Antigen epitope peptide fragment recognized by PPRV HN monoclonal antibody and application of antigen epitope peptide fragment
By preparing an antigenic epitope peptide recognized by a monoclonal antibody against PPRV HN, the complexity of existing vaccines in the prevention and control of peste des petits ruminants (PPRV) has been solved. By competitively binding to receptors to block viral adsorption, efficient neutralization and diagnosis of PPRV virus have been achieved, providing an effective means of prevention and treatment.
Patent Information
- Application Number
- CN202511968523.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-24
- Publication Date
- 2026-03-24
AI Technical Summary
Existing vaccines present complex and long-term control challenges in preventing peste des petits ruminants (PPR), and there is a lack of effective PPRV virus recognition antigen epitope peptides for virus prevention and treatment.
Provides antigenic epitope peptides for recognition by PPRV HN monoclonal antibodies, including the linear antigenic epitope peptide sequence CLVEACK and the conformational antigenic epitope peptide sequence ECLVEA, for use in vaccine and diagnostic probe preparation. By competitively binding to SLAMF1 and PVRL4 receptors, it blocks viral adsorption and neutralizes PPRV virus.
It effectively reduces the adhesion of PPRV virus to cells, inhibits viral replication, achieves neutralization activity, blocks viral proliferation, and provides an efficient means of prevention and diagnosis.
Smart Images

Figure CN121717879A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of small ruminant virus (PPRV) antibody preparation technology, specifically relating to an antigenic epitope peptide recognized by a PPRV HN monoclonal antibody and its application. Background Technology
[0002] Pestos petits ruminants (PPR), also known as sheep plague, is caused by the peste des petits ruminants virus (PPRV). PPRV infection in small ruminants, especially goats and sheep, causes an acute, febrile, highly contagious disease characterized by high mortality and respiratory and gastrointestinal hemorrhages. Wild ruminants infected with PPRV often exhibit atypical clinical symptoms, thus serving as a natural reservoir for the virus. PPRV spreads from latently infected wild animals to domesticated populations, leading to PPR outbreaks; therefore, PPR control is complex and long-term. Currently, vaccines available for PPR immunization include live attenuated vaccines derived from the Nigeria 75 / 1 and Sµngri 96 strains, but these offer limited selectivity.
[0003] PPRV virus belongs to the order Single-stranded Negative-sense Viriorder, family Paramyxoviridae, subfamily Paramyxovirinae, and genus Measlesvirus. The identified cell types for PPRV infection are lymphocytes and epithelial cells. Among these, the signaling lymphocyte activating molecule 1 (SLAMF1) is a membrane glycoprotein expressed on immature thymocytes and serves as the receptor for PPRV and other measles viruses to infect immune cells. The adhesion and junction protein Nectin-4, also known as poliovirus receptor-like 4 (PVRL4), is a single-transmembrane protein of the immunoglobulin superfamily, highly expressed in the trachea, placenta, lungs, prostate, stomach, mammary glands, and nasopharynx. PVRL4 is also the receptor for PPRV to infect immune cells. Developing antigenic epitope peptides that recognize PPRV hemagglutinin protein could be used for the prevention and treatment of PPRV virus infection. Summary of the Invention
[0004] To address the aforementioned technical problems, this invention provides an antigenic epitope peptide recognized by a PPRV HN monoclonal antibody and its application.
[0005] To facilitate understanding of the contents of this specification, a simplified version of this specification is listed below: Among them, the hemagglutinin protein of peste des petits ruminants virus is abbreviated as HN. HN monoclonal antibody is abbreviated as HN. 1D4-4D9 Small ruminant virus, abbreviated as PPRV.
[0006] The purpose of this invention is to provide an antigenic epitope peptide recognized by a PPRV HN monoclonal antibody, wherein the antigenic epitope peptide comprises a linear antigenic epitope peptide sequence and a conformational antigenic epitope peptide sequence.
[0007] The amino acid sequence of the linear antigen epitope peptide sequence is CLVEACK.
[0008] The amino acid sequence of the conformational antigenic epitope peptide sequence is ECLVEA.
[0009] A gene composition comprising an amino acid sequence encoding the antigenic epitope peptide of claim 1.
[0010] The application of the antigenic epitope peptide or gene composition includes at least one of the following: (1) Application of antigenic epitope peptides or combinations in the preparation of drugs for the prevention of peste des petits ruminants.
[0011] (2) Probes prepared from antigenic epitope peptides or combinations for the diagnosis of peste des petits ruminants.
[0012] Preferably, the drug is a vaccine.
[0013] Preferably, the vaccine further includes a pharmacologically acceptable adjuvant.
[0014] Preferably, the adjuvant is an immune-enhancing adjuvant or a delivery system adjuvant.
[0015] Preferably, the adjuvant is aluminum hydroxide, aluminum phosphate, or potassium aluminum sulfate.
[0016] Preferably, the vaccine uses the antigen epitope peptide or gene composition as the sole active ingredient.
[0017] Preferably, the gene composition is HN 1D4-4D9 HN 1D4-4D9 The amino acid sequence is shown in SEQ ID NO.1.
[0018] The amino acid sequence of SEQ ID NO.1 is shown below:
[0019] Preferably, the HN 1D4-4D9 The method for obtaining it is the hybridoma method.
[0020] Compared with the prior art, the present invention has the following beneficial effects: 1. The PPRV HN monoclonal antibody of the present invention recognizes an antigenic epitope peptide, wherein the antigenic epitope peptide comprises a linear antigenic epitope peptide sequence or a conformational antigenic epitope peptide sequence. The amino acid sequence of the linear antigenic epitope peptide sequence is CLVEACK. The amino acid sequence of the conformational antigenic epitope peptide sequence is ECLVEA. Example 1 of the present invention provides an HN antibody containing the linear antigenic epitope peptide and the conformational antigenic epitope peptide. 1D4-4D9 HN competitively binds to SLAMF1 and PVRL4 sites, reducing PPRV's adhesion to cells and thus decreasing PPRV replication. Therefore, HN 1D4-4D9It can neutralize the proliferation of PPRV and has neutralizing activity.
[0021] The present invention uses real-time quantitative PCR to demonstrate HN 1D4-4D9 The neutralizing effect on viral biological activity primarily occurs during the viral adsorption phase. Immunoprecipitation experiments demonstrate that HN... 1D4-4D9 It hinders the interaction between HN glycoprotein and SLAMF1 and PVRL4 receptors, thereby inhibiting the viral adsorption phase and suppressing viral replication. Attached Figure Description
[0022] Figure 1 HN of the present invention 1D4-4D9 Schematic diagram of the preparation process.
[0023] Figure 2 This diagram illustrates the identification of continuous spatial antigenic epitopes of the PPRV HN protein in Example 2 of the present invention. A represents the IFA identification results of the first round of truncated expression of the PPRV HN protein. B represents the IFA identification results of the second round of truncated expression of the PPRV HN protein. C represents the IFA identification results of the PPRV HN protein antigenic epitopes at the C-terminal and N-terminal amino acid residue positions. D represents the PPRV HN amino acid sequence.
[0024] Figure 3 This diagram illustrates the identification of key amino acid sites of the continuous linear and conformational antigenic epitopes of the PPRV HN protein in Example 3 of this invention. A is a schematic diagram of site-directed mutagenesis of the PPRV HN antigenic epitope. B is the Western blot result of exogenous transfection and expression of the PPRV HN antigenic epitope mutant plasmid. C is the IFA result of exogenous transfection of the PPRV HN antigenic epitope mutant plasmid. D is a schematic diagram of the structural simulation of key sites of the linear and spatial epitopes of PPRV HN.
[0025] Figure 4 HN in Embodiment 4 of the present invention 1D4-4D9 Neutralization activity assay chromatogram. Where A is HN 1D4-4D9 Antibodies were incubated in Vero-SN cells 1 hour prior to PPRV infection. B is HN. 1D4-4D9 Antibody was incubated 1 hour prior to PPRV infection. The intracellular PPRV HN protein content in Vero-SN cells was measured. C represents TCID. 50 Method for determining HN 1D4-4D9 Antibody infection was preceded by PPRV infection and incubation for 1 hour. Extracellular PPRV levels were measured using Vero-SN. D was determined by flow cytometry for HN. 1D4-4D9 The fluorescence intensity of Vero-SN PPRV-EGFP incubated 1 hour prior to PPRV infection with the antibody. E represents HN. 1D4-4D9 Incubate with PPRV strains. F is HN. 1D4-4D9Incubation with PPRV strains and the intracellular PPRV HN protein content in Vero-SN cells. G represents HN. 1D4-4D9 Extracellular PPRV content in Vero-SN cells after incubation with anti-PPRV strains. H is HN. 1D4-4D9 The fluorescence intensity of Vero-SN PPRV-EGFP after co-incubation with PPRV strains. I indicates PPRV infection precedes HN. 1D4-4D9 Antibody incubation for 1 hour. J indicates PPRV infection precedes HN. 1D4-4D9 Antibody incubation for 1 hour, PPRV HN protein content in Vero-SN cells. K indicates that PPRV infection precedes HN. 1D4-4D9 Extracellular PPRV levels in Vero-SN cells after 1 hour of antibody incubation. L indicates that PPRV infection precedes HN infection. 1D4-4D9 The fluorescence intensity of Vero-SN PPRV-EGFP after 1 hour of antibody incubation.
[0026] Figure 5 HN in Embodiment 5 of the present invention 1D4-4D9 The result of inhibiting PPRV adsorption into cells. Where A is HN. 1D4-4D9 Antibodies were incubated in Vero-SN cells 1 hour prior to PPRV infection to measure the intracellular PPRV viral genome content. B represents HN. 1D4-4D9 The intracellular PPRV viral genome content was measured when cells were incubated with anti-PPRV strains. C indicates that PPRV infection precedes HN infection. 1D4-4D9 The content of PPRV virus genome in cells after 1 hour of antibody incubation. D represents HN. 1D4-4D9 Antibody infection was pre-incubated for 1 hour before PPRV infection. The graph shows the PPRV viral genome content in Vero-SN cells. E represents HN. 1D4-4D9 Experiments involving co-incubation of anti- and PPRV strains; PPRV viral genome content in Vero-SN cells. F indicates PPRV infection prior to HN infection. 1D4-4D9 Image showing the PPRV virus genome content in Vero-SN cells after 1 hour of antibody incubation.
[0027] Figure 6 HN in Embodiment 6 of the present invention 1D4-4D9 Diagram showing the competitive inhibition of PPRV HN glycoprotein and its interaction with SLAM and Nectin4 receptors. In this diagram, A represents the interaction between HN and SLAM receptors as confirmed by co-immunoprecipitation experiments. 1D4-4D9 Competitive inhibition of the interaction between PPRV HN and SLAM receptors. B is an immunoprecipitation assay demonstrating HN... 1D4-4D9 Competitive inhibition of the interaction between PPRV HN and Nectin4 receptor. C is an immunoprecipitation assay demonstrating HN. 1D4-4D9 Diagram of non-competitive inhibition of PPRV HN and F protein interaction. Detailed Implementation
[0028] To enable those skilled in the art to better understand and implement the technical solutions of the present invention, the following detailed description, in conjunction with preferred embodiments and accompanying drawings, provides a clear and complete account of the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of them. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention.
[0029] It should be noted that all technical terms used in this invention are for the purpose of describing specific embodiments only and are not intended to limit the scope of protection of this invention. Unless otherwise specified, all raw materials, reagents, instruments and equipment used in the following embodiments of this invention can be purchased from the market or prepared by existing methods.
[0030] Example 1 A small ruminant disease virus HN 1D4-4D9 The method for preparing antibodies includes the following steps: 1. Construction of recombinant plasmid containing pET28a-PPRV HN (223aa~551aa) truncated protein Referring to the gene sequence of the prevalent field strain PPRV / XJBZ / 2015 (GenBank accession number KT633939), bioinformatics was used to predict and analyze the transmembrane region and dominant antigenic epitope region of the PPRV HN protein. SnapGene software was used to design specific primers for the PPRV HN gene to amplify the truncated HN gene sequence 223aa~551aa. The primers are shown in Table 1, and the target fragment size was 984bp. Using the pCAGGS-Velogenic HN(VHN)-HA plasmid, a prevalent PPRV strain in the field, as a template, polymerase chain reaction (PCR) amplification was performed. The reaction system consisted of 25 µL of 2×PhantaMax Bµffer, 18 µL of ddH2O, 2 µL each of forward and reverse primers, 1 µL of dNTP Mix, 1 µL of PhantaMax Sµper-Fidelity DNA Polymerase, and 1 µL of cDNA template, for a total volume of 50 µL. The reaction program was 95 °C pre-denaturation for 3 min, 95 °C denaturation for 15 s, 58 °C annealing for 15 s, 72 °C extension for 60 s, for 34 cycles, followed by a final extension at 72 °C for 5 min. After verification of the PCR product by 1% agarose gel electrophoresis, the target fragment was recovered using a gel extraction kit. The gel-recovered fragment was cloned into the prokaryotic expression vector pET28a, which had been digested with restriction endonucleases, using the Clon Express MµltiS one-step cloning kit. The ligation product was transformed into DH5α competent cells, plated on 2YT solid medium containing kanamycin, and incubated overnight at 37°C. Positive single colonies were picked and inoculated into 2YT liquid medium. After 15 hours of incubation, plasmids were extracted and sequenced. The correctly sequenced positive plasmid was named pET28a-Velogenic HN (VHN), thus obtaining pET28a-VHN.
[0031] Table 1. Primer sequences for PCR construction of truncated protein recombinant plasmid 2. Protein induction and purification of pET28a-VHN The flowchart of pET28a-VHN protein induction expression and protein purification is as follows: Figure 1 As shown. The original bacterial culture containing the recombinant plasmid pET28a-VHN was inoculated into 1 mL of 2 YT liquid medium containing kanamycin at a volume ratio of 1:100, and cultured with shaking at 37℃ and 200 rpm. The OD of the bacterial culture was then measured. 600When the pH reached 1.0, IPTG was added to a final concentration of 1 mmol / L for induction. After induction, the bacterial culture was incubated at 37℃ and 200 rpm for 12 h with shaking. The bacterial pellet was then collected by centrifugation at 4℃ and 12000 rpm for 2 min. The pellet was resuspended in 0.01 M phosphate buffer (pH 7.2) and then sonicated. The lysate was centrifuged at 12000 rpm for 15 min, and the supernatant and pellet were separated and collected. The expression form of the recombinant protein, such as soluble or inclusion bodies, was analyzed by SDS-PAGE electrophoresis. After large-scale induction of protein expression, the recombinant protein was purified by nickel-nitrotriacetic acid affinity chromatography. The purified protein was verified by SDS-PAGE electrophoresis, yielding the pET28a-VHN protein.
[0032] 3. HN 1D4-4D9 Preparation, purification and potency determination Four 7-week-old female SPF-grade BALB / c mice were selected and subjected to three rounds of immunization. For the first immunization, purified truncated recombinant HN protein was emulsified at 50 µg / mouse with an equal volume of Freund's complete adjuvant and injected subcutaneously at four points on the back, 0.1 mL per point. Two weeks later, for the second immunization, the protein was emulsified with Freund's incomplete adjuvant and injected subcutaneously at the same dose and route. Two weeks after the second immunization, a third immunization was administered, using the same method. Three days before cell fusion, a pulse immunization was performed. To enhance B cell activation, 100 µg / mouse of truncated recombinant HN protein was diluted to 0.3 mL with sterile PBS, thoroughly mixed, and injected aseptically into the intraperitoneum to enhance the immune response. Ten days after the third immunization, blood was collected from the tail vein, and serum antibody titers were detected by indirect ELISA. Mice with titers greater than or equal to 1:10000 were selected for cell fusion. Immunized mice were euthanized by cervical dislocation, and the spleen was harvested under sterile conditions, ground, and passed through a 200-mesh sieve. SP2 / 0 myeloma cells in logarithmic growth phase with a viability of ≥95% were mixed with spleen cells at a ratio of 5:1 and fused using 50% PEG4000. The fused cell suspension was seeded into 96-well plates containing HAT medium and incubated at 37°C in a 5% CO2 incubator. After 7 days, the medium was replaced with HT medium. After 14 days of culture, positive wells were screened using an indirect ELISA: the truncation of recombinant PPRV HN protein 223-551aa was used as the antigen to detect the positivity of antibodies in the cell supernatant. Positive wells were subcloned using a limiting dilution method, with three consecutive subclonings to obtain the hybridoma cell line 1D4-4D9, which stably secretes antibodies against PPRV HN protein. Seven-week-old BALB / c mice were intraperitoneally injected with 1 mL of 1D4-4D9 (1×10⁻⁶). 6Each mouse was injected with a single antibody. Starting on day 9 post-injection, the abdominal distension of the mice was observed daily. Ascites fluid was collected, centrifuged at 4000 rpm for 8 minutes at 4°C to remove the precipitate, and the supernatant was the monoclonal antibody ascites fluid. The ascites antibody was purified using the Nab Protein A / GSpin Colµmns antibody purification kit to obtain purified antibody HN. 1D4-4D9 HN 1D4-4D9 The concentration is 7.5 mg / mL, HN 1D4-4D9 Repackage and store at -80℃ for later use.
[0033] The titer of the purified antibody was determined by Western blot. Protein samples were prepared by lysing PPRV-infected Vero-SN cells, separated by SDS-PAGE, and transferred to an NC membrane. After blocking, HN was added in serially diluted 1:1000–60000. 1D4 -4D9 As the primary antibody, incubate overnight at 4°C. After washing with TBST, add secondary antibody, HRP-labeled goat anti-mouse IgG, and incubate at room temperature for 1 hour. Perform ECL color development, and the highest dilution showing a clear, specific band is taken as the antibody titer purified from the ascites fluid.
[0034] Example 2 Identification of the continuous linear and spatial antigenic epitope amino acid sequence of an HN protein targeting PPRV, comprising the following steps: To determine the precise location of the antigenic epitope, the full-length PPRV HN protein was predicted using the IEDBB B-cell epitope prediction tool. Based on the prediction results, a series of truncated eukaryotic plasmids containing the HA tag were constructed, as shown in Table 2. The specific experimental procedure is as follows: First, the potential antigenic epitopes present in the full-length PPRV HN protein were preliminarily predicted online using the IEDBB B-cell epitope prediction website. Then, eukaryotic expression plasmids containing the HA tag for the 609aa encoded by the PPRV HN protein were constructed by gradually truncating the protein. The primers are shown in Table 2. The constructed plasmids were transfected into HEK-293T cells. After 24 hours, the cell culture supernatant was aspirated, 100 µL of cell lysis buffer was added to fully lyse the cells, and after sonication, 25 µL of 5× protein loading buffer was added. The cells were boiled for 10 min, cooled, and subjected to Western blotting (WB) experiments. After SDS-PAGE electrophoresis, the protein samples were wet-transferred to an NC membrane. After the transfer was complete, the membrane was blocked with 5% skim milk at room temperature for 1 hour. After washing with TBST, the samples were incubated with primary antibody. The primary antibodies used were purified HN2 and HN2. 1D4-4D9Monoclonal antibodies, murine β-actin, and HA antibodies were used. After overnight incubation with the primary antibody, the cells were washed again with TBST before incubation with the secondary antibody, Goat Anti-Moµse IgG-HRP, at room temperature for 1 hour. After secondary antibody incubation and washing with TBST, the cells were then subjected to color development and exposure using a chemiluminescence instrument.
[0035] The first round of truncation divided the PPRV HN protein into three truncated variants: 1aa~300aa, 200aa~440aa, and 301aa~609aa, and constructed plasmids for each variant. Detection showed that the truncated HN variants (301aa~609aa and 200aa~440aa) were positive in Western blot (WB) assays after transfection into HEK-293T cells. After transfection into Vero-SN cells, specific IFA fluorescence was observed, as shown in the results below. Figure 2 As shown, the epitope was initially located in the range of 301aa to 440aa. Further prediction was performed on the 301aa to 440aa region using the IEDB website, dividing it into three truncated variants: 301aa to 350aa, 351aa to 410aa, and 411aa to 440aa. Plasmids were then constructed based on these variants. The results... Figure 2 As shown in B in the figure. The results showed that only the 351aa~410aa truncated variant of HN simultaneously satisfied both WB and IFA, narrowing the epitope range to 351aa~410aa. The third round of truncation identification focused on the C-terminal localization of the 351aa~410aa peptide chain, constructing 351aa~400aa and 351aa~390aa truncated variant plasmids respectively. Both WB and IFA results were positive, indicating that this round of truncation did not touch the critical C-terminal region of the epitope and still contained the complete epitope, excluding 400aa~410aa as the key epitope sequence, suggesting that the C-terminus of the epitope is located within the 351aa~390aa region. In the fourth round of identification, to facilitate plasmid construction, the N-terminus of the truncated fragment was extended to 200 aa. The N-terminus was fixed, and the C-terminus was progressively truncated to construct truncated somatic plasmids of 200aa~388aa, 200aa~387aa, 200aa~386aa, 200aa~385aa, 200aa~384aa, and 200aa~383aa. Results showed that in Western blotting, a specific band was observed at the 200aa~387aa range up to HN, while the 200aa~386aa and shorter fragments of HN were negative. In intracellular fluorescence analysis (IFA), only the 200aa~385aa range of HN showed specific fluorescence, while the 200aa~384aa and shorter fragments of HN were negative, indicating that the linear epitope C-terminus is 387aa and the conformational epitope C-terminus is 385aa. Figure 2As shown in C in the figure. In the fifth round of identification, the N-terminus of the epitope was located, and the C-terminus of the truncated fragment was extended to 440 aa. The C-terminus was fixed, and the N-terminus was progressively truncated to construct truncated somatic plasmids of 360aa~440aa, 370aa~440aa, 373aa~440aa, 375aa~440aa, and 377aa~440aa. The results are as follows... Figure 2 As shown in C, all plasmids showed positive results for both Western blotting and in vitro blotting (IFA), indicating that the epitope was not truncated to the critical N-terminal region, meaning the N-terminus of the epitope is located after 377 aa. A sixth round of identification was performed. To facilitate plasmid construction, the C-terminus of the truncated fragment was extended to 609 aa, constructing truncated somatic plasmids of 379 aa~609 aa, 380 aa~609 aa, 381 aa~609 aa, 382 aa~609 aa, 383 aa~609 aa, and 384 aa~609 aa. The results showed that a specific band appeared at 381 aa~609 aa in the HN assay, while the 382 aa~609 aa and shorter fragments of HN were negative. Figure 2 As shown in Figure C, only the 380aa~609aa segments of HN in IFA exhibited specific fluorescence, while the 381aa~609aa segments and shorter fragments of HN were negative, indicating that the N-terminus of the linear epitope is 381aa and the N-terminus of the conformational epitope is 380aa. The smallest linear antigenic epitope binding to the monoclonal antibody was ultimately determined to be CLVEACK, and the smallest conformational antigenic epitope was determined to be ECLVEA.
[0036] Table 2. PCR primer sequences for constructing the PPRV HN gene truncated plasmid Example 3 The identification of key amino acid sites of continuous linear and spatial antigenic epitopes in PPRV HN proteins includes the following steps: The key amino acid sites of the continuous linear and spatial antigenic epitopes of PPRV HN protein, such as Figure 3As shown in A in Table 3. Using alanine mutation scanning technology, single-point alanine mutation primers were designed for each amino acid of the minimal antigenic epitope. The primers are shown in Table 3. The specific experimental procedure is as follows: Using alanine scanning mutation technology, single-point alanine substitutions were performed on each amino acid in the linear epitope CLVEACK and the conformational epitope ECLVEA, constructing eight mutant plasmids: HN(380E-A), HN(381C-A), HN(382L-A), HN(383V-A), HN(384E-A), HN(385A-A), HN(386C-A), and HN(387K-A). These mutant plasmids were transfected into HEK-293T cells. Twenty-four hours after transfection, the cells were lysed on ice using RIPA lysis buffer, and the proteins were denatured in a 100°C metal bath for 10 minutes. 10% SDS-PAGE electrophoresis was performed under the following conditions: 80V constant voltage for 30 minutes, followed by 120V constant voltage for 2 hours. After electrophoresis, proteins were transferred to a nitrocellulose membrane using a wet transfer method. The nitrocellulose membrane is abbreviated as NC membrane. The NC membrane was blocked with 5% skim milk powder at room temperature for 1 hour, and purified HN was added separately. 1D4-4D9 Monoclonal antibodies and HA-tagged antibodies were incubated overnight at 4°C. After washing three times with TBST, HRP-labeled goat anti-mouse secondary antibody was added, and incubation was carried out at room temperature for 1 hour. After washing again, the cells were developed with ECL chemiluminescence immunoassay solution, and the results were exposed and analyzed using a chemiluminescence imaging system. Simultaneously, the mutant plasmid was transfected into Vero-SN cells on pre-placed slides and cultured to 60%–70% confluence. After washing three times with PBS, the cells were fixed with 4% paraformaldehyde at room temperature for 20 minutes. The cells were permeabilized with 0.05% Triton X-100 at room temperature for 10 minutes, washed with PBS, and then blocked with 5% BSA at 37°C for 35 minutes. HN was added... 1D4-4D9 Monoclonal antibodies were incubated at 37°C for 3 hours. After washing three times with PBS, Alexa Fluor 488-labeled goat anti-mouse secondary antibody was added in the dark, and the mixture was incubated at 37°C for 1 hour. Finally, the nuclei were stained with DAPI at 37°C for 8 minutes, and the slides were mounted with anti-quenching mounting medium. Fluorescence was observed using a Zeiss LSM880 laser confocal microscope. Western blotting and in vitro fluorescence (IFA) were used to analyze the effect of mutations on antibody binding and to identify key amino acid sites.
[0037] After cell transfection, the effect of mutations on antibody binding was analyzed by Western blotting (WB) and in vitro immunoassay (IFA). The results showed that in WB analysis, the HN(381C-A), HN(383V-A), HN(386C-A), and HN(387K-A) mutants showed no specific bands, while the other mutants still showed clear bands. This indicates that C381, V383, C386, and K387 are key amino acids for maintaining the binding of linear epitopes to antibodies. Figure 3As shown in B in the figure. Meanwhile, in the IFA assay, only the HN(381C-A) and HN(383V-A) mutants showed no specific fluorescence, while the remaining mutants all showed fluorescence, indicating that C381 and V383 are the core amino groups that exert antigen-antibody reaction activity through conformational epitopes, such as... Figure 3 As shown in C. To observe HN1 more clearly. 1D4-4D9 Based on the key linear and spatial epitope structural characteristics, we predicted and simulated the structure of the PPRV HN protein using Alphafold and PMOL software. For example... Figure 3 As shown in D, HN1 1D4-4D9 Both the key linear and spatial antigenic epitopes are located in the β-sheet tertiary structure.
[0038] Table 3 Primer sequences for constructing PPRV HN key antigenic epitope mutant plasmids. Application Example 1 HN 1D4-4D9 To effectively neutralize PPRV virus activity, the following steps are included: To systematically evaluate HN 1D4-4D9 To neutralize PPRV virus, this invention uses Vero-SN cells as the host cell and the PPRV vaccine strain (Nigeria 75) as the target, and designs three incubation strategies. These strategies include HN... 1D4-4D9 Incubate 1 hour prior to PPRV infection, PPRV and HN 1D4-4D9 Co-incubation and HN 1D4-4D9 The cells were then incubated 1 hour after PPRV infection. PPRV was incubated alone as a positive control.
[0039] The specific experimental procedure is as follows: (1) HN 1D4-4D9 Incubation 1 hour prior to PPRV infection: Vero-SN cells were seeded into 12-well plates and cultured routinely until 90% confluence. A positive control group was set up without antibody. The experimental groups were treated with HN1 at dilutions of 1:25, 1:100, 1:400, 1:1000, and 1:2000 per well. 1D4-4D9 After incubation at 37℃ and 5% CO2 for 1 hour, 12 µL of PPRV solution with an MOI of 1 was added to each well of both the experimental and positive control groups, and the cells were incubated at 37℃ for 1 hour for adsorption. The old culture medium was discarded, and the cells were washed three times with PBS. 1 mL of DMEM complete medium containing 10% fetal bovine serum was added to each well, and the cells were incubated at 37℃ and 5% CO2 for 72 hours. The cell supernatant was collected to determine the TCID50 (median viral load). 50 Cells were lysed to collect total protein, and viral HN protein expression was detected by Western blot.
[0040] (2) Virus and HN 1D4-4D9Co-incubation: Vero-SN cells were seeded in 12-well plates and cultured until 90% confluence. Experimental group, positive control group, and replicate wells were set up. Six 1.5 mL EP tubes were prepared for each group. Each tube contained 500 µL of serum-free DMEM and 25 µL of triple antibody. Five tubes were added with HN diluted 1:25, 1:100, 1:400, 1:1000, and 1:2000 respectively. 1D4-4D9 One branch pipe without HN 1D4-4D9 Add 12 µL of PPRV buffer (MOI=1) to each tube, vortex to mix, and incubate at 37°C for 1 h. Transfer the incubation solution to cell wells and incubate at 37°C for 1 h for adsorption. After adsorption, discard the old culture medium, wash the cells three times with PBS, add 1 mL of complete culture medium to each well, and incubate at 37°C and 5% CO2 for 72 h. Collect the cell supernatant for viral TCID assay. 50 Simultaneously, cells were lysed to collect total protein samples, and the expression level of viral HN protein was detected by Western blotting.
[0041] (3) HN 1D4-4D9 One hour after viral infection, Vero-SN cells were seeded into 12-well plates and cultured until confluence reached 90%–100%. Experimental groups, positive control groups, and replicate wells were set up: 12 µL of PPRV solution with an MOI of 1 was added to each well of the experimental and positive control groups, and the cells were incubated at 37°C and 5% CO2 for 1 hour, after which the virus solution was discarded; the experimental groups were treated with HN diluted 1:25, 1:100, 1:400, 1:1000, and 1:2000. 1D4-4D9 Antibody, positive control group without HN 1D4-4D9 After incubation at 37℃ and 5% CO2 for 1 hour, discard the liquid in the wells, wash three times with PBS, and add complete culture medium for 72 hours. After culture, collect the cell supernatant for viral TCID assay. 50 Cells were lysed to collect total protein samples, and the expression level of viral HN protein was detected by Western blotting.
[0042] In addition to the above three experimental protocols, experimental groups, negative controls, and positive controls were set up. After infecting the cells with the fluorescently labeled PPRV strain (EGFP-PPRV) according to the above steps and culturing for 72 h, the cells of each group were collected, washed twice with PBS, digested with trypsin, and then DMEM containing 10% serum was added to terminate the digestion. The cells were centrifuged at 4°C and 1500 rpm for 5 min, the supernatant was discarded, the cell pellet was resuspended with 5% BSA, filtered through a cell filter, and the fluorescence signal of 10,000 cells was collected using CytoFLEX flow cytometer. The proportion of fluorescent positive cells was analyzed using FlowJo 10 software.
[0043] HN 1D4-4D9 PPRV-EGFP neutralizing activity such as Figure 4 As shown. The results show that, Figure 4Western blot results for antibody-pre-viral infection (1 hour incubation) showed that, compared to the positive control group, in the antibody-pre-viral infection (1 hour incubation) group, the expression level of HN protein in cells decreased with increasing antibody dilution, indicating a gradient decrease in HN protein expression as antibody concentration increased. 1D4 -4D9 It can specifically inhibit the proliferation of PPRV in Vero-SN cells. Figure 4 TCID of C in 50 The results showed that, compared with the positive control group, the antibody incubation group 1 hour before viral infection showed higher extracellular TCID levels. 50 The decrease in antibody concentration followed by a gradient weakening indicates that HN 1D4-4D9 It can specifically inhibit the proliferation of PPRV outside Vero-SN cells. Figure 4 Flow cytometry analysis of D in HN showed that, compared with the positive control, 1D4-4D9 The extracellular fluorescence signal was significantly weakened after 1 hour of incubation following PPRV-EGFP infection, indicating that HN 1D4-4D9 It can specifically inhibit the proliferation of green fluorescently labeled PPRV-EGFP virus in Vero-SN cells.
[0044] like Figure 4 As shown in E and F, compared to the positive control group, HN 1D4-4D9 The expression level of PPRV HN protein in cells incubated with the PPRV vaccine strain decreased in a gradient with decreasing antibody dilution, suggesting that HN... 1D4-4D9 It can specifically inhibit the proliferation of Vero-SN virus in cells. Figure 4 TCID of G in 50 The test results showed that, compared with the positive control group, HN 1D4-4D9 Extracellular TCID group incubated with PPRV 50 As antibody dilution decreases, i.e., as antibody concentration increases, the gradient weakens, suggesting HN. 1D4-4D9 It can specifically inhibit the extracellular viral proliferation of Vero-SN; Figure 4 Flow cytometry results of H in H showed that, compared with the positive control, HN 1D4-4D9 The extracellular fluorescence signal was significantly reduced in the group incubated with PPRV-EGFP, indicating that HN 1D4-4D9 It can specifically inhibit the proliferation of green fluorescently labeled PPRV-EGFP in Vero-SN cells.
[0045] Figure 4 HN shown 1D4-4D9 Subsequently, in the experimental protocol of incubation 1 hour after viral infection, in HN 1D4-4D9 In the method of incubation 1 hour after viral infection, Western blotting, TCID50, and flow cytometry all indicated HN 1D4-4D9It did not specifically inhibit the proliferation of PPRV in Vero-SN cells and did not exhibit neutralizing activity.
[0046] Application Example 2 HN 1D4-4D9 Inhibition of the PPRV adsorption phase includes the following steps: For preliminary identification of HN 1D4-4D9 This invention compares three experimental methods for neutralizing viruses with monoclonal antibodies: incubation of antibodies and viruses together, incubation of antibodies 1 hour before viral infection, and incubation of antibodies 1 hour after viral infection. Under 37°C conditions, samples were collected immediately after 1 hour of viral adsorption and prepared. The viral genome copy number in cells was detected by quantitative real-time PCR to assess the viral genome replication level. The specific experimental procedure is as follows: Vero-SN cells were seeded into 12-well plates and cultured until cell confluence reached 90%–100%. After pre-cooling the cells at 4°C, each well of the experimental group was treated with 1:25 HN diluted in 500 µL of serum-free DMEM medium. 1D4-4D9Antibody was adsorbed and incubated at 4°C for 1 hour. Then, 12 µL of PPRV vaccine strain (Nigeria 75) with an MOI of 1 was added to each well, and incubation continued at 4°C for 1 hour. A positive control group was set up with only an equal volume of virus solution and no antibody. After incubation, cells were washed three times with pre-cooled PBS buffer, and 500 µL of Trizol reagent was added to each well. Cells were incubated at room temperature for 10 minutes to ensure complete lysis. The lysis buffer was transferred to enzyme-free EP tubes, 200 µL of chloroform was added, vortexed for 15 seconds, then incubated on ice for 5 minutes, and centrifuged at 4°C and 12000 rpm for 15 minutes. The upper aqueous phase was aspirated, an equal volume of isopropanol was added, and the tubes were incubated on ice for 5 minutes, then centrifuged at 4°C and 12000 rpm for 20 minutes. The precipitate was washed twice with 1 mL of 75% ethanol, centrifuged at 4°C and 9500 rpm for 5 minutes, the supernatant was discarded, and the cells were dried in a clean bench before dissolving the RNA in 50 µL of enzyme-free water. 2 µg of RNA was added to RNase-free ddH2O and 4×g DNA wiperMix, and incubated at 42℃ for 2 min to remove genomic DNA. 5×HiScript II qRT SµperMix II was added, and reverse transcription was completed at 50℃ for 15 min and 85℃ for 5 s. Quantitative real-time PCR was performed using cDNA as a template: upstream primer PPRN8a-F, downstream primer PPRN9b-R. The nucleotide sequence of PPRN8a-F is SEQ ID NO.70: CACAGCAGAGGAAGCCAAAC, and the nucleotide sequence of PPRN9b-R is SEQ ID NO.71: TGTTTTGTGCTGGAGGAAGGA. The reaction conditions were: 95℃ pre-denaturation for 30 s, 95℃ denaturation for 10 s, 60℃ annealing for 20 s, for 40 cycles; melting curve: 95℃ for 10 s, 60℃ for 5 s. Each sample was tested in triplicate to analyze the viral RNA copy number adsorbed by cells. Two other neutralization protocols were simultaneously analyzed using quantitative real-time PCR. The results are as follows Figure 5 As shown in A in the diagram.
[0047] qPCR results showed that the viral genome copy number in cells incubated 1 hour after antibody infection was significantly higher than that in the groups incubated with both antibody and virus and incubated 1 hour before antibody infection, consistent with the neutralizing activity assay results. These results indicate that the main neutralizing mechanism of the HN monoclonal antibody is targeting the early viral replication process, rather than acting on the invasion stage after viral adsorption.
[0048] To further clarify HN 1D4-4D9 The neutralizing target of monoclonal antibodies, in this invention, allows only viral adsorption and blocks internalization at 4°C. The effect of the antibody on PPRV adsorption is detected by qPCR. Figure 5As shown in Figures D, E, and F, compared with the positive control, the number of viral RNA copies in cells adsorbed was significantly lower in the antibody-incubated group 1 hour before viral infection and in the antibody-virus-incubated group (p < 0.001). However, there was no statistically significant difference between the antibody-incubated group 1 hour after viral infection and the positive control. This result directly confirms HN 1D4-4D9 Monoclonal antibodies can exert a neutralizing effect by inhibiting the adsorption process of PPRV to Vero-SN cells.
[0049] Application Example 3 HN 1D4-4D9 The competitive binding of HN to the cell receptors SLAM and Nectin4 comprises the following steps: To elucidate HN at the molecular level 1D4-4D9 The neutralization mechanism of monoclonal antibodies was investigated in this invention using an immunoprecipitation experiment to explore whether antibodies interfere with the interaction between PPRV HN protein and cell receptors SLAM and Nectin4. The specific experimental procedure is as follows: HEK-293T cells were seeded in 6-well plates and cultured to 80% confluence. The cells were then transfected with plasmids according to the following groups: (i) pCAGGS+HN-HA, (ii) HN-HA+SLAM-Flag, H-HA+Nectin4-Flag, and HN-HA+F-Flag. A positive control group was used without antibody. Twenty hours after transfection, cells were lysed on ice for 5 minutes with lysis buffer. The lysate was collected into 1.5 mL EP tubes, incubated on ice for 15 minutes, and then centrifuged at 4°C and 12000 rpm for 15 minutes. (i) 50 µl of the supernatant was added to 15 µl of 5× loading buffer and boiled at 100°C for 8 minutes as the input group. The remaining supernatant was processed according to the following groups: (ii) HN-HA was added to the samples of the groups at a ratio of 1:5 and 1:25, respectively. 1D4-4D9 Monoclonal antibodies were used as the experimental group, group (ii) was a positive control with the same plasmid combination but without antibody, and group (i) was a negative control. All samples were incubated at 4°C on a shaker for 3 hours. 8 µL of HA magnetic beads were taken, adsorbed onto a magnetic rack, and washed three times with a lysis buffer. The incubated sample was added to the magnetic beads, and 500 µL of diluted protease inhibitor was added to each tube. The samples were incubated overnight at 4°C on a shaker. The magnetic beads were collected, washed three times with lysis buffer, and 5 µL of lysis buffer and 15 µL of 5× loading buffer were added. The samples were boiled at 100°C for 8 minutes. The supernatant was collected on the magnetic rack for Western blotting to verify the band intensity changes. The results are as follows: Figure 6 As shown.
[0050] In the positive control group, HA antibody successfully co-precipitated SLAM-Flag and Nectin4-Flag proteins, confirming the specific binding of HN protein to both receptors. The addition of HN... 1D4-4D9In the monoclonal antibody experimental group, the intensity of the co-precipitated bands of SLAM-Flag and Nectin4-Flag was significantly reduced, suggesting that the inhibitory effect of the antibody on the binding of HN protein to both SLAM and Nectin4 receptors is dose-dependent. This indicates that HN... 1D4-4D9 Monoclonal antibodies exert neutralizing activity by specifically binding to the PPRV HN protein, competitively occupying the binding site of the PPRV HN protein to the cell receptor, or forming steric hindrance.
[0051] Furthermore, this invention also verified, through Co-IP experiments, whether the antibody affects the interaction between the PPRV HN protein and the F protein. The results are as follows... Figure 6 As shown in B, in the positive control group, HA antibody successfully co-precipitated F-Flag protein, confirming the specific binding of HN protein to F protein. The addition of HN... 1D4-4D9 In the monoclonal antibody experimental group, the intensity of the co-precipitated band of F-Flag was slightly enhanced compared to the positive control group, indicating that the antibody can slightly promote the binding of HN protein to F protein in a dose-dependent manner. This result clearly demonstrates that HN... 1D4-4D9 The monoclonal antibody did not interfere with the interaction between the PPRV HN protein and the F protein after specifically binding to the PPRV HN protein.
[0052] In this invention, we utilized bioinformatics to analyze the dominant antigenic epitope region and its transmembrane region of the PPRV HN protein. Using a prokaryotic expression system, we truncated the dominant antigenic epitope in the non-transmembrane region of the expressed protein. Then, using a traditional hybridoma monoclonal antibody technology platform, we successfully prepared a monoclonal antibody targeting the PPRV HN protein, named HN. 1D4-4D9 In this invention, we systematically characterized a novel and conserved linear and conformational antigenic epitope sequence and its key amino acid sites on the PPRV strain HN from different genotypes. Crucially, we demonstrated that HN… 1D4-4D9 It exhibits potent neutralizing biological activity in vitro. Mechanistically, our results indicate that this monoclonal antibody effectively blocks viral adsorption, thereby preventing the initiation of the infection cycle. We identified HN... 1D4-4D9 The primary mode of neutralization is steric hindrance of its interaction with cellular receptors such as SLAM and Nectin-4. Characterization of this key neutralizing epitope will guide the rational design of epitope-based drugs and next-generation vaccines. Meanwhile, HN... 1D4-4D9 Antibodies have been shown to be a multifunctional agent for the prevention and diagnosis of PPR, as well as a novel experimental probe and target material for studying the pathogenesis of PPRV.
[0053] Vaccination is a fundamental preventative measure against emerging and recurrent viral infections in humans and animals. Virus-induced neutralizing antibodies have become an effective therapeutic intervention against viral diseases. The protective effect of neutralizing antibodies stems not only from their ability to target viral surface proteins but also from their ability to mobilize the immune system through Fc-mediated effector functions, such as antibody-dependent cell-mediated cytotoxicity, opsonization, mast cell activation, and complement activation.
[0054] Antigenic determinants are the sites on which antigen molecules can specifically bind to antibodies. They are structures that can specifically bind to their corresponding antibodies or sensitized lymphocytes, and are special chemical groups with a specific composition and structure. Antigenic determinants with a defined structure are called antigenic epitopes. Antigenic epitopes can be divided into linear epitopes and conformational epitopes. Meanwhile, HN... 1D4-4D9 Antibodies have been shown to be a multifunctional agent for the prevention and diagnosis of PPR, as well as a novel experimental probe target material for studying the pathogenesis of PPRV.
[0055] This invention targets the HN glycoprotein of peste des petits ruminants virus (PPR) primarily using truncation and overlap PCR techniques to identify HN. 1D4-4D9 The identified continuous linear antigenic epitope of B cells was CLVEACK. Its continuous spatial antigenic epitope was determined to be ECLVEA. Simultaneously, truncated, deleted, dotted immunoblotting, and enzyme-linked immunosorbent assay (ELISA) experiments were performed to confirm HN. 1D4-4D9 Linear and conformational antigenic epitopes of B cells.
[0056] This invention employs site-directed mutagenesis to mutate each amino acid of the identified linear and spatial epitopes to alanine, a amino acid with minimal impact on protein structure. Western blotting analysis identified the key amino acid sites of the linear epitope peptide as C381, V383, C386, and K387. Indirect immunofluorescence assays identified the key amino acid sites of the conformational epitope peptide as C381 and V383.
[0057] This invention uses quantitative real-time PCR to prove HN 1D4-4D9 Monoclonal antibodies exert their neutralizing viral biological activity primarily during the viral adsorption phase. Immunoprecipitation experiments mechanistically demonstrate that HN... 1D4-4D9 It hinders the interaction between HN glycoprotein and SLAM and Nectin4 receptors, thereby inhibiting the viral adsorption phase and suppressing viral replication.
[0058] It should be noted that when numerical ranges are involved in this invention, it should be understood that both endpoints of each numerical range and any value between the two endpoints can be selected. Since the steps and methods used are the same as in the embodiments, preferred embodiments are described in this invention to avoid redundancy. Although preferred embodiments of this invention have been described, those skilled in the art, once they understand the inventive concept of this invention, can make other changes and modifications to these embodiments, and all such changes and modifications fall within the scope of this invention.
[0059] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. If such modifications and variations fall within the scope of equivalents of this invention, then this invention also intends to include these modifications and variations.
Claims
1. An antigenic epitope peptide recognized by a PPRV HN monoclonal antibody, characterized in that, The antigenic epitope peptides include linear antigenic epitope peptide sequences and conformational antigenic epitope peptide sequences. The amino acid sequence of the linear antigen epitope peptide sequence is CLVEACK. The amino acid sequence of the conformational antigenic epitope peptide sequence is ECLVEA.
2. A gene composition, characterized in that, The gene composition comprises a combination of nucleotide sequences encoding the antigenic epitope peptide of claim 1.
3. The application of the antigenic epitope peptide of claim 1 or the gene composition of claim 2, characterized in that, Includes at least one of the following: (1) The use of antigenic epitope peptides or combinations in the preparation of drugs for the prevention of peste des petits ruminants; (2) Probes prepared from antigenic epitope peptides or combinations for the diagnosis of peste des petits ruminants.
4. The application according to claim 3, characterized in that, The drug in question is a vaccine.
5. The application according to claim 4, characterized in that, The vaccine also includes a pharmacologically acceptable adjuvant.
6. The application according to claim 5, characterized in that, The vaccine uses the antigen epitope peptide or gene composition as its sole active ingredient.
7. The application of the antigenic epitope peptide recognized by the PPRV HN monoclonal antibody according to claim 3, characterized in that, The gene composition is HN 1D4-4D9 HN 1D4-4D9 The amino acid sequence is shown in SEQ ID NO.
1.
8. The application of the antigenic epitope peptide recognized by the PPRV HN monoclonal antibody according to claim 3, characterized in that, The HN 1D4-4D9 The method for obtaining it is the hybridoma method.