) Uranium staining: Place the copper mesh containing the slices in uranyl acetate staining solution and stain at room temperature in the dark for 20-30 minutes, then rinse thoroughly with double-distilled water.

[0130] (8) Electron microscopy observation and image acquisition: Place the stained copper mesh into the transmission electron microscope sample holder. Observation and calibration: At an accelerating voltage of 80-100 kV, first perform low-magnification positioning, then high-magnification observation. Image acquisition: Systematically observe the cells of the control group and the treatment group, focusing on the following ultrastructures, and acquire typical images at the same magnification (e.g., ×5000, ×30000).

[0131] (9) Results Analysis and Judgment: By comparing the ultrastructural differences between the control group and the treatment group, the cell death or stress pattern was determined: Alkaline death: Manifestations: A large number of transparent vacuoles of varying sizes appear in the cells. These vacuoles mainly originate from swollen organelles, especially mitochondria and endoplasmic reticulum. This is significantly different from the cytoplasmic shrinkage of apoptosis and the edema of necrosis, but with fewer vacuoles. Extreme swelling: The volume of mitochondria increases significantly, the matrix becomes thin, and the structure of the transparent cristae is destroyed: the inner membrane folds (crista) decrease, break, or even disappear, presenting a "balloon-like" change. In the later stage of death, the swollen cell membrane eventually ruptures, and the contents are released, similar to necrosis.

[0132] The experimental results are as follows: Observation and image analysis were performed using a transmission electron microscope. The mitochondrial morphology of KYSE140 and KYSE150 cells was observed under a transmission electron microscope, such as... Figures 18-19 The results showed that, compared with the control group, KYSE140 and KYSE150 cells in the DEO (30 μM) group exhibited alkalosis morphology. Mitochondria were extremely swollen: mitochondrial volume was significantly increased, the matrix became thinner, and cristae structure was disrupted: inner membrane folds (cristises) decreased, broke, or even disappeared, presenting a "balloon-like" change.

[0133] ③ Effect of DEO on ROS content in esophageal squamous cell carcinoma cells The steps are as follows: (1) Cell spread: Use a 6-well plate or small dish to spread cells. Seed an appropriate amount of KYSE-150 and KYSE-410 cells on a coverslip (density of about 40%) and culture the cells normally in an incubator.

[0134] (2) DEO intervention: Dilute the DEO stock solution according to the calculated ratio (20, 30, 40 μM), add DEO-containing medium, and incubate for 24 h.

[0135] (3) Dilute probe concentration: Dilute CM-H2DCFDA with extracellular fluid (CO216) at a ratio of 1:1000 or with appropriate solutions such as PBS or HBSS as appropriate, to a final concentration of 5 µM.

[0136] (4) Probe incubation: Discard the culture medium, add 1 ml of CM-H2DCFDA, and incubate in a 37ºC cell culture incubator for 30 minutes. Wash 2-3 times with PBS solution.

[0137] (5) Photographic Statistics: Observation was performed using a fluorescence microscope. The intensity of fluorescence was observed and recorded by using an excitation wavelength of 495 nm and an emission wavelength of 530 nm. Changes in fluorescence color and intensity were recorded.

[0138] Experimental results are as follows Figure 20 As shown: DCFH-DA (2',7'-dichlorodihydrofluorescein diacetate) is a ROS-sensitive fluorescent probe widely used for the quantitative detection of cellular oxidative stress levels. After diffusion into cells, this compound undergoes deacetylase catalysis to generate the non-fluorescent precursor DCFH. The latter is oxidized to the highly fluorescent substance DCF in the presence of ROS, and its fluorescence signal intensity is linearly positively correlated with the intracellular ROS concentration. DCFH-DA probe detection results show that, compared with the control group, DEO intervention at different concentrations significantly increased the generation of reactive oxygen species in KYSE-150 and KYSE-410 cells, resulting in a significant enhancement of green fluorescence in the cells. P <0.05 or P <0.01), indicating that DEO can induce ROS generation in KYSE-150 and KYSE-410 cells in a concentration-dependent manner.

[0139] 5. DEO combined with lentiviral knockdown and overexpression of CA9 to verify basophilic death. ① Plate clone experiment to observe the in vitro proliferation ability of esophageal squamous cell carcinoma cells The steps are as follows: (1) Cell preparation: Take KYSE-150 and KYSE-410 cells and evenly spread them in a six-well plate at a density of 2000 cells per well. Culture the cells normally in an incubator.

[0140] (2) DEO intervention: Dilute the DEO stock solution according to the formula (0, 5, 10, 20, 30, 40, 50 μM), add DEO-containing medium to each well of a 6-well plate, and continue to incubate for 24 h.

[0141] (3) Culture medium change: After culturing for 24 h, wash with PBS 2-3 times and then replace with normal culture medium. Observe the cell status and density under a microscope every day and change the medium on the plate every 3 days.

[0142] (4) Fixation and staining: When the cell colony density is 50-60%, take out the 6-well plate, fix the cells with 4% paraformaldehyde and then stain with 0.1% crystal violet for 15 minutes.

[0143] (5) Photographing the results: Observe and photograph the staining results and compile statistics.

[0144] The experimental results are as follows: The effects of DEO on the colony-forming ability of shCA9-KYSE-150 and shCA9-KYSE-410 cell lines were observed using a plate colony-forming assay. Figures 21-22 As shown, compared with the shNC group, the number of cell colonies in the shCA9, shNC+DEO, and shCA9+DEO groups was significantly reduced. The results indicate that DEO can inhibit the colony formation ability of shCA9-KYSE-150 and shCA9-KYSE-410 cells. Furthermore, compared with the oeNC group, DEO significantly reduced the number of cell colonies. Compared with the oeCA9+DEO group, oeCA9 significantly increased the ability to form cell colonies.

[0145] ②DEO-targeted inhibition of CA9-induced basalization of esophageal squamous cell carcinoma cells (1) Cell culture and intervention: KYSE150 and KYSE410 cells transfected with lentivirus were digested and counted. For ELISA reader detection: cells were cultured at 1-2 × 10⁻⁶ cells / year. 4 Seeds were placed at a density of cells / well in 96-well black transparent plates with 100 μL of complete culture medium per well. Sufficient replicates were provided (at least 3-5 replicates per group). For microscopic imaging: Cells were seeded at an appropriate density in glass-bottomed culture dishes. Cells were then returned to the incubator and cultured for 16-24 hours to allow them to adhere and enter the logarithmic growth phase.

[0146] (2) Preparation of probe working solution: Before the experiment, remove the BCECF-AM stock solution and thaw it at room temperature in the dark. Dilute BCECF-AM to a working concentration of 2-5 μM using pre-warmed, serum- and phenol red-free HBSS or basal medium. Note: The working solution should be prepared fresh before use. Washing cells: Aspirate the medium from the 96-well plate and gently wash the cells twice with pre-warmed HBSS to remove esterases from the serum.

[0147] (3) Loading probes: Add 100 μL of the prepared BCECF-AM working solution to each well. Place the cell plate in a 37℃, 5% CO2 incubator and incubate in the dark for 20-30 minutes. Remove excess probes: After incubation, aspirate the probe working solution. Wash the cells thoroughly three times with preheated HBSS or basal medium to remove extracellular BCECF-AM that has not entered the cells.

[0148] (4) Equilibration: Finally, add 100 μL of fresh, preheated HBSS (without probe) to each well, put the cell plate back into the incubator and equilibrate for 15-20 minutes to allow the intracellular esterase to fully hydrolyze AM ester and stabilize the fluorescence signal.

[0149] (5) Fluorescence detection: Excitation wavelength: set to 490 nm (pH sensitive) and 440 nm (pH insensitive, used as internal reference), respectively. Emission wavelength: set to 535 nm. Gain: manually set according to the fluorescence value of the negative control well to keep the signal in the upper-middle part of the linear range and avoid saturation. Temperature: set to 37℃.

[0150] Read fluorescence values: Place the 96-well plate into the microplate reader and start reading immediately. Record the fluorescence intensity (RFU) of each well at Ex490 / Em535 and Ex440 / Em535, respectively. Calculate the ratio: For each well, calculate Ratio = RFU(490nm) / RFU(440nm). This ratio is positively correlated with intracellular pH.

[0151] The experimental results are as follows: like Figure 23 As shown, compared with the oeNC group, oeNC+DEO significantly induced cytoplasmic alkalization in KYSE150 and KYSE410 cells. Compared with the oeCA9+DEO group, oeCA9 significantly inhibited cytoplasmic alkalization in KYSE150 and KYSE410 cells.

[0152] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. Application of deoxylabaquinone in the preparation of CA9 inhibitors.

2. A CA9 inhibitor, characterized in that, The active ingredient includes deoxylabaquinone.

3. The CA9 inhibitor according to claim 2, characterized in that, It also includes pharmaceutically acceptable excipients.

4. The use of deoxylabaquinone or the CA9 inhibitor as described in claim 2 or 3 in the preparation of a medicament for the prevention and treatment of esophageal squamous cell carcinoma.

5. A drug for the prevention and treatment of esophageal squamous cell carcinoma, characterized in that, The active ingredient includes deoxylabaquinone or the CA9 inhibitor as described in claim 2 or 3.

6. The drug for preventing and treating esophageal squamous cell carcinoma according to claim 5, characterized in that, It also includes pharmaceutically acceptable excipients.

7. The drug for preventing and treating esophageal squamous cell carcinoma according to claim 5, characterized in that, The dosage form of the drug is a solid dosage form, a liquid dosage form, a paste dosage form, or an emulsion dosage form.