Application of gene GlZn2Cys661 in regulation and control of synthesis of ganoderic acid

By regulating the expression or silencing of the gene GlZn2Cys6_61, the problems of low ganoderic acid content and unclear synthetic network were solved, resulting in a significant increase in ganoderic acid yield and efficient production of various monomeric ganoderic acids, providing a strategy for the industrial application of engineered Ganoderma lucidum strains.

CN121718602APending Publication Date: 2026-03-24ZHEJIANG SCI-TECH UNIV
View PDF 0 Cites 1 Cited by

Patent Information

Application Number
CN202511791250.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-01
Publication Date
2026-03-24

AI Technical Summary

Technical Problem

Existing technologies have low ganoderic acid content and complex traditional extraction processes, making it difficult to meet the needs of clinical applications. The regulatory network for ganoderic acid synthesis has not been fully elucidated, and there is a lack of precise targets.

Method used

By mining the nucleotide sequence of the gene GlZn2Cys6_61, overexpression and gene silencing vectors were constructed to regulate the synthesis of ganoderic acid, including the overexpression vector pw-GlZn2Cys6_61-OE and the RNAi silencing vector pSM-GlZn2Cys6_61-Si, to achieve positive or negative regulation of the gene GlZn2Cys6_61.

Benefits of technology

It significantly increases or decreases the synthesis of ganoderic acids, increases the total triterpenoid content by 32.4%, and significantly accumulates various important monomeric ganoderic acids, providing efficient potential for industrial application and precise control methods.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121718602A_ABST
    Figure CN121718602A_ABST
Patent Text Reader

Abstract

The invention discloses application of a gene GlZn2Cys661 in regulation and control of synthesis of ganoderic acid. The nucleotide sequence of the gene GlZn2Cys661 is as shown in SEQ ID NO. 1. The gene expression is regulated and controlled by constructing an overexpression or silent vector, so that the synthesis of the ganoderic acid is promoted or inhibited, and an effective method is provided for regulating and controlling the yield of the ganoderic acid. The invention relates to the technical field of bioengineering, and discloses an application of a gene GlZn2Cys661 in regulation and control of ganoderic acid synthesis. The invention provides a key gene target and a core engineering strain for efficiently producing ganoderic acid through a metabolic engineering means, and has important application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of bioengineering technology, specifically to the application of the gene GlZn2Cys6_61 in regulating the synthesis of ganoderic acid. Background Technology

[0002] Reishi mushroom, a traditional medicinal and edible fungus, primarily contains ganoderic acids, which are lanostane-type triterpenoids with various pharmacological effects including antitumor, anti-inflammatory, and immunomodulatory properties (Song Hongyan et al., 2025). However, the content of ganoderic acids in natural reishi is extremely low (usually less than 0.1% dry weight), and traditional extraction processes are complex and yield low output, making it difficult to meet the needs of clinical applications (Advances in the Biosynthesis of Ganoderic Acids and Their Derivatives, 2025).

[0003] The biosynthetic pathway of ganoderic acid begins with acetyl-CoA as a precursor, which is converted to the key intermediate lanosterol via the mevalonate (MVA) pathway. Subsequent post-modification reactions, such as oxidation and cyclization, occur through cytochrome P450 enzymes (e.g., the CYP512V2 and CYP5144 family) and glycosyltransferases (Xu Junwei et al., 2025). Currently identified key regulatory genes include squalene synthase (SQS) and 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR). Overexpression of these genes can increase ganoderic acid production by 1.5-6 times (China Journal of Traditional Chinese Medicine, 2025). Key regulatory genes identified so far include squalene synthase (SQS) and 3-hydroxy-3-methylglutaryl-CoA reductase (HMGR). Overexpression of these genes can increase the yield of ganoderic acid by 1.5-6 times (China Journal of Traditional Chinese Medicine, 2025).

[0004] Although transcription factors (such as the bHLH family and Zn2Cys6 type) have been shown to participate in the global regulation of ganoderic acid synthesis (Shouxiangu Research Team, 2025), the specific target genes and mechanisms of action of most regulatory factors remain unclear. In particular, the oxidative modification step downstream of lanosterol involves the synergistic action of multiple P450 enzymes, and its regulatory network has not been fully elucidated, resulting in a lack of precise targets for constructing high-yield strains (Identification and Functional Study of P450 Genes Related to Ganoderic Acid Biosynthesis in Ganoderma lucidum, 2025).

[0005] Therefore, discovering new genes that regulate ganoderic acid synthesis and elucidating their molecular regulatory mechanisms is of great significance for overcoming yield bottlenecks through metabolic engineering. Summary of the Invention

[0006] Therefore, this invention provides an application of the gene GlZn2Cys6_61 in regulating ganoderic acid synthesis. The technical solution provided by this invention is as follows: In a first aspect, the present invention provides the application of the gene GlZn2Cys6_61 in regulating the synthesis of ganoderic acid, wherein the nucleotide sequence of the gene GlZn2Cys6_61 is shown in SEQ ID NO.1.

[0007] The regulation is to promote or inhibit the synthesis of ganoderic acid.

[0008] The application is to promote the synthesis of ganoderic acid by increasing the expression level and / or activity of the gene GlZn2Cys6_61 in Ganoderma lucidum.

[0009] The application is to inhibit the synthesis of ganoderic acid by reducing the expression level and / or activity of the gene GlZn2Cys6_61 in Ganoderma lucidum.

[0010] Secondly, the present invention provides a biomaterial for regulating the synthesis of ganoderic acid, wherein the biomaterial comprises the gene GlZn2Cys6_61 with the nucleotide sequence shown in SEQ ID NO.1. The biomaterial is an expression cassette, a recombinant vector, or a host cell.

[0011] The regulation is achieved by positively or negatively regulating the function of the gene GlZn2Cys6_61 to promote or inhibit the synthesis of ganoderic acid.

[0012] The recombinant vector is an overexpression vector or a gene silencing vector containing the nucleotide sequence shown in SEQ ID NO.1.

[0013] The method for constructing the overexpression vector includes the following steps: (1) Using Ganoderma lucidum cDNA as a template, the coding sequence of the gene GlZn2Cys6_61 was obtained by PCR amplification using primer pairs GlZn2Cys6_61-OE-F (SEQ ID NO.4) and GlZn2Cys6_61-OE-R (SEQ ID NO.5); the nucleotide sequence of the gene GlZn2Cys6_61 is shown in SEQ ID NO.1; the CDS sequence of GlZn2Cys6_61 is shown in SEQ ID NO.40; (2) The pCAMBIA1304-MsdhB empty vector (whose sequence consists of SEQ ID NO.2 and SEQ ID NO.3, respectively) was linearized by single enzyme digestion using the restriction endonuclease Sma I; (3) The PCR product obtained in step (1) is ligated to the linearized vector obtained in step (2) by homologous recombination; (4) The ligation product of step (3) was transformed into competent E. coli cells. After resistance screening and sequencing verification, the correct recombinant overexpression vector was obtained and named pw-GlZn2Cys6_61-OE.

[0014] The method for constructing the gene silencing vector includes the following steps: (1) A specific sequence was selected from the CDS sequence (SEQ ID NO.40) of the gene GlZn2Cys6_61 as a silencing target; the sequence of the silencing target is shown in SEQ ID NO.21. (2) Using Ganoderma lucidum genomic DNA or cDNA as templates, primer pairs GlZn2Cys6_61-Si-Z-HF (SEQ ID NO.22) / GlZn2Cys6_61-Si-Z-HR (SEQ ID NO.23) and GlZn2Cys6_61-Si-F-HF (SEQ ID NO.24) / GlZn2Cys6_61-Si-F-HR (SEQ ID NO.25) were used to amplify the target site by PCR to obtain the forward and reverse fragments. (3) The pSilent-1 plasmid was modified, digested with Not I enzyme, and the oxychlorpyrifos resistance gene MsdhB (SEQ ID NO.8) was inserted to construct the basic silencing vector pSM; (4) The multiple cloning site 2 (MCS2) of the pSM vector was digested with the restriction endonuclease Sph I-HF, and the intermediate vector was constructed by ligating it with the reverse fragment obtained in step (2) through homologous recombination. (5) The multiple cloning site 1 (MCS1) of the intermediate vector obtained in step (4) was digested with the restriction endonuclease SnaB I, and then linked with the forward fragment obtained in step (2) through homologous recombination to finally construct the RNAi silencing vector pSM-GlZn2Cys6_61-Si, which can form a hairpin structure.

[0015] Thirdly, the present invention provides a Ganoderma lucidum engineered strain, which is obtained by introducing the aforementioned biological material into Ganoderma lucidum.

[0016] The Ganoderma lucidum mentioned is Xianzhi No. 1, Zhejiang (non-Agricultural) Approval No. 2009003.

[0017] The engineered Ganoderma lucidum strain can alter the synthesis level of ganoderic acids by regulating the expression of the gene GlZn2Cys6_61.

[0018] In one embodiment of the present invention, the engineered Ganoderma lucidum strain is a strain that overexpresses the GlZn2Cys6_61 gene. In this strain, the expression levels of the GlZn2Cys6_61 gene and key enzyme genes for ganoderic acid biosynthesis (such as SQS, HMGR, and LS) are significantly upregulated. Its total triterpenoid content is increased by 16.9% to 32.4% compared to wild-type Ganoderma lucidum.

[0019] In another embodiment of the present invention, the engineered Ganoderma lucidum strain is a gene-silenced strain of GlZn2Cys6_61. In this strain, the expression levels of the gene GlZn2Cys6_61 and its downstream key enzyme genes are significantly downregulated, its total triterpenoid content is reduced by 17.3% to 21.2% compared with wild-type Ganoderma lucidum, and the content of various monomeric ganoderic acids (including ganoderic acids C2, C6, G, B, C1 and F) is significantly reduced.

[0020] Fourthly, the present invention provides a method for increasing the content of ganoderic acid in Ganoderma lucidum, the method comprising the step of increasing the expression level and / or activity of gene GlZn2Cys6_61 in Ganoderma lucidum, the nucleotide sequence of gene GlZn2Cys6_61 being shown in SEQ ID NO.1.

[0021] As an embodiment of the present invention, the "increasing the expression level and / or activity of gene GlZn2Cys6_61" is achieved by introducing an overexpression vector of gene GlZn2Cys6_61 into Ganoderma lucidum cells to obtain Ganoderma lucidum engineered bacteria that stably overexpress the gene. Preferably, the overexpression vector is pw-GlZn2Cys6_61-OE.

[0022] Fifthly, the present invention provides a method for reducing the content of ganoderic acid in Ganoderma lucidum, the method comprising the step of reducing the expression level and / or activity of gene GlZn2Cys6_61 in Ganoderma lucidum, the nucleotide sequence of gene GlZn2Cys6_61 being shown in SEQ ID NO.1.

[0023] As an embodiment of the present invention, the reduction of the expression level and / or activity of the gene GlZn2Cys6_61 is achieved by any of the following methods: a) Introduce an RNA interference (RNAi) vector or antisense nucleic acid targeting the gene GlZn2Cys6_61 into Ganoderma lucidum cells to obtain a gene-silencing strain; b) Knock out or inactivate the gene GlZn2Cys6_61 in Ganoderma lucidum cells using gene editing technology.

[0024] Preferably, the RNA interference vector is pSM-GlZn2Cys6_61-Si.

[0025] In a sixth aspect, the present invention provides the application of the gene GlZn2Cys6_61 or the protein encoded therein in regulating the expression of key enzyme genes in the ganoderic acid biosynthesis pathway, wherein the key enzyme genes include at least one of squalene synthase gene (SQS), 3-hydroxy-3-methylglutaryl-CoA reductase gene (HMGR), and lanosterol synthase gene (LS).

[0026] The gene GlZn2Cys6_61 positively regulates the transcriptional expression of the SQS gene by binding to the promoter region of the SQS gene.

[0027] The nucleotide sequence of the gene GlZn2Cys6_61 is shown in SEQ ID NO.1. In a seventh aspect, the present invention provides the application of the gene GlZn2Cys6_61 in the selection of Ganoderma strains that produce high levels of ganoderic acid, the nucleotide sequence of which is shown in SEQ ID NO.1. The applications include: using the sequence of the gene GlZn2Cys6_61 or its expression level as molecular markers to screen naturally occurring Ganoderma lucidum germplasm resources that highly express this gene; or constructing engineered Ganoderma lucidum strains using the methods described above. The nucleotide sequence of the gene GlZn2Cys6_61 is shown in SEQ ID NO.1.

[0028] This invention, through overexpression of the GlZn2Cys6_61 gene, increased the total triterpenoid content of three OE-GlZn2Cys6_61 strains by 16.9%, 21.7%, and 32.4%, respectively. In all three OE-GlZn2Cys6_61 strains, the expression levels of both the GlZn2Cys6_61 and SQS genes were significantly upregulated. In the OE-GlZn2Cys6_61-3 strain, the expression levels of the GlZn2Cys6_61, SQS, HMGR, and LS genes were extremely significantly upregulated. The SQS gene showed the most significant change, with its expression level being 4.39 times that of the WT strain, followed by the GlZn2Cys6_61 gene, which was 3.43 times that of the WT strain. By silencing the GlZn2Cys6_61 gene, the total triterpenoid content in the two Si-GlZn2Cys6_61 strains decreased by 21.2% and 17.3%, respectively, compared to the WT strain. In the Si-GlZn2Cys6_61 strains, the relative expression levels of the GlZn2Cys6_61, SQS, and HMGR genes were significantly decreased. During the primordial stage, in both Si-GlZn2Cys6_61 gene-silenced strains, compared to the WT strain, the content of most ganoderic acids showed a significant decreasing trend in the Si-GlZn2Cys6_61 strains. Among them, the contents of ganoderic acids C2, C6, G, B, C1, and F decreased extremely significantly (p<0.0001), while ganoderic acid B, ganoderic acid D, ganoderic acid A, H, and D2 decreased significantly. Specifically, in these two gene-silencing strains, the content of ganoderic acid C2 decreased by 54.6% and 49.4%, respectively; the content of ganoderic acid C6 decreased by 63.5% and 64.2%, respectively; the content of ganoderic acid G decreased by 57.2% and 54.8%, respectively; the content of ganoderic acid B decreased by 62.3% and 57.9%, respectively; the content of ganoderic acid C1 decreased by 65.0% and 62.7%, respectively; and the content of ganoderic acid F decreased by as much as 80.8% and 69.3%, respectively, showing the most significant reduction effect.

[0029] This invention utilizes RNA-Seq technology to perform transcriptome sequencing analysis on WT and GlZn2Cys6_61 transgenic strains (Si-GlZn2Cys6_61-2). KEGG annotation revealed that DEGs in the Si-GlZn2Cys6_61-2 strain were significantly enriched in the MAPK signaling pathway-yeast, Ribosome biogenesis in eukaryotes, and Cell cycle-yeast pathways. This indicates that these DEGs may play an important role in environmental information processing and metabolism.

[0030] Compared with the prior art, the beneficial effects of the present invention are as follows: 1. This invention is the first to reveal and confirm that the transcription factor gene GlZn2Cys6_61 is a key positive regulatory hub in the ganoderic acid biosynthesis pathway. This provides a novel perspective and an important molecular target for understanding the complex regulatory network of ganoderic acid synthesis.

[0031] 2. Overexpression of this gene directly and efficiently drives the entire synthetic pathway, increasing the total triterpenoid content of the engineered Ganoderma lucidum strain by up to 32.4%, demonstrating enormous potential for industrial application. Simultaneously, gene silencing technology can reversely inhibit synthesis, providing a powerful technical means for precisely controlling Ganoderma lucidum metabolites and preparing Ganoderma lucidum materials with specific component ratios.

[0032] 3. The regulatory effect of this invention is not to simply increase the total content, but to significantly enhance the accumulation of various monomeric ganoderic acids with important biological activities (such as ganoderic acid C2, C6, G, B, etc.), especially providing a new strategy for the efficient production of rare or low-content monomeric ganoderic acids.

[0033] 4. The core molecular mechanism by which GlZn2Cys6_61 performs its function by directly binding to and activating the promoter of the rate-limiting enzyme gene SQS was revealed.

[0034] This invention not only provides a gene sequence, but also provides a complete and mature technical solution from vector construction (overexpression vector, RNAi silencing vector), genetic transformation to screening and identification of engineered strains. It has good reproducibility, strong operability, and is easy for those skilled in the art to implement and apply.

[0035] 5. This gene can serve as an important molecular marker for high-throughput screening of superior Ganoderma lucidum germplasm resources. More importantly, the Ganoderma lucidum engineered strains created with this gene as the core provide core germplasm resources and key technologies for cultivating new Ganoderma lucidum varieties with stable genetic traits and high yield of ganoderic acid without changing cultivation conditions. Attached Figure Description

[0036] Other features, objects, and advantages of the present invention will become more apparent from the following detailed description of non-limiting embodiments with reference to the accompanying drawings: Figure 1 Overexpression during the mycelial stage GlZn2Cys6_61 Total triterpenoid content in the strains; WT is the control, and * in the figure represents a significant difference between the gene overexpression strain and the WT strain; Figure 2 Overexpression during the mycelial stage GlZn2Cys6_61 Relative expression levels of key genes in the strain; WT is the control, and * in the figure indicates a significant difference between the gene-overexpressing strain and the WT strain; Figure 3The total triterpenoid content is shown in the mycelial stage of the gene-silenced strain; WT is the control, and * in the figure indicates a significant difference between the gene-silenced strain and the WT strain. Figure 4 This is a graph showing the relative expression levels of key genes in gene-silenced strains during the mycelial stage; WT is the control, and * in the graph indicates a significant difference between gene-silenced strains and WT strains; Figure 5 The graph shows the analysis of ganoderic acid content in the protogenes stage Si-GlZn2Cys6_61 strain; WT is the control, and * in the graph indicates a significant difference between the gene-silenced strain and the WT strain; Figure 6 Subcellular localization analysis diagram of GlZn2Cys6_61; Figure 7 A yeast one-hybrid analysis diagram of GlZn2Cys6_61 and the SQS promoter; Figure 8 A statistical diagram of differentially expressed genes in the Si-GlZn2Cys6_61 strain during the primordial stage; Figure 9 This is a graph showing the GO enrichment analysis of differentially expressed genes in the Si-GlZn2Cys6_61 strain during the primordial stage. Figure 10 This is a graph showing the KEGG enrichment analysis of differentially expressed genes in the Si-GlZn2Cys6_61 strain during the primordial stage. Figure 11 Figure 1 shows the results of gene expression analysis related to ganoderic acid biosynthesis in the Si-GlZn2Cys6_61 strain during its primordial stage. Figure 12 This is a diagram showing the results of gene analysis related to the growth, development, and environmental adaptation of the Si-GlZn2Cys6_61 strain during its primordial stage. Figure 13 Construct a graph for the silent carrier; Figure 14 The pSilent vector map. Detailed Implementation

[0037] The present invention will be described in detail below with reference to embodiments. These embodiments will help those skilled in the art to further understand the present invention, but do not limit the invention in any way. It should be noted that those skilled in the art can make several adjustments and improvements without departing from the concept of the present invention. These all fall within the protection scope of the present invention.

[0038] In this invention: Gene GlZn2Cys6_61 The sequence is as shown in SEQ ID NO.1; Vector: Gene overexpression vector pCAMBIA1304-MsdhB (abbreviated as pw), the sequence of which includes SEQ ID NO.2 and SEQ ID NO.3 respectively; Gene GlZn2Cys6_61 The CDS sequence is shown in SEQ ID NO.40: Wild Ganoderma: The Ganoderma in this study was Ganoderma lucidum (Xianzhi No. 1, Zhejiang (non-Agricultural) Approval No. 2009003), provided by Zhejiang Shouxiangu Botanical Medicinal Research Institute Co., Ltd. (Hangzhou).

[0039] Reference for Ganoderma lucidum cultivation: DB3715 / T 13-2022 Technical Specifications for Ganoderma lucidum Bag Cultivation Example 1: Obtaining the gene GlZn2Cys6_61 1. Experimental Materials 1.1 Preparation of main experimental solutions and culture media PTC buffer (100 mL): 60 g PEG4000, 0.56 g CaCl2, 1.25 mL 2M Tris-HCl (pH=7.5), add deionized water, and bring the volume to 100 mL.

[0040] STC buffer (100 mL): 100 g sorbitol, 0.112 g CaCl2, 1.25 mL 2M Tris-HCl (pH=7.5), add deionized water, and bring the volume to 100 mL.

[0041] Liquid seed culture medium: 35 g / L L-glucose, 5 g / L Typtone, 2.5 g / L Yeast extract, 0.5 g / L MgSO4·7H2O, 1 g / L KH2PO4, 0.05 g / L Vitamin B1, all components are per liter (L).

[0042] Fermentation medium: 35 g / L Lactose, 5 g / L Typtone, 5 g / L Yeast extract, 0.5 g / L MgSO4·7H2O, 1 g / L KH2PO4, 0.05 g / L Vitamin B1, all components are per liter (L).

[0043] Protoplast regeneration medium (CYM): 20 g / L L-glucose, 10 g / L Maltose, 2 g / L Typtone, 2 g / L Yeast extract, 109.3 g / L Mannitol, 0.5 g / L MgSO4·7H2O, 4.6 g / L KH2PO4, 10 g / L Agar. All components are per liter (L).

[0044] Upper selective medium: Same as CYM medium, but the agar used is low melting point agarose.

[0045] 1.2. Strains and vectors Strains: DH5α competent cells were purchased from Shanghai Weidi Biotechnology Co., Ltd.

[0046] Vector: Gene overexpression vector pCAMBIA1304-MsdhB (abbreviated as pw).

[0047] Ganoderma lucidum: In this study, Ganoderma lucidum was provided by Zhejiang Shouxiangu Botanical Medicine Research Institute Co., Ltd. (Hangzhou).

[0048] 2. Gene cloning and analysis 2.1 Mycelial Culture: Remove the Ganoderma lucidum strain plate from the 4℃ refrigerator, and use a sterile scalpel to cut a 1 cm piece from the edge of the plate. 3 Take small pieces of mycelium, inoculate them onto PDA plates, and incubate at 28°C in the dark for 5-7 days. Once the mycelium has fully colonized the plate, scrape off the Ganoderma lucidum mycelium with the tip of a blue pipette, aliquot it into centrifuge tubes, add 2-3 sample beads, and immediately flash freeze in liquid nitrogen for storage.

[0049] 2.2 Extraction of Total RNA from Ganoderma lucidum Mycelium: The mycelium was ground into powder using a cryogenic grinder at 90 Hz for 60 seconds. RNA was extracted using the Novizan RNA Extraction Kit (RC411), strictly following the instructions. Low temperatures were maintained throughout the extraction process, which was performed in a clean bench. The concentration and purity of the RNA samples were determined using NanoDrop, and the integrity of the RNA samples was checked by electrophoresis. Qualified RNA samples were stored at -80°C.

[0050] 2.3 Synthesis of Ganoderma lucidum cDNA: RNA reverse transcription was performed using the Akerui Reverse Transcription Kit (AG11728). The steps are shown in the table below.

[0051] 2.3.1 Prepare the reaction solution according to Table 1, carry out the gDNA removal reaction, react at 42℃ for 2 min, and store briefly at 4℃.

[0052] Table 1 gDNA Removal System

[0053] 2.3.2. Prepare the reaction solution according to Table 2, react at 37℃ for 15 min, react at 85℃ for 5 sec, and store the obtained cDNA at -20℃ for a long time.

[0054] Table 2 Reverse Transcription Reaction System

[0055] 2.4 Gene cloning: Based on GlZn2Cys6_61 The gene's CDS sequence (SEQ ID NO.40) and the pw vector sequence were used, and Sma I (CCCGGG) was selected as the single restriction enzyme site for the vector. GlZn2Cys6_61 Homologous recombination primers for the gene were designed using Snap Gene 6.0.2 software, and the primer sequences are shown in Table 3.

[0056] Table 3 PCR Primers

[0057] Using the cDNA of the Ganoderma lucidum strain as a template, the above-mentioned homologous recombination primers were used to amplify the DNA. GlZn2Cys6_61 Genes and PCR conditions are shown in Tables 4 and 5.

[0058] Table 4 PCR reaction system

[0059] Table 5 PCR reaction conditions

[0060] The PCR reaction solution was detected by 1% agarose gel electrophoresis, and then the DNA fragments were purified using the Acrylic gel extraction kit (AG21005). The concentration of the DNA fragments was determined and sent for sequencing. The correctly sequenced DNA fragments were used for vector construction.

[0061] Example 2, Target Gene GlZn2Cys6_61 Construction and transformation of overexpression vectors 1. Single enzyme digestion of pw vector The enzyme digestion system of the pw vector is shown in Table 6 below. The digestion was carried out at 37℃ for 1 h. The digestion products were recovered by gel extraction to obtain the linearized vector and the concentration was detected.

[0062] Table 6 Enzyme digestion reaction system

[0063] 2. Homologous recombination to construct overexpression vectors Using the Novizan Bio-Homologous Recombination Kit (C112-01), the linearized vector and the target gene fragment were mixed according to the proportions shown in Table 7. All operations were performed on ice. The larger volume component was added first, followed by the smaller volume component. After mixing by pipetting, the mixture was briefly centrifuged. Subsequently, the mixture was incubated in a PCR instrument at 37°C for 30 min. The resulting recombinant plasmid pw-GlZn2Cys6_61-OE can be directly used for the next transformation experiment.

[0064] Table 7 Recombination Reaction System

[0065] Note: Optimal cloning vector usage (X μL) = [0.02 × number of cloning vector base pairs] ng (0.03 pmol) Optimal insert usage (Y μg) = [0.04 × number of insert base pairs] ng (0.06 pmol) 3. DH5α competent cell transformation Heat shock transformation was performed according to the instructions for DH5α competent cells (Weidi Bio).

[0066] 4. Colony PCR identification Single colonies were picked from the resistant plates and cultured at 37°C and 200 rpm for 2 h. The bacterial culture was then used for PCR identification. The reaction system was prepared according to Table 8 and the PCR amplification program was performed according to Table 9. P1304W-F and P1304W-R were used as primers and Tm was set to 60°C.

[0067] P1304W-F: GACGCAACTAGCGCTCATTG; SEQ ID NO.6; P1304W-R:CGTACGAAGGTTACGAGGTCC;SEQ ID NO.7; Table 8. Bacterial PCR Reaction System

[0068] Table 9. PCR reaction conditions for bacterial culture

[0069] The PCR products were detected by electrophoresis, and 2-3 bacterial cultures with similar band sizes were selected for sequencing analysis.

[0070] 5. Plasmid extraction Add 20 mL of Kana-resistant LB broth to a 50 mL centrifuge tube, then add 200 µL of correctly sequenced bacterial culture to the same tube and incubate overnight. Perform plasmid extraction according to the instructions of the plasmid miniprep kit (DC204-01).

[0071] Example 3: Protoplast preparation and PEG-mediated transformation 1. Preparation of liquid culture of Ganoderma lucidum strain 1.1 Preparation of Plate Culture: Remove the Ganoderma lucidum strain plate from the 4℃ refrigerator, and use a sterile scalpel to cut a 1 cm piece from the edge of the plate. 3 Take mycelial blocks of various sizes, inoculate them into PDA plates, and incubate at 28°C in the dark for 5-7 days; once the mycelium has fully colonized the plate, it is ready for use. 1.2 Preparation of liquid mycelial culture: Add 5 mL of liquid seed culture medium to the plate culture prepared in step 1.1. Scrape off the white mycelium and transfer the mycelial suspension from the plate to a 250 mL Erlenmeyer flask containing 100 mL of seed culture medium. Incubate in the dark at 30℃ and 120 rpm for 4-5 days. Inoculate 4-5 mL of the culture medium into a new 250 mL Erlenmeyer flask containing 100 mL of liquid seed culture medium. Continue to incubate under the same conditions until the mycelial ball diameter is about 0.5 cm, obtaining the Ganoderma lucidum liquid mycelial culture. Use the mycelial balls at this stage to prepare protoplasts.

[0072] 2. Protoplast preparation To avoid protoplast contamination, protoplasts were prepared in a clean bench. Furthermore, to effectively maintain the activity and integrity of the protoplasts, the entire procedure was performed on ice. The specific steps are as follows: 2.1 Take a sterile 50 mL centrifuge tube, add a sterilized small steel ball to the tube, and then add 30 mL of the Ganoderma lucidum liquid culture prepared in step 1. Invert the centrifuge tube to break up the mycelium by colliding with the steel ball, thereby obtaining highly fragmented mycelium.

[0073] 2.2 Transfer the broken mycelium to a new centrifuge tube, place it in a pre-cooled centrifuge at 4°C, centrifuge at 5000 rpm for 15 min, and discard the upper culture medium.

[0074] 2.3 Add 30 mL of mannitol to the precipitate in the centrifuge tube, mix well by pipetting, and then transfer to a new 50 mL centrifuge tube that has already been weighed. Centrifuge under the same conditions as in step 2, retaining the mycelial precipitate.

[0075] 2.4. Pipette 5 mL of mannitol solution into a 10 mL centrifuge tube, add 0.1 g of lysozyme (Merck brand L8757) powder and mix thoroughly. Filter sterilize using a 0.22 µm filter membrane to prepare a 2 wt% lysozyme solution. Add 1 mL of the 2 wt% lysozyme solution to every 0.3 g of mycelial precipitate, mix thoroughly, and incubate at 30℃ with shaking at 100 rpm for approximately 2.5 h. Observe the enzymatic hydrolysis of the mycelium every 30 min.

[0076] 2.5. When the mycelial enzymatic hydrolysis is complete (the end of enzymatic hydrolysis is when no intact mycelia are visible to the naked eye under a microscope), add 30 mL of mannitol solution to the hydrolyzed mycelial solution and invert the container to mix thoroughly. Then, filter the mixed filtrate through a sterile funnel with a 0.22 µm filter cloth (Merck), centrifuge the filtrate, and retain the precipitate.

[0077] 2.6 Add 30 mL of mannitol solution to the precipitate, mix gently, centrifuge at 3000 rpm for 5 min at 4℃, and discard the supernatant.

[0078] 2.7 Add 1 mL of mannitol solution to the precipitate, mix gently, and transfer to a 1.5 mL centrifuge tube to obtain the protoplast solution. Dilute the protoplast solution with pre-cooled mannitol solution, add 10 µL to a hemocytometer, and count under a microscope.

[0079] 3. PEG-mediated transformation 3.1 Dilute the protoplast solution obtained in step 2.7. After dilution, each mL of solution contains 10⁷ protoplasts. Centrifuge at 3000 rpm for 5 min at 4°C, and discard the supernatant.

[0080] 3.2 Add 160 µL STC buffer, 5 µg plasmid (pw-GlZn2Cys6_61-OE), 100 µg heparin sodium, and 5 µL 50 mM spermidine to the precipitate. Gently stir the centrifuge tube by hand to ensure full contact.

[0081] 3.3 Add 50 µL of PTC buffer, mix gently, and incubate on ice for 30 min.

[0082] 3.4 Add 1 mL of PTC buffer, incubate in a water bath at 28°C for 30 min, then centrifuge at 4°C and 4000 rpm for 5 min, and discard the supernatant.

[0083] 3.5 Add 1 mL of pre-cooled mannitol solution, gently mix by pipetting, and then transfer to an antibiotic-free protoplast regeneration medium plate.

[0084] 3.6 Place the plates in a 30℃ incubator and incubate for 12 h. After 12 h, remove the plates and add 5-10 mL of upper selection medium (containing 4 µg / mL carboxin). Continue incubation for 7-15 days until white Ganoderma lucidum transformants appear.

[0085] Example 4: Obtaining and Identifying Overexpression Strains 1. Obtaining and screening transformants Several transformants were selected from the upper selective medium and inoculated into PDA plates containing 4 µg / mL carboxin. After two subcultures (culture conditions: 30℃, subculture every 5-7 days), it was confirmed that the transformants could grow normally. The normally growing Ganoderma lucidum transformants after secondary screening were inoculated into PDA plates and cultured in the dark for 4-5 days.

[0086] 2. PCR identification of transformants DNA was extracted from each Ganoderma lucidum transformant using the Biospin Fungal Genomic DNA Extraction Kit. Using this DNA as a template, the oxychloride resistance gene (primers: Cbxr-F / Cbxr-R) (oxychloride resistance gene MsdhB: SEQ ID NO.8) and the target gene (primers: P1304W-F / P1304W-R) in the recombinant plasmid were amplified. The PCR amplification system is shown in Table 8, and the PCR reaction is shown in Table 9. The PCR products were detected by 1% agarose gel electrophoresis. Positive transformants were selected for subsequent experiments. The positive transformants were identified as gene overexpression strains, and these strains were named OE-GlZn2Cys6_61-1, OE-GlZn2Cys6_61-2, and OE-GlZn2Cys6_61-3, respectively.

[0087] in: Cbxr-F: CCTAAGGCGATTGATTTAGCGGC (SEQ ID NO.9); Cbxr-R: CTCCTAAAGGTACTAGTCCTGCAGG (SEQ ID NO. 10); P1304W-F: GACGCAACTAGCGCTCATTG (SEQ ID NO. 6); P1304W-R: CGTACGAAGGTTACGAGGTCC (SEQ ID NO. 7).

[0088] Example 5: Detection of total triterpenoid content and expression levels of key enzyme genes in the ganoderic acid biosynthesis pathway in overexpression strains during the mycelial stage. The tested strains included: OE-GlZn2Cys6_61-1, OE-GlZn2Cys6_61-2, OE-GlZn2Cys6_61-3, and wild-type strain WT.

[0089] 1. Cultivation and harvesting of Ganoderma lucidum mycelium Plate culture: Same as step 1.1 in Example 3; Primary seed culture: Same as step 1.2 in Example 3; Secondary fermentation broth culture: Break the primary seed liquid with a steel ball, take an appropriate amount of the primary seed liquid and inoculate it into the fermentation medium, and culture at 30℃, 120 rpm, in the dark for 7 days.

[0090] The secondary fermentation broth, cultured for 7 days, was filtered through a Buchner funnel to remove the fermentation medium. The filtered mycelium was then rinsed 2-3 times with deionized water to ensure complete removal of any remaining medium components. After filtration, one-quarter of the mycelium was used for subsequent RNA extraction and sample storage; the remaining mycelium was dried in a 45°C oven.

[0091] 2. Determination of total triterpenoid content in overexpression strains 2.1 Plotting the standard curve: Prepare a 0.1 mg / mL oleanolic acid standard solution: Weigh 10 mg of oleanolic acid standard into a brown beaker, then add 80 mL of anhydrous ethanol and sonicate to dissolve, bringing the volume to 100 mL. Pipette 0, 0.1, 0.2, 0.3, 0.4, and 0.5 mL of the oleanolic acid standard solution into 10 mL glass test tubes, respectively. Incubate at 100℃ for 5-10 min to evaporate the ethanol, then allow to cool to room temperature. Add 0.1 mL of 5% vanillin-glacial acetic acid solution and 0.4 mL of perchloric acid to the glass test tubes, vortex, incubate at 70℃ for 15 min, then in an ice-water bath for 5 min. Finally, add 2 mL of ethyl acetate and measure the absorbance at A548 nm. Plot a standard curve with the mass of oleanolic acid on the x-axis and absorbance on the y-axis. Calculate the total triterpenoid content based on the standard curve. The standard curve and content calculation formula are as follows: y = 11.258x + 0.0758, R 2 =0.9996 .

[0092] 2.2 Determination of Triterpenoid Content in Samples Sample preparation: Place the dried mycelium in a centrifuge tube, add 2-3 steel balls, and grind the dried mycelium into a fine powder using a cryogenic grinder. Weigh 25 mg of the finely powdered Ganoderma lucidum sample into a 2 mL centrifuge tube using a 0.01% balance, add 1.5 mL of 95% ethanol, incubate at room temperature for 2 h, shake several times every 30 min, sonicate for 30 min, and centrifuge at 4000 rpm for 15 min. Transfer 200 µL of the supernatant to a glass test tube (3 replicates per sample), evaporate the ethanol in a boiling water bath, and perform subsequent steps as with the standard solution determination. The results of the triterpenoid content determination are as follows: Figure 1 As shown.

[0093] 3. Detection of expression levels of key enzyme genes in the ganoderic acid biosynthesis pathway in overexpression strains Weigh 0.1 g of Ganoderma lucidum mycelium and extract RNA and reversed cDNA according to steps 2.2 and 2.3 of "Example 1". Real-time fluorescence quantitative PCR was performed on key enzyme genes (HMGR, SQS, LS) in the ganoderic acid biosynthesis pathway. The reaction system is shown in Table 10. Ganoderma lucidum 18S was used as an internal reference gene, and a 2... ΔΔCt The relative expression levels of key enzyme genes were calculated using a quantitative real-time PCR method. Primers for this method are shown in Table 11, and graphing was performed using GraphPad Prism 9.5. The results of detecting the relative expression levels of key genes in the mycelial stage overexpression strains are shown below. Figure 2 As shown.

[0094] Table 10. Real-time PCR reaction system

[0095] Table 11 Primer list for quantitative real-time PCR

[0096] Example 6: Determination of ganoderic acid content in primordia-stage overexpression strains 1. Cultivation of Ganoderma lucidum and harvesting of Ganoderma lucidum during the primordia stage Strains: Ganoderma lucidum engineered strains overexpressing the target gene (numbered: OE-GlZn2Cys6_61-1, OE-GlZn2Cys6_61-2, OE-GlZn2Cys6_61-3) and wild-type control strains (WT).

[0097] Ganoderma lucidum cultivation: A bag cultivation method is adopted, inoculating the mycelium of the engineered strain of Ganoderma lucidum and the wild-type control strain (WT) into the substrate bags (17 cm × 33 cm in size) and placing them in the cultivation room for cultivation. The temperature of the cultivation room is controlled at 25-27℃, the relative humidity is maintained at 55%-70%, and natural ventilation is provided for 1-2 hours per day.

[0098] Primordial Harvesting: When the Ganoderma lucidum grows to the primordium stage, use a sterilized blade to completely cut it from the mycelium bag, removing the excess parts on both sides and retaining only the middle part. Then, accurately weigh 0.5 g using a balance and place it in an oven to dry at 45℃ for 2-3 days. Transfer the remaining primordium sample to 2 mL centrifuge tubes and freeze at -80℃ for subsequent transcriptome sequencing.

[0099] 2. Preparation of mixed standard solution and primary basal period test solution The mixed standard solution was provided by Shouxiangu Company, with the following concentrations of individual ganoderic acids: 10.24 μg / mL ganoderic acid I, 9.67 μg / mL ganoderic acid C2, 10.33 μg / mL ganoderic acid C6, 10.55 μg / mL ganoderic acid G, 5.46 μg / mL ganoderic acid B, 4.66 μg / mL ganoderic acid N, 11.55 μg / mL ganoderic acid B, 9.74 μg / mL ganoderic acid LM2, 9.74 μg / mL ganoderic acid A, 11.19 μg / mL ganoderic acid H, 10.38 μg / mL ganoderic acid A, 8.63 μg / mL ganoderic acid D2, 11.58 μg / mL ganoderic acid D, 7.13 μg / mL ganoderic acid C1, 7.43 μg / mL ganoderic acid F, and 9.68 μg / mL ganoderic acid C6. μg / mL ganoderic acid triol, 10.7 μg / mL ganoderic acid DM, 7.51 μg / mL ganoderic acid TR.

[0100] Weigh 10 mg of chloramphenicol standard and add 1 mL of 50% methanol to prepare a stock solution. Add 100 μL of the stock solution to 50 mL of methanol and mix well to obtain the internal standard solution. Grind the dried primordial stage Ganoderma lucidum into a fine powder using a cryogenic grinder. Accurately weigh 50 mg into a 2 mL EP tube, add 1 mL of the internal standard solution, vortex to mix, and then sonicate for 30 min (note the low temperature to prevent extract degradation). Centrifuge at 12000 r / min for 10 min. Filter the supernatant using a 0.22 μm organic filter membrane, and add 500 μL of the filtrate to a sample vial to obtain the primordial stage test solution.

[0101] 3. Determination of ganoderic acid content by LC-MS The content of ganoderic acid monomer was determined by LC-MS. Chromatographic conditions: Waters ACQUITY UPLCBEH C18 column (2.1 mm × 100 mm, 1.7 μm). Mobile phase A was 0.1% formic acid aqueous solution; mobile phase B was acetonitrile. Gradient elution conditions were: 0 min, 5% B; 0–1 min, 5%–26.5% B; 1–3 min, 26.5% B; 3–12 min, 26.5%–35% B; 12–14 min, 35%–50% B; 14–17 min, 50%–60% B; 17–20 min, 60%–100% B; 20–22 min, 100% B; 22–30 min, 5% B; 30–32 min, 5% B. Flow rate was 0.2 mL / min, column temperature was 25℃, and injection volume was 2 μL. Mass spectrometry conditions: ESI source. Negative ion mode: Ion source temperature 140℃; nebulization pressure 6.0 bar; cone voltage 35 V; collision energy 20-50 eV; nebulizer gas temperature 450℃; nebulizer gas flow rate 1000 L / h; capillary voltage 2.5 kV; scan range m / z 50~1200. Mass spectrometry data were processed using MassLynx software, and GraphPad Prism 9.5 software was used to analyze the quantitative data of ganoderic acid.

[0102] Example 7 GlZn2Cys6_61 Gene silencing 1. Experimental materials 1.1 Preparation of main experimental solutions and culture media Same as "1.1 of Example 1" 1.2. Strains and vectors Strains: DH5α competent cells were purchased from Shanghai Weidi Biotechnology Co., Ltd.

[0103] Vector: Gene overexpression vector pCAMBIA1304-MsdhB (abbreviated as pw), SEQ ID NO.2.

[0104] Ganoderma lucidum: In this study, Ganoderma lucidum was provided by Zhejiang Shouxiangu Botanical Medicine Research Institute Co., Ltd. (Hangzhou), and the variety was Xianzhi No. 1, Zhejiang (non-)approved bacteria number 2009003.

[0105] pSilent plasmid: purchased from Wuhan Miaoling Biotechnology Co., Ltd.

[0106] 2. Cloning and analysis of silent genes Using Ganoderma lucidum strain cDNA as a template, from GlZn2Cys6_61In the gene sequence, a sequence located in the middle to late stages and approximately 300 bp in length was selected as the silencing region (SEQ ID NO. 21). Forward and reverse primers were designed for the selected silencing region, with lowercase letters indicating homologous sequences on the vector and uppercase letters indicating gene-specific amplification primer sequences, as shown in Table 12 below. The PCR reaction system and conditions are shown in Tables 4 and 5. PCR amplification products were detected by 1% agarose gel electrophoresis, and gel recovery was performed. The electrophoresis results of the PCR products are shown below. Figure 7 As shown.

[0107] Table 12 PCR Primer List

[0108] Example 8, Gene GlZn2Cys6_61 Construction and transformation of the silencing vector (pSM-GlZn2Cys6_61-Si) 1. pSilent plasmid modification In the field of filamentous fungi research, pSilent plasmids are commonly used as silencing vectors, but the HYG resistance they carry has certain limitations in practical applications. This invention innovatively introduces a succinate dehydrogenase iron-sulfur protein subunit SdhB mutation-induced hygroscopic agent resistance system, which exhibits higher screening efficiency, genetic stability, and safety.

[0109] The specific modification steps are as follows: First, use Not I to modify the pSilent vector (as shown in the image). Figure 14 The enzyme was digested with a single enzyme, and the digestion system is shown in Table 13. Then, the digested product was purified, and the purified fragment was homologously recombinated with the oxychloride resistance gene (MsdhB, SEQ ID NO. 8) fragment, and the reaction system is shown in Table 13. Finally, following the steps described in "Example 2", DH5α competent cell transformation, colony PCR identification, and plasmid extraction were performed sequentially. Based on the above operations, a novel silencing vector carrying oxychloride resistance was successfully constructed, named pSM vector (pSilent-MsdhB plasmid map shown in Table 13). Figure 13 ).

[0110] The primers for the MsdhB fragment are as follows: MsdhB-F: AAGCTGGAGCTCCACCG, SEQ ID NO.26 MsdhB-R: GATCCACTAGTTCTAGAGCGGCC, SEQ ID NO.27 Table 13 Enzyme digestion reaction system

[0111] 2. Construction of intermediate carrier The MCS2 region of the pSM plasmid was digested with the restriction endonuclease Sph I-HF, and the digestion system is shown in Table 14. After digestion at 37℃ for 1 h, the plasmid was purified and recovered. The purified and recovered linear plasmid was then combined with... GlZn2Cys6_61 Homologous recombination was performed on the reverse fragment of the gene, and the homologous recombination system is shown in Table 7. Following the steps described in "Example 2", DH5α competent cell transformation, colony PCR identification, sequencing, and plasmid extraction were performed sequentially.

[0112] Table 14 Enzyme digestion reaction system

[0113] 3. Silent carrier structure ((pSM-GlZn2Cys6_61-Si)) The MCS1 region of the intermediate vector was digested with the restriction endonuclease SnaB I. The digestion reaction system is shown in Table 15. Digestion was carried out at 37°C for 1 h. The digestion product was then mixed with... GlZn2Cys6_61 Homologous recombination was performed on the forward fragment of the gene, and the recombination system is shown in Table 7. Following the steps described in "Example 2," DH5α competent cell transformation, colony PCR identification, sequencing, and plasmid extraction were performed sequentially. The vector construction results are shown below. Figure 8 As shown.

[0114] Table 15 Enzyme digestion reaction system

[0115] Example 9: Protoplast preparation and PEG-mediated transformation 1. Preparation of liquid culture of Ganoderma lucidum strain Same as "Example 3"

[0116] 2. Protoplast preparation Same as "Example 3"

[0117] 3. PEG-mediated transformation The basic steps are the same as in Example 3, except that the plasmid in step 3.2 uses the pSM vector constructed in Example 9.

[0118] Example 10: Obtaining and Identifying Silent Strains Same as "Example 4". The obtained silent strains were named Si-GlZn2Cys6_61-1, Si-GlZn2Cys6_61-2, and Si-GlZn2Cys6_61-3, respectively.

[0119] The screening results of Ganoderma lucidum mycelial silencing transformants are as follows: Figure 9 As shown. PCR electrophoresis results of Ganoderma lucidum mycelial silencing transformants are shown below. Figure 10 As shown.

[0120] Example 11: Detection of total triterpenoid content and expression levels of key enzyme genes in the ganoderic acid biosynthesis pathway in mycelial silent strains. The test strains included: Si-GlZn2Cys6_61-2, Si-GlZn2Cys6_61-3; wild-type strains WT and EV (transformed into the empty vector pSM vector without the target gene).

[0121] The test method is the same as in Example 5. The total triterpenoid content in the silent strains during the mycelial stage of the sample is as follows: Figure 3 As shown in the figure. The relative expression levels of key genes in the silencing strains during the mycelial stage of the samples are as follows. Figure 4 As shown.

[0122] Example 12: Determination of monomeric ganoderic acid content in primordia-stage silent strains The test strains included: Si-GlZn2Cys6_61-2, Si-GlZn2Cys6_61-3; wild-type strains WT and EV (transformed into the empty vector pSM vector without the target gene).

[0123] The testing method is the same as in Example 6. The results of the analysis of ganoderic acid content in primordial stage silent strains are as follows: Figure 5 As shown.

[0124] Example 13, Subcellular Localization 1. Amplification of the target fragment Using Ganoderma lucidum strain cDNA as a template, specific primers containing homologous arms were designed based on the multiple cloning site of the pw vector and the GlZn2Cys6_61 gene sequence (Table 16) to amplify the GlZn2Cys6_61-EGFP fusion fragment, the full-length EGFP fragment (fluorescent reporter gene), and the truncated fragment (EGFP1, SEQ ID NO.28), as well as the EGFP fragment (SEQ ID NO.29). The corresponding primers are shown in Table 16, the PCR reaction system is shown in Table 4, and the reaction procedure is shown in Table 5.

[0125] Table 16 PCR Primer List

[0126] 2. Construction of subcellular localization vectors The pw vector was digested and purified according to step 1 of Example 2. Subsequently, using Vazyme's homologous recombination kit (C113), the subcellular localization vector GlZn2Cys6_61-EGFP (composed of SEQ ID NO.1 and SEQ ID NO.29, respectively) was constructed according to the recombination reaction system shown in Table 17. The EGFP1 vector was constructed using the homologous recombination kit (C112).

[0127] Table 17 Recombination Reaction System

[0128] The homologous recombination products were transformed into *E. coli*, and colony PCR was performed using primers P1304W-F / P1304W-R. Two to three single colonies were selected from each plate for sequencing. For successfully sequenced colonies, plasmids were extracted and the bacterial strain was preserved promptly; positive clones (GlZn2Cys6_61-EGFP plasmid and EGFP1 plasmid) were obtained.

[0129] 2. Obtaining and identifying subcellular localized strains The two plasmids were introduced into wild Ganoderma lucidum via PEG-mediated transformation. Two subcellular localization strains were obtained through two rounds of resistance plate screening and PCR identification, as detailed in "Example 3" and "Example 4". They were named GlZn2Cys6_61-EGFP strain and EGFP1 strain.

[0130] 3. Fluorescence microscopy observation WT, GlZn2Cys6_61-EGFP, and EGFP1 strains were inoculated into a solution containing 10 mM CaCl₂. 2 The bacteria were placed in a PDA plate. Then, using sterile forceps, a sterilized coverslip was placed 1-2 cm away from the bacterial block. Once the hyphae had grown onto the coverslip, it was removed with forceps, DAPI solution was added, and the slide was stained in the dark for 10 min. Afterward, the coverslip was rinsed with PBS 2-3 times, 5 min each time. Finally, the prepared slide was observed under the Changguang Chenying S3000 ultrafast three-dimensional fluorescence imaging system. The observation results are as follows: Figure 6 As shown.

[0131] Example 14: Yeast Single-Heteromorph Experiment 1. Construction of pGADT7-GlZn2Cys6_61 vector 1.1 Amplification of the target fragment GlZn2Cys6_61-AD Primers containing homologous arms were designed according to Table 18. Using Ganoderma lucidum strain gene cDNA as a template, the GlZn2Cys6_61-AD fragment (SEQ ID NO.34) was amplified. The PCR reaction system is shown in Table 4, and the PCR reaction procedure is shown in Table 5. The fragment was purified and recovered by 1% agarose gel electrophoresis and sequenced.

[0132] Table 18 PCR Primer List

[0133] 1.2 Construction of pGADT7-GlZn2Cys6_61 recombinant plasmid The pGADT7 vector (purchased from Shanghai Weidi Biotechnology Co., Ltd.) was digested with Sfi I and BamHI, and the digestion products were then purified and recovered. Following the steps shown in "Example 2", the purified pGADT7 fragment was homologously recombinated with the GlZn2Cys6_61-AD fragment, followed by transformation, colony PCR verification, and plasmid extraction, successfully obtaining the pGADT7-GlZn2Cys6_61 recombinant plasmid (including SEQ ID NO.37 and SEQ ID NO.38, respectively).

[0134] 2. Obtaining bait strains 2.1 Amplification of the SQS promoter The SQS promoter region (SEQ ID NO.41) was obtained from the Ganoderma lucidum genome. Specific primers containing the CGG triplet were designed. Using Ganoderma lucidum genomic DNA as a template, the SQS promoter was amplified by PCR. The PCR reaction system is shown in Table 4, and the PCR reaction procedure is shown in Table 5. The target fragment with a length of approximately 200 bp was purified and recovered by 1% agarose gel electrophoresis.

[0135] The primers for SQS are as follows: SQS-F: cttgaattcgagctcggtaccTGATCACCACTATTTGCGAGGAGC; SQS-R: atacagagcacatgcctcgagAGCGGAAGACAGCTTTCCAGG.

[0136] 2.2 Construction of the pSQS-AbAi recombinant vector The pAbAi vector (SEQ ID NO. 39) was double-digested with restriction endonucleases Hind III and Sma I, and the pSQS-AbAi recombinant vector was constructed using homologous recombination. The recombination system is shown in Table 7.

[0137] 2.3 Preparation of linearized recombinant vectors and yeast transformation The pSQS-AbAi recombinant vector was digested with the restriction endonuclease BstB I. The linearized vector was recovered and transformed into the Y1HGold yeast strain (purchased from Weidi Biotechnology, catalog number YC1001). After culturing for 2-3 days, 6-8 white, round yeast colonies were picked and resuspended in 20 µL ddH2O. The yeast cell walls were lysed by alternating freezing in liquid nitrogen for 5 min and water bath at 37°C for 5 min three times. PCR verification was then performed to screen for positive strains (named Y1HGold[pSQS-AbAi]). The positive strain was inoculated into SD / -Ura liquid medium (purchased from Weidi Biotechnology, catalog number YM3104L) and cultured until the OD600 value reached 0.2. The bacterial culture was then diluted 10-fold and 100-fold, respectively. Take 10 µL of stock solution and dilution and spot it onto SD / -Ura plates containing different AbA concentrations (0, 100, 200, 300, 400, 500 ng / mL) to determine the minimum AbA concentration that inhibits the growth of Y1HGold[pSQS-AbAi] strain, and take pictures to record the experimental results.

[0138] 3. Y1H Interaction Verification The preparation and transformation of competent cells were performed according to the instructions of the Super Yeast Competent Cell Preparation and Transformation Kit Plus. In short: Y1HGold[pSQS-AbAi] strain was prepared into competent cells; subsequently, pGADT7-GlZn2Cys6_61 was transformed into the competent cells, and positive clones were screened using SD / -Leu plates. Single colonies were picked, and positive clones were identified according to "Step 2 of Example 14," and then spotted onto SD / -Leu plates with a concentration of 500 ng / mL AbA. The experimental results were photographed and recorded. The experimental results are as follows: Figure 7 As shown.

[0139] Example 15: Transcriptome analysis of Ganoderma lucidum during the primordial stage 1. Experimental materials Three replicates were taken from each of the WT and Si-GlZn2Cys6_61-2 primordia stage lines, for a total of 6 samples.

[0140] 2. Total RNA extraction from Ganoderma lucidum Same as item “Example 1 2.2”.

[0141] 3. cDNA library construction and transcriptome sequencing Wuhan Bena Technology Co., Ltd. (Wuhan, China) was responsible for the total RNA quality control, cDNA library construction, and NovaSeq 6000 S4 transcriptome sequencing of six samples. The specific steps are as follows: Total RNA quality control: The total RNA of the six samples was quantified and quality controlled using the Agilent 2100 Bioanalyzer to ensure that the RNA integrity index (RIN) met the library construction standards.

[0142] cDNA library construction: Library construction was performed using Illumina's standard library construction kit.

[0143] Library amplification and screening: The ligation products were amplified by PCR, and cDNA fragments of appropriate length were screened using AMPure XP beads to finally complete the library construction.

[0144] Transcriptome sequencing: The constructed library was sequenced bidirectionally at the ends (PE150) on an Illumina NovaSeq 6000 platform (S4 flow cell).

[0145] 4. Transcriptome Data Processing 4.1 Data Quality Control: The raw image data files obtained from high-throughput sequencing were converted into raw data through base calling analysis. Subsequently, Fastp (v 0.21.0) was used to filter the raw data, removing sequences shorter than 30 bp, contaminated sequences, low-quality sequences, and sequences with excessively high N-base ratios, generating high-quality clean data. FastQC was then used to assess the quality of the filtered clean data.

[0146] 4.2 Alignment with reference genome: The Clean Data was aligned with the Ganoderma lucidum reference genome using STAR (v 2.7.9a) software, and the results were statistically analyzed.

[0147] 4.3 Quantitative Analysis of Gene Expression Levels: FeatureCounts (1.5.0-p3) was used to calculate the readings mapped to each gene. Then, the FPKM (Factor-to-Kilogram Mass) of each gene was calculated based on its length. FPKM refers to the expected number of segments per thousand base pairs of sequenced transcripts per million base pairs. The results of the expression analysis of genes related to ganoderic acid biosynthesis in the primordial stage of strain Si-GlZn2Cys6_61 are as follows: Figure 11 As shown in the figure. The results of gene analysis related to growth, development, and environmental adaptation of the primordial Si-GlZn2Cys6_61 strain are as follows. Figure 12 As shown.

[0148] 4.4 Screening of Differentially Expressed Genes: Differential expression analysis was performed using DESeq2 (v 1.46.0) software. First, low-expression genes were filtered by CPM value, and the read_count data were standardized. Then, the baseline mean of the sample groups was calculated, and the fold change was determined. Finally, discrete values ​​were estimated using a negative binomial distribution model, the p-value was calculated, and the q-value was obtained after Benjamini-Hochberg correction. The results of differentially expressed gene analysis of the protogenetic Si-GlZn2Cys6_61 strain are shown below. Figure 8 As shown.

[0149] 4.5 Enrichment Analysis: GO enrichment analysis and KEGG enrichment analysis were performed on differentially expressed genes using topGO and clusterProfiler (v 3.14.3) software, respectively. The GO analysis results of differentially expressed genes in the primordial Si-GlZn2Cys6_61 strain are shown below. Figure 9 As shown. The KEGG analysis results of differentially expressed genes in the primordial Si-GlZn2Cys6_61 strain are as follows. Figure 10 As shown.

[0150] The specific embodiments of the present invention have been described above. It should be understood that the present invention is not limited to the specific embodiments described above, and those skilled in the art can make various modifications or variations within the scope of the claims, which do not affect the essence of the present invention.

Claims

1. The application of gene GlZn2Cys6_61 in regulating ganoderic acid synthesis, characterized in that, The nucleotide sequence of the gene GlZn2Cys6_61 is shown in SEQ ID NO.1; the regulation is to promote or inhibit the synthesis of ganoderic acid.

2. A biomaterial for regulating the synthesis of ganoderic acid, characterized in that, The biomaterial contains the gene GlZn2Cys6_61 with a nucleotide sequence as shown in SEQ ID NO.1; the biomaterial is an expression cassette, a recombinant vector, or a host cell.

3. The biomaterial according to claim 2, characterized in that, The recombinant vector contains SEQ ID NO.1 The nucleotide sequence shown is used for overexpression vectors or gene silencing vectors. And / or, the regulation is achieved by positively or negatively regulating the function of the gene GlZn2Cys6_61 to promote or inhibit the synthesis of ganoderic acid.

4. A type of engineered Ganoderma lucidum strain, characterized in that, The Ganoderma lucidum engineered bacteria are obtained by introducing the biological material described in claim 2 or 3 into Ganoderma lucidum.

5. The engineered Ganoderma lucidum strain according to claim 4, characterized in that, The Ganoderma lucidum engineered strain is a strain that overexpresses the GlZn2Cys6_61 gene.

6. The engineered Ganoderma lucidum strain according to claim 4, characterized in that, The Ganoderma lucidum engineered strain is a GlZn2Cys6_61 gene-silenced strain.

7. A method for increasing the content of ganoderic acid in Ganoderma lucidum, characterized in that, The method includes the step of increasing the expression level and / or activity of the gene GlZn2Cys6_61 in Ganoderma lucidum; the nucleotide sequence of the gene GlZn2Cys6_61 is shown in SEQ ID NO.

1.

8. A method for reducing the content of ganoderic acid in Ganoderma lucidum, characterized in that, The method includes the step of reducing the expression level and / or activity of the gene GlZn2Cys6_61 in Ganoderma lucidum; the nucleotide sequence of the gene GlZn2Cys6_61 is shown in SEQ ID NO.

1.

9. The application of the gene GlZn2Cys6_61 or its encoded protein in regulating the expression of key enzyme genes in the ganoderic acid biosynthesis pathway, characterized in that, The key enzyme gene includes at least one of SQS, HMGR and LS; the nucleotide sequence of the gene GlZn2Cys6_61 is shown in SEQ ID NO.

1.

10. The application of the gene GlZn2Cys6_61 in the selection of Ganoderma strains with high ganoderic acid production, characterized in that, The applications include: using the sequence of the gene GlZn2Cys6_61 or its expression level as a molecular marker to screen naturally occurring Ganoderma lucidum germplasm resources that highly express the gene; or constructing Ganoderma lucidum engineered strains by means of the method of claim 7; the nucleotide sequence of the gene GlZn2Cys6_61 is shown in SEQ ID NO.1.

Citation Information

Cited By

  • A ganoderma lucidum hydrophobic protein glhyd694 gene, the encoded protein and application thereof

    CN122256378A