Metal nucleic acid framework nanoscale cascade enzyme, preparation method and application thereof

Abstract

The application relates to the technical field of biosensors, and discloses a metal nucleic acid framework nanocascade enzyme as well as a preparation method and application thereof. The preparation method of the nanocascade enzyme is as follows: nucleotide sequences shown in SEQ ID NO. 1-10 are mixed in an equimolar ratio, annealing reaction is carried out to obtain a metal template DNA nanosheet; the DNA nanosheet is reacted with a metal precursor to obtain the metal nucleic acid framework nanocascade enzyme. The metal nucleic acid framework nanocascade enzyme DNS-Fe has catalase activity, after corresponding aptamers are added, the DNS-Fe can accurately recognize target objects in various interferents, and the accuracy is high; DNS-Pt / Fe has lactic acid oxidase, glucose oxidase and sarcosine oxidase activity; DNS-Ag / Fe has uric acid oxidase activity; the combination of the DNS-Fe and the DNS-Ag / Fe can realize cascade action, replace natural catalase to catalyze hydrogen peroxide to generate free radicals, and the free radicals are reacted with chromogenic substances to generate a color reaction, and the results are easy to observe.

Description

Technical Field

[0001] This invention relates to the field of biosensor technology, and in particular to metal-nucleic acid framework nanocascade enzymes, their preparation methods, and applications. Background Technology

[0002] Existing biosensor technologies face key challenges in detecting metabolites in vivo, including insufficient substrate selectivity, poor structural stability, and catalytic activity that fails to meet practical requirements. These challenges are detailed below:

[0003] 1. Insufficient substrate selectivity and susceptibility to interference: While existing technologies utilize aptamers to enhance target analyte recognition, the binding specificity between aptamers and targets is not fully optimized in the complex environment of biological samples containing multiple substances such as glucose, lactic acid, uric acid, and sarcosine. This leads to cross-recognition, affecting the accuracy of detection results. Furthermore, the cascade catalytic process is susceptible to interference from inherent intermediates in the sample (such as naturally occurring hydrogen peroxide), resulting in positive biases in the detection results. The core reason lies in the lack of a logical regulatory mechanism for the "product relay" characteristics of cascade reactions, making it difficult to effectively distinguish the action pathways of target substrates and interfering substances, thus hindering the accurate identification of target metabolites.

[0004] 2. Poor structural stability and limited fabrication: Traditional metal-nucleic acid nanostructures generally suffer from assembly defects. In sub-1 nanometer periods, the entropy-induced high-dimensional lattice defect rate can reach 70%, and DNA single strands easily embed into adjacent lattices, disrupting structural integrity. Furthermore, the DNA origami structure is limited by the length of the bacteriophage single strand and the base sequence, resulting in weak stability of the assembled metal nanostructures and insufficient electromagnetic field strength, making it difficult to maintain long-term effective detection performance. The root cause of this problem lies in the difficulty of controlling the kinetics of nucleic acid self-assembly. The free swinging of DNA strands in short-period sequences easily leads to misaligned binding. At the same time, the interfacial forces between metal and nucleic acid are difficult to control precisely, causing the composite structure to easily dissociate. Moreover, it is difficult to achieve structural homogenization and stability control during the fabrication process.

[0005] 3. Insufficient catalytic activity leads to conversion difficulties: The catalytic efficiency of existing artificial cascade nanozymes is far lower than that of natural enzymes, and the detection sensitivity is insufficient to meet the needs of clinical and practical applications. The key reason is that the distribution of active sites of metal nanozymes is unreasonable, and the spatial synergy between aptamers and catalytic sites is not fully optimized, resulting in limited cascade catalytic efficiency. This makes it impossible to efficiently complete the catalytic reaction and signal amplification of target metabolites, thus limiting their practical conversion and application in biosensors. Summary of the Invention

[0006] The purpose of this invention is to provide metal-nucleic acid framework nanocascade enzymes, their preparation methods, and applications to solve the aforementioned technical problems.

[0007] To achieve the above objectives, this invention provides a method for preparing metal-nucleic acid framework nanocascade enzymes, comprising the following steps:

[0008] Step 1, Preparation of DNA nanosheets: The nucleotide sequences shown in SEQ ID NO.1-5 and SEQ ID NO.6-10 are mixed in equal molar ratio and annealed to obtain metal-templated DNA nanosheets;

[0009] The sequences of SEQ ID NO.1-5 and SEQ ID NO.6-10 are as follows:

[0010] Tile A:

[0011] A-SC1: GATGGCGAGAGCCTATCGTGATGAACGTACACTGTGAGAATTGACAT (SEQ ID NO. 1);

[0012] A-SC2: CAGACGCTGGTTGATCGCAATATACTACAGGCCAGTTGGGAATGCGG (SEQ ID NO. 2);

[0013] A-ST1: GTAGCGCCGCATTCGGCTCTC (SEQ ID NO.3);

[0014] A-ST2: TGTAGTATATTCAGTGTACGTTCATCACGATAACCAACTGGCC (SEQ ID NO.4);

[0015] A-ST3: GACTGCATGTCAATTCTCAGCGATCAACCAG (SEQ ID NO.5);

[0016] Tile B:

[0017] B-SC1: CGCTACCGTGAACCATAGACTAACTCATACGCTCGACGGACAGCAGC (SEQ ID NO. 6);

[0018] B-SC2: GCAGTCGCGGGACCTGACTTTGTGCATCGAAATCCTCCTGCAACGACT (SEQ ID NO.7);

[0019] B-ST1: CGTCTGGCTGCTGTGGTCCCGC (SEQ ID NO. 8);

[0020] B-ST2: TGCACAAAGTCACCGTCGAGCGTATGAGTTAGTGGATTTCGA (SEQ ID NO.9);

[0021] B-ST3: GCCATCAGTCGTTGCAGGACTATGGTTCACG (SEQ ID NO. 10);

[0022] Step 2, Preparation of metal-based nucleic acid framework nanocascade enzymes: The DNA nanosheets from Step 1 are reacted with the metal precursor to obtain metal-based nucleic acid framework nanocascade enzymes;

[0023] The metal-nucleic acid framework nanocascade enzymes include DNS-Pt / Fe, DNS-Fe, and DNS-Ag / Fe;

[0024] DNS-Fe has catalase activity, DNS-Pt / Fe has lactate oxidase, glucose oxidase and sarcosine oxidase activity, and DNS-Ag / Fe has urate oxidase activity. Combining these with DNS-Fe can achieve a cascade effect.

[0025] The metal precursors include potassium hypochloroplatinate, anhydrous ferric chloride, and silver nitrate.

[0026] Furthermore, the preparation method of DNS-Pt / Fe is as follows: the DNA nanosheets of the metal template are taken out and centrifuged, transferred to a new centrifuge tube, potassium hypochlorous acid platinum, anhydrous ferric chloride, and dimethylamine borane are added, and the reaction is carried out overnight at 25°C and 400 rpm to obtain DNS-Pt / Fe.

[0027] Without the addition of potassium hypochlorous acid platinum, DNS-Fe is obtained. Specifically, the preparation method of DNS-Fe is as follows: the DNA nanosheets of the metal template are taken out and centrifuged, transferred to a new centrifuge tube, anhydrous ferric chloride and dimethylamine borane are added, and the reaction is carried out overnight at 25°C and 400 rpm to obtain DNS-Fe.

[0028] Furthermore, in DNS-Pt / Fe, the concentration of potassium hypochlorous acid platinum was 9 mmol / L, the concentration of anhydrous ferric chloride was 30 mmol / L, and the concentration of dimethylamine borane was 400 mmol / L; the volume ratio of DNA nanosheets: potassium hypochlorous acid platinum: anhydrous ferric chloride: dimethylamine borane was 30 μL: 0.3 μL: 0.15 μL: 0.3 μL.

[0029] In DNS-Fe, the concentration of anhydrous ferric chloride was 30 mmol / L, and the concentration of dimethylamine borane was 400 mmol / L; the volume ratio of DNA nanosheets: anhydrous ferric chloride: dimethylamine borane was 30 μL: 0.15 μL: 0.3 μL.

[0030] Furthermore, the preparation method of DNS-Ag / Fe is as follows: the DNA nanosheets of the metal template are taken out and centrifuged, transferred to a new centrifuge tube, silver nitrate and anhydrous ferric chloride are added, and the reaction is carried out at 4°C and 400 rpm for 1 h. Then sodium borohydride is added, and the reaction is continued at 4°C and 400 rpm overnight to obtain DNS-Ag / Fe.

[0031] Furthermore, in DNS-Ag / Fe, the concentration of silver nitrate was 50 mmol / L, the concentration of anhydrous ferric chloride was 100 mmol / L, and the concentration of sodium borohydride was 150 mmol / L; the volume ratio of DNA nanosheets: silver nitrate: anhydrous ferric chloride: sodium borohydride was 100 μL: 0.3 μL: 0.3 μL: 0.3 μL.

[0032] The present invention also provides a metal-nucleic acid framework nanocascade enzyme, which is prepared by the above-described preparation method.

[0033] This invention also provides the application of the above-mentioned metal-nucleic acid framework nanocascade enzyme in the preparation of a biosensor for detecting metabolites in vivo, wherein the application is not for the purpose of disease diagnosis or treatment; the metabolites in vivo include lactic acid, glucose, uric acid, and sarcosine.

[0034] The present invention also provides a biosensor for detecting metabolites in vivo, comprising the aforementioned metallo-nucleic acid framework nanocascade enzyme and corresponding aptamers for the metabolites in vivo.

[0035] Furthermore, the in vivo metabolites include lactic acid, glucose, uric acid, and creatine.

[0036] Furthermore, the metallo-nucleic acid framework nanocascade enzyme is linked to an aptamer of an in vivo metabolite via an extended chain, the sequence of which is shown in SEQ ID NO.11-14, and the sequence of the aptamer is shown in SEQ ID NO.15-21.

[0037] Specifically, the sequence of the extended chain is as follows:

[0038] Glu, UA, LA-AST3:TTTTTGACAACCACGCTACTG (SEQ ID NO. 11);

[0039] Glu, UA, LA-BST3: TTTTTGACTGACTGCCTACTG (SEQ ID NO. 12);

[0040] Sar-AST3:TTTTTCAGTCAGGCAGTCAGTC (SEQ ID NO.13);

[0041] Sar-BST3:TTTTTCAGTCAGGCAGTCAGTCA (SEQ ID NO. 14);

[0042] The sequence of the aptamers is shown below:

[0043] SPT-LA: CTCTCGACGACGAGTAGCGCGTATGAATGCTTTTCTATGGAGTCGTCTTTTCAGTAGCGTGGTTGTC (SEQ ID NO. 15);

[0044] SPT-Glu: CTCTCGACGACCGTGTGTGTTGCTCTGTAACAGTGTCCATTGTCGTCTTTTCAGTAGCGTGGTTGTC (SEQ ID NO. 16);

[0045] SPT-UA: CTCTCACGACATTACGGGACCTTGCTAAAGGTGGAATTATGTCGTTTTTCAGTAGCGTGGTTGTC (SEQ ID NO. 17);

[0046] SPT-Sar: CTCTCCGGGACGACCACGCAAATACGAATAGTGTGAACGGGAGTCCCGTTTTTTGACTGACTGCCTGACTG (SEQ ID NO.18);

[0047] Mb-LA, Glu: AGTCGTCGAGAG (SEQ ID NO. 19);

[0048] Mb-UA: CTGTCGTGAGAG (SEQ ID NO. 20);

[0049] Mb-Sar:AGTCCCGGAGAG (SEQ ID NO. 21).

[0050] The metal-nucleic acid framework nanocascade enzyme, its preparation method, and its application provided by this invention precisely address and effectively solve the aforementioned deficiencies of existing technologies. Specific advantages are as follows:

[0051] 1. Enhanced substrate selectivity and reduced interference: This invention significantly improves the binding specificity of the aptamer to target metabolites (lactic acid, glucose, uric acid, sarcosine) by optimizing the aptamer sequence (SEQ ID NO. 15-21) and precisely linking the aptamer to the metallo-nucleic acid framework nano-cascade enzyme using an extended strand (SEQ ID NO. 11-14). Simultaneously, the structured design of the metallo-nucleic acid framework constructs an ordered cascade reaction regulation system, clarifying the logical path of "recognition-catalysis-signal output." This effectively distinguishes the action mechanisms of target substrates and interfering substances, avoiding cross-recognition and mitigating interference from inherent intermediate products in the sample. This enables precise identification of target metabolites even in environments with multiple interfering substances, resulting in a significant improvement in detection accuracy.

[0052] 2. Enhanced structural stability and optimized preparation process: This invention uses the nucleotide sequences shown in SEQ ID NO.1-10, and through equimolar mixing and 48-hour annealing, self-assembles into structurally regular DNA nanosheets as metal templates. These templates possess a stable lattice structure, effectively reducing misalignment and embedding issues of DNA single strands. Simultaneously, by precisely controlling the concentration and volume ratio of the metal precursors (potassium hypochlorous acid, anhydrous ferric chloride, and silver nitrate) and reaction conditions (temperature, rotation speed, and reaction time), precise control of the metal-nucleic acid interface forces is achieved. The resulting DNS-Pt / Fe, DNS-Fe, and DNS-Ag / Fe metal-nucleic acid framework nano-cascade enzyme materials exhibit uniform structure and strong stability, overcoming the problems of numerous assembly defects and easy dissociation in traditional metal-nucleic acid nanostructures. Furthermore, the preparation process does not rely on special bacteriophage single strands, making it simple, controllable, and suitable for large-scale preparation.

[0053] 3. Enhanced Catalytic Activity and Improved Practical Transformation: The metal-nucleic acid framework nano-cascade enzyme materials prepared in this invention exhibit multi-functional catalytic activity. DNS-Pt / Fe simultaneously possesses lactate oxidase, glucose oxidase, and sarcosine oxidase activities, while DNS-Ag / Fe exhibits urate oxidase activity. Furthermore, all three materials possess peroxidase activity. Through the rational design of the metal-nucleic acid framework structure, a uniform distribution of active sites is achieved. Simultaneously, the spatial matching between the aptamers and catalytic sites significantly enhances the cascade catalytic efficiency. Its catalytic performance can replace natural enzymes, effectively solving the problem of insufficient catalytic efficiency in traditional artificial nanozymes. Furthermore, this material achieves integrated "recognition-catalysis," with a cascade reaction that efficiently catalyzes hydrogen peroxide to generate free radicals, which then react with chromogenic substances (such as TMB) to produce a distinct colorimetric reaction, allowing the results to be observed with the naked eye. It also exhibits high detection sensitivity (LOD of 0.126 µM for lactate, 0.78 µM for glucose, 0.134 µM for sarcosine, and 0.22 µM for uric acid), meeting the sensitivity requirements of practical detection and significantly promoting its application in biosensors.

[0054] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. Attached Figure Description

[0055] Figure 1 This is a schematic diagram of Tile A and Tile B in an embodiment of the present invention;

[0056] Figure 2 This is a schematic diagram of the assembly of Tile A unit and Tile B unit in an embodiment of the present invention;

[0057] Figure 3 This is a schematic diagram of Tile A and the glucose aptamer in an embodiment of the present invention;

[0058] Figure 4 The images shown are atomic force microscopy images of metal nanosheets in embodiments of the present invention, where A represents DNS-Pt / Fe, B represents DNS-Ag / Fe, and C represents DNS-Fe.

[0059] Figure 5 These are TEM images of metal nanosheets in an embodiment of the present invention, where A is DNS-Pt / Fe, B is DNS-Ag / Fe, and C is DNS-Fe;

[0060] Figure 6The following are the detection results of lactic acid (LA), glucose (GLU), uric acid (UA), and sarcosine (Sar) using metal nanosheets DNS-Pt / Fe and DNS-Ag / Fe in embodiments of the present invention. Wherein A represents lactic acid (LA), ① represents the quantitative determination of lactic acid at different concentrations, with the absorbance value of the reaction solution measured at 652 nm, ② represents the standard working curve plotted based on ①, B represents glucose (GLU), ③ represents the quantitative determination of glucose at different concentrations, with the absorbance value of the reaction solution measured at 652 nm, ④ represents the standard working curve plotted based on ③, C represents sarcosine (Sar), ⑤ represents the quantitative determination of sarcosine at different concentrations, with the absorbance value of the reaction solution measured at 652 nm, ⑥ represents the standard working curve plotted based on ⑤, D represents uric acid (UA), ⑦ represents the quantitative determination of uric acid at different concentrations, with the absorbance value of the reaction solution measured at 652 nm, and ⑧ represents the standard working curve plotted based on ⑦.

[0061] Figure 7 The figures represent the identification results of the electrochemical experiments on metal nanosheets in this embodiment of the invention, where A represents the recognition of lactic acid by DNS-Fe, B represents the recognition of glucose by DNS-Fe, C represents the recognition of uric acid by DNS-Fe, and D represents the recognition of sarcosine by DNS-Fe.

[0062] Figure 8 The figures represent the selectivity results of metal nanosheets in the embodiments of the present invention, wherein A represents the specific recognition of lactic acid by the metal nanosheets, B represents the specific recognition of glucose, C represents the specific recognition of sarcosine, and D represents the specific recognition of uric acid. Detailed Implementation

[0063] The technical solution of the present invention will be further described below with reference to the accompanying drawings and embodiments.

[0064] Unless otherwise defined, the technical or scientific terms used in this invention shall have the ordinary meaning as understood by one of ordinary skill in the art to which this invention pertains.

[0065] Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without inventive effort are within the scope of protection of this invention. Experimental methods in the following embodiments that do not specify specific conditions are generally determined according to national standards. Experimental instruments, equipment, and reagents in the following embodiments that do not specify their sources are all commercially available materials.

[0066] Unless otherwise defined or stated, all technical and scientific terms used in this invention have the same meaning as those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be applied to the methods of this invention.

[0067] The reagents used in this invention are: tris-acetic acid, magnesium acetate, anhydrous ferric chloride, potassium hypochlorous acid platinum, silver nitrate, dimethylamine borane (DMAB), sodium borohydride, phosphate-buffered saline (PBS), 3,3',5,5'-tetramethylbenzidine (TMB), NaAc-HAc buffer solution, horseradish peroxidase (HRP), lactate (LA), glucose (Glu), uric acid (UA), and sarcosine (Sar); the instruments used are: a constant temperature mixer, a T100 Thermal Cycler PCR instrument, a polystyrene foam box, a vortex mixer, and a centrifuge, all of which are commercially available.

[0068] The aptamer designed in this invention can accurately identify target substances among various interfering substances. Furthermore, after incorporating the aptamer into the metallo-nucleic acid framework, this invention can not only identify lactic acid, glucose, uric acid, and sarcosine, but also simultaneously possess lactate oxidase, glucose oxidase, and sarcosine oxidase activities. The synthesis method of DNS-Ag / Fe is also very simple. The metallo-nucleic acid framework can also achieve cascade reactions, replacing natural catalase to catalyze the generation of free radicals from hydrogen peroxide, which then react with chromogenic substances to produce a colorimetric reaction, allowing for visual observation of the results, which is very convenient.

[0069] The following detailed description is provided through examples.

[0070] Example

[0071] (1) Preparation of DNA nanosheets: The nucleotide sequences of Tile A and Tile B (Table 1) were prepared into solutions with a concentration of 2 μmol / L and mixed in Tris-Mg at pH 5.0. 2+ The reaction solution was prepared by adding 400 mM tirs-acetic acid and 100 mmol / L Mg(OAc)2 to a buffer solution. The reaction solution was then placed in a centrifuge tube, sealed with sealing film, and wrapped with tape. The centrifuge tube was then placed in a beaker containing 2 L of boiling water, and the beaker was placed in a sealed polystyrene foam box to allow the boiling water temperature to slowly cool to 25 °C. The annealing treatment lasted for 48 h to obtain DNA nanosheets with a metal template.

[0072] Table 1 shows the nucleotide sequences of Tile A and Tile B.

[0073]

[0074] Figure 1 This is a schematic diagram of Tile A and Tile B units, which are formed by the self-assembly of 5 DNA single strands.

[0075] Figure 2This is a schematic diagram of the assembly of Tile A and Tile B units. The terminal bases of AST3 on Tile A: GACTGC, ASC2: CAGACG, and AST1: GTAGCG are complementary to the terminal bases of BSC2: GCAGTC, BST1: CGTCTG, and BSC1: CGCTAC, respectively, thus binding Tile A to Tile B.

[0076] Figure 3 The connection between Tile A and the aptamer is illustrated using glucose as an example.

[0077] Table 2 Extended strand sequences

[0078]

[0079] Table 3 Aptamer Sequences

[0080]

[0081] (2) Preparation of metal nanosheets (metal-based nucleic acid framework nanocascade enzymes):

[0082] ①Preparation of DNS-Pt / Fe: After annealing the DNA nanosheets with the metal template for 48 hours, centrifuge and accurately transfer the contents to a new centrifuge tube. Add 9 mmol / L potassium hypochlorous acid, 30 mmol / L anhydrous ferric chloride, and 400 mmol / L DMAB. (Add 0.3 μL of potassium hypochlorous acid, 0.15 μL of anhydrous ferric chloride, and 0.3 μL of DMAB per 30 μL of DNA nanosheets). Incubate the centrifuge tube overnight at 25°C and 400 rpm.

[0083] ②Preparation of DNS-Fe: Without adding potassium hypochlorous acid, the other raw materials, proportions and preparation methods are the same as those for DNS-Pt / Fe.

[0084] ③ Preparation of DNS-Ag / Fe: After annealing the metal template DNA nanosheets for 48 hours, centrifuge and accurately transfer them to a new centrifuge tube. Add 50 mmol / L silver nitrate and 100 mmol / L anhydrous ferric chloride, and place the tube in a mixer at 4°C and 400 rpm for 1 hour. Then add 150 mmol / L sodium borohydride and continue to react overnight in a constant temperature mixer at 4°C and 400 rpm (add 0.3 μL silver nitrate, 0.3 μL anhydrous ferric chloride, and 0.3 μL sodium borohydride per 100 μL DNA nanosheets).

[0085] Characterization of metal nanosheets, such as Figure 4 and Figure 5 As shown, Figure 4Atomic force microscopy images of DNS-Pt / Fe, DNS-Ag / Fe, and DNS-Fe. Figure 5 The TEM images of the three are provided by Figure 4 As shown in Figure 5, DNS-Pt / Fe, DNS-Ag / Fe, and DNS-Fe metal nanosheets were successfully synthesized.

[0086] (3) Recognition function of DNS-Fe metal nanosheets (taking LA as an example): LA aptamer (SPT-LA) and Mb (Mb-LA) were added to the synthesized DNS-Fe DNA nanosheets at a ratio of 1:2. The mixture was reacted at 25°C and 400 rpm for 4 hours. The reacted material was placed on polished gold electrodes, and 15 μL of solution was incubated on each gold electrode overnight. After incubation, the electrodes were rinsed once with PBS buffer. Three electrodes were dried to avoid contact with air, and then three electrodes were coated with 10 mM / L LA as the experimental group. The remaining three electrodes were coated with 10 mM / L Glu as the control group. After 1 hour of LA and Glu application, the electrodes were rinsed once with PBS buffer solution containing tween, then rinsed once with PBS buffer solution, dried, and subjected to electrochemical testing. Tests revealed that the electrode with only the material dropped showed an Mb signal, the electrode with LA dropped showed no Mb signal, while the electrode with Glu dropped showed an Mb signal. This demonstrates that DNS-Fe with the LA aptamer added has a recognition effect on LA. Figure 7 Using the same principle, but only changing the aptamer, it can be found that DNS-Fe with the corresponding aptamer can identify the corresponding target.

[0087] The connection method between Tile A and the aptamer is as follows: Figure 3 As shown (using glucose as an example), when encountering the target substance, the target substance will compete with Mb, and eventually Mb will fall off, proving that the aptamer can bind to the material to identify the target substance.

[0088] (4) Lactate oxidase (LOX) catalysis of DNS-Pt / Fe: Prepare 10 mM lactic acid, take 50 μL of LA, add 30 μL of material (DNS-Pt / Fe), place in a constant temperature mixer at 37℃ and 400 rpm for 30 minutes, add a pre-prepared mixture of 100 μL NaAc-HAc buffer solution (20 mmol / L, pH=4) and 50 μL TMB (4 mmol / L). Then add 30 μL of HRP, and the solution turns blue. This indicates that the prepared DNS-Pt / Fe material can react with LA to generate hydrogen peroxide, which then reacts with TMB under the catalysis of HRP to produce a color reaction. This proves that DNS-Pt / Fe has LOX activity. By changing the target compound, we further verified that DNS-Pt / Fe has the activities of glucose oxidase (GOD) and sarcosine oxidase (SOX).

[0089] (5) The verification method for uric acid oxidase activity of DNS-Ag / Fe is the same as that for LOX, GOD and SOX of DNS-Pt / Fe. Only the target substance needs to be replaced with uric acid.

[0090] (6) Peroxidase activity (POD) of DNS-Pt / Fe, DNS-Ag / Fe, and DNS-Fe. When 30 μL of DNS-Pt / Fe, DNS-Ag / Fe, and DNS-Fe were added to a mixed solution of 175 μL NaAc-HAc buffer solution, 22 μL TMB solution, and 30 μL H2O2, respectively, the solution turned blue, proving that the three have peroxidase activity.

[0091] (7) Cascade enzyme action: DNS-Pt / Fe binds with DNS-Fe to achieve a cascade action. It has the enzyme activities of LOX, GOD and SOX, and also has the POD enzyme activity, and DNS-Fe has a recognition function.

[0092] Example 2

[0093] The metal nanosheets DNS-Pt / Fe and DNS-Ag / Fe prepared in Example 1 were used to detect lactic acid (LA), glucose (GLU), uric acid (UA), and sarcosine (Sar). The detection method is as follows: Lactic acid solutions of 0, 0.01, 0.2, 2, 20, 40, 50, 60, 80, 140, 170, 300, 500, 1000, and 2000 μM were prepared. In the first step, 30 μL of DNS-Pt / Fe and 50 μL of lactic acid were added and reacted in a constant temperature mixer at 37°C and 400 rpm for 30 minutes. In the second step, 100 μL of NaAc-HAc buffer solution, 50 μL of TMB solution, and 30 μL of DNS-Pt / Fe were added to the solution from the first step and reacted in a constant temperature mixer at 37°C and 400 rpm for 30 minutes. The absorbance was then measured. Plot the concentration versus absorbance at 652 nm, and then plot a standard curve. The procedure for glucose, creatine, and uric acid is the same.

[0094] The test results are shown in Table 4 and Figure 6 As shown:

[0095] Table 4

[0096]

[0097] From Table 4 and Figure 6The results show that the detection limits (LODs) for lactate (LA), glucose (GLU), uric acid (UA), and sarcosine (Sar) using the metal nanosheets DNS-Pt / Fe and DNS-Ag / Fe are as follows: Lactate (LA) 0.126 µM, Glucose (GLU) 0.78 µM, uric acid (UA) 0.22 µM, and sarcosine (Sar) 0.134 µM. This indicates that the metal nanosheets DNS-Pt / Fe and DNS-Ag / Fe possess high sensitivity.

[0098] Eleven substances were selected to participate in the target analyte competition reaction. Absorbance measurements demonstrated that the metallo-nucleic acid framework with aptamers exhibited good selectivity. The specific procedure was as follows: A clean 96-well plate was prepared, and 100 μL of polylysine (0.001 g in 0.1%–1 mL) was added to each well. The plate was incubated at 37°C for 1 hour. The plate was then washed three times with 300 μL of PBS buffer, ensuring the surface was dry each time. Next, 100 μL of maleic acid (0.5 g / mL) was added to each well. The plate was incubated at 25°C in the dark for 1 hour. The plate was then washed three times with 300 μL of PBS buffer. In the third step, 30 μL of the material was added, and the plate was incubated at 25°C for 3–4 hours. After the reaction, the plate was washed with PBS. Then, 100 μL of the target analyte and 100 μL of the interfering analyte were added to each well, and the plate was incubated at 37°C for 1 hour. The plate was then washed three times with PBS. Finally, 100 μL of NaAc-HAc and 50 μL of TMB were added, and the plate was incubated at 37°C for 30 minutes. The absorbance was then measured. The absorbance at 652 nm was compared. The results are as follows: Figure 8 As shown.

[0099] Therefore, this invention utilizes the aforementioned metal-nucleic acid framework nano-cascade enzyme, its preparation method, and its application. After adding aptamers to the metal-nucleic acid framework nano-cascade enzyme, it can accurately identify target substances among various interfering substances with high accuracy. Simultaneously, the metal-nucleic acid framework nano-cascade enzyme not only possesses lactate oxidase, glucose oxidase, and sarcosine oxidase activities, achieving a cascade effect, but also replaces natural catalase in catalyzing hydrogen peroxide to generate free radicals that react with chromogenic substances, resulting in easily observable results. Furthermore, it can identify lactate, glucose, uric acid, and sarcosine for the detection of metabolites in vivo.

[0100] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can still be made to the technical solutions of the present invention, and these modifications or equivalent substitutions cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.

Claims

1. A biosensor for detecting metabolites in vivo, characterized in that, The invention includes metallo-nucleic acid framework nanocascade enzymes and corresponding aptamers for in vivo metabolites; the metallo-nucleic acid framework nanocascade enzymes are connected to the aptamers for in vivo metabolites via extended chains, the sequences of which are shown in SEQ ID NO.11-14 and the sequences of which are shown in SEQ ID NO.15-21. The preparation method of metal-nucleic acid framework nanocascade enzymes includes the following steps: Step 1, Preparation of DNA nanosheets: The nucleotide sequences shown in SEQ ID NO.1-5 and SEQ ID NO.6-10 are mixed in equal molar ratio and annealed to obtain metal-templated DNA nanosheets; Step 2, Preparation of metal-based nucleic acid framework nanocascade enzymes: The DNA nanosheets from Step 1 are reacted with the metal precursor to obtain metal-based nucleic acid framework nanocascade enzymes; The metal-nucleic acid framework nanocascade enzymes include DNS-Pt / Fe, DNS-Fe, and DNS-Ag / Fe; DNS-Fe has catalase activity, DNS-Pt / Fe has lactate oxidase, glucose oxidase and sarcosine oxidase activity, and DNS-Ag / Fe has urate oxidase activity. The metal precursors include potassium hypochloroplatinate, anhydrous ferric chloride, and silver nitrate.

2. The biosensor according to claim 1, characterized in that, In step 2, the preparation method of DNS-Pt / Fe is as follows: the DNA nanosheets of the metal template are taken out and centrifuged, transferred to a new centrifuge tube, potassium hypochlorous acid platinum, anhydrous ferric chloride, and dimethylamine borane are added, and the reaction is carried out overnight at 25°C and 400 rpm to obtain DNS-Pt / Fe. The preparation method of DNS-Fe is as follows: the DNA nanosheets with metal templates are taken out and centrifuged, transferred to a new centrifuge tube, anhydrous ferric chloride and dimethylamine borane are added, and the reaction is carried out overnight at 25°C and 400 rpm to obtain DNS-Fe.

3. The biosensor according to claim 2, characterized in that: In DNS-Pt / Fe, the concentration of potassium hypochlorous acid platinum was 9 mmol / L, the concentration of anhydrous ferric chloride was 30 mmol / L, and the concentration of dimethylamine borane was 400 mmol / L; the volume ratio of DNA nanosheets: potassium hypochlorous acid platinum: anhydrous ferric chloride: dimethylamine borane was 30 μL: 0.3 μL: 0.15 μL: 0.3 μL. In DNS-Fe, the concentration of anhydrous ferric chloride was 30 mmol / L, and the concentration of dimethylamine borane was 400 mmol / L; the volume ratio of DNA nanosheets: anhydrous ferric chloride: dimethylamine borane was 30 μL: 0.15 μL: 0.3 μL.

4. The biosensor according to claim 1, characterized in that, In step 2, the preparation method of DNS-Ag / Fe is as follows: the DNA nanosheets of the metal template are taken out and centrifuged, transferred to a new centrifuge tube, silver nitrate and anhydrous ferric chloride are added, and the reaction is carried out at 4℃ and 400rpm for 1h. Then sodium borohydride is added, and the reaction is continued at 4℃ and 400rpm overnight to obtain DNS-Ag / Fe.

5. The biosensor according to claim 4, characterized in that, The concentration of silver nitrate was 50 mmol / L, the concentration of anhydrous ferric chloride was 100 mmol / L, and the concentration of sodium borohydride was 150 mmol / L; the volume ratio of DNA nanosheets: silver nitrate: anhydrous ferric chloride: sodium borohydride was 100 μL: 0.3 μL: 0.3 μL: 0.3 μL.

6. The biosensor according to claim 1, characterized in that: The metabolites in the body include lactic acid, glucose, uric acid, and creatine.

Images