Method for efficiently screening gene knockout cells based on CRISPR-Cas13d system

Abstract

The invention discloses a CRISPR-Cas13d (clustered regularly interspaced short palindromic repeats-associated protein 13d) system as well as a construction method and application of the CRISPR-Cas13d system. The invention further provides a method for efficiently screening gene knockout cells based on the CRISPR-Cas13d system. According to the method, an endogenous molecular marker, namely target gene transcript deletion caused by a gene knockout event, is creatively utilized and is combined with'incidental activity 'which is specific to a CRISPR-Cas13d system and depends on target RNA activation, so that automatic and specific enrichment of successfully knocked-out cells is realized in a cell culture process.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, and particularly relates to a method for efficiently screening gene knockout cells based on a CRISPR-Cas13d system. BACKGROUND

[0002] Today, with the maturation of gene editing technology, obtaining specific gene knockout cell lines has become a routine requirement in life science research and biopharmaceutical development. However, how to efficiently screen out cell clones successfully knocking out target genes from a large number of cells has always been a technical bottleneck that puzzles researchers. The current mainstream method relies on a single clone screening strategy: obtaining a single cell clone through limiting dilution, and then extracting the genome of each clone, amplifying by PCR and verifying by sequencing one by one. This process not only takes a long time of four to eight weeks, but also requires a large amount of manpower and material resources, and usually hundreds of clones are screened to obtain only a few homozygous knockout strains. This inefficient screening method seriously restricts the progress of gene function research and limits the application scenarios that require rapid construction of gene knockout cell models.

[0003] To improve the screening efficiency, researchers have tried to introduce exogenous screening markers. For example, adding a fluorescent protein gene or an antibiotic resistance gene to the editing vector, trying to enrich edited cells through fluorescence sorting or drug screening. However, these methods have inherent defects: the introduction of exogenous genes may change the inherent properties of cells, and in therapeutic applications, there are safety hazards; the expression of fluorescent proteins is easily silenced by the genomic location; antibiotic screening can only select cells that have been successfully transfected, and cannot distinguish whether the expected gene editing has occurred. These methods have not fundamentally solved the contradiction between screening specificity and efficiency.

[0004] In recent years, Cas13 proteins, especially Cas13d variants, in the CRISPR system family that target RNA have attracted much attention due to their compact size and high knockdown efficiency. In-depth studies have revealed a unique property of Cas13d: when targeting high-abundance RNA, its activated non-specific RNase activity can cause widespread transcriptome degradation, thereby inhibiting cell proliferation and even causing cell death, a phenomenon known as "collateral activity." For example, Konermann mentioned that the Cas13d system has high knockdown efficiency when targeting RNA, and also first explicitly described its collateral activity when targeting high-abundance RNA, indicating that Cas13d is a double-edged sword, and its strong cytotoxic side effects have laid the foundation for its subsequent creative applications (Konermann, S., Lotfy, P., Brideau, N. J., Oki, J., Shokhirev, M. N., & Hsu, P. D. Transcriptome Engineering with RNA-Targeting Type VI-D CRISPR Effectors. Cell, 2018, 173(3), 665-676.e14.). Further mechanism studies by Wessels revealed that in human cells, the collateral activity was characterized in detail, causing global mRNA degradation, translation inhibition, and ultimately cell death, indicating that this activity has clear abundance dependence and strong killing efficiency (Wessels, H. H., Stirn, A., Méndez-Mancilla, A. et al. Prediction of on-target and off-target activity of CRISPR–Cas13d guide RNAs using deep learning. Nature Biotechnology, 2024, 42, 628-637.). Interestingly, this property shows transformative potential in specific scenarios, as Shi showed that targeting HIV viral RNA with Cas13d not only directly inhibits the virus, but the collateral activity triggered by it can also help clear infected cells (Shi, P., Murphy, M. R., Aparicio, A. O. et al. Collateral activity of the CRISPR / RfxCas13d system in human cells. Communications Biology, 2023, 6, 334.).

[0005] However, in traditional studies for specific gene knockdown, such collateral activity is usually regarded as a side effect that needs to be avoided, and its potential positive application value has not been fully explored. It is worth noting that although Cas13d systems have been widely used in RNA function and regulation research, so far, no research report or technical solution has attempted to use Cas13d systems and their collateral activity characteristics to screen gene knockout cells.

[0006] The gene knockout event itself will cause the most direct molecular change - the absence of the target gene transcript. This endogenous RNA level difference provides a natural basis for selective screening. Unfortunately, existing technologies completely rely on individual clone verification after physical separation, and do not take advantage of the molecular differences caused by gene knockout events to achieve biological screening. Combining the transcript absence caused by gene knockout with the characteristics of Cas13d is expected to open up a new screening path, which is the core problem to be solved and the starting point of technical innovation of the present application. SUMMARY

[0007] The first object of the present application is to provide a CRISPR-Cas13d system and a construction method thereof.

[0008] The second object of the present application is to provide a gene knockout cell containing the system.

[0009] The third object of the present application is to provide an efficient screening method based on the CRISPR-Cas13d system, based on the technical bottlenecks of existing gene knockout cell screening technologies, such as complicated process, low efficiency, and easy introduction of exogenous interference. The core idea of the method is to creatively use the endogenous molecular marker of target gene transcript absence caused by gene knockout event, and combine it with the "collateral activity" unique to the CRISPR-Cas13d system, which depends on target RNA activation, so as to realize the automatic and specific enrichment of successfully knocked out cells during cell culture.

[0010] Technical scheme: In order to solve the above problems, the present application provides a CRISPR-Cas13d system, which comprises:

[0011] (a) an expression element encoding a Cas13d protein or a functional variant thereof; and

[0012] (b) an expression element encoding at least one crRNA, which is designed to specifically target the mRNA transcript of the target gene, preferably the sequence of the crRNA is shown as SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3 or SEQ ID NO. 4.

[0013] The application also provides a construction method of the CRISPR-Cas13d system, comprising the following steps: constructing crRNA into a plasmid containing a Cas13d protein expression frame to obtain the same, preferably the sequence of the crRNA is shown as SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3 or SEQ ID NO. 4.

[0014] Preferably, the plasmid containing the Cas13d protein expression frame is VB287.

[0015] Preferably, the sequence of the CRISPR-Cas13d system is shown as SEQ ID NO. 5.

[0016] The application also provides a gene knockout cell containing the CRISPR-Cas13d system.

[0017] The application also provides an application of the CRISPR-Cas13d system in efficient screening of gene knockout cells.

[0018] The application also provides a method for efficient screening of gene knockout cells based on the CRISPR-Cas13d system, comprising the following steps:

[0019] (1) introducing the CRISPR-Cas9 system into target cells for specific cutting or editing of target genes to obtain treated cells;

[0020] (2) introducing the CRISPR-Cas13d system into the cells treated in step (1) and culturing the cells; the system is obtained by constructing crRNA into a plasmid containing a Cas13d protein expression frame;

[0021] (3) inoculating the surviving cells after step (2) and culturing them into single clones, extracting the genome for PCR identification, and the homozygous cell clones are the cells in which the target gene is successfully knocked out.

[0022] In step (1), the target cells include SiHa cells, SiHa cell hGLYR1 knockout homozygous cells, HCT116 cells, MDA-MB-231 cells, Mv-4-11 cells, 293T cells, BXPC-3 cells or other animal cells or human cells.

[0023] The target gene in step (1) includes hGLYR1 gene, hSLC2A3 gene, hCPB1 gene, hMMP1 gene or other arbitrary genes.

[0024] The introduction mode of step (1) and step (2) is electroporation, preferably, the introduction time of step (2) is 24 hours or more than 24 hours after the treatment of step (1). Preferably, the treatment time is 24-120 hours, and more preferably, the treatment time is 24-72 hours.

[0025] The step (3) includes the following steps: designing primer pair 1 for sgRNA1 of the target gene, primer pair 2 for sgRNA2 of the target gene and primer pair 3 for sgRNA1 and sgRNA2 of the target gene, respectively, and performing PCR amplification on all surviving cells by using the three pairs of primers. If primer pair 1 and primer pair 2 do not amplify wild-type PCR products, and primer pair 3 only amplifies PCR products corresponding to the sequence deletion between the two sgRNAs, it is determined that the single clone is homozygous deletion, and the surviving cell is a homozygous cell in which the target gene is successfully knocked out. If primer pair 1 and primer pair 2 amplify PCR products consistent with the wild-type control, and primer pair 3 amplifies wild-type size products and shorter products with deletion characteristics, it is determined that the single clone is heterozygous deletion, and the surviving cell is a heterozygous cell. When the three pairs of primers can all amplify PCR products completely consistent with the wild-type control, the surviving cell is a wild-type cell. In the wild-type or non-deleted allele, primer pair 3 can amplify a larger PCR product spanning the entire sgRNA1-sgRNA2 region. If the distance between the two target sites is too large (≥5 kb), it may not be possible to amplify the wild-type band.

[0026] The application also provides the cell obtained by the method for efficiently screening gene knockout cells based on the CRISPR-Cas13d system.

[0027] The present application obtains the final target cells by genome editing, Cas13d screening system introduction, transcript-based biological screening, obtaining and analyzing the enriched cell population. Specifically, the present application first introduces a first CRISPR system into the target cells by conventional gene editing means, which is used for specific cleavage or editing of the genomic DNA of the target gene, thereby achieving functional knockout of the gene. The first CRISPR system is preferably a CRISPR-Cas9 system, and its functional components (such as Cas nuclease and specific sgRNA) can be introduced into cells by plasmid transfection, viral vector infection or ribonucleoprotein complex delivery. After the genome editing event occurs, a second CRISPR system, i.e. a CRISPR-Cas13d system, is introduced into the cells. The CRISPR-Cas13d system comprises: (a) an expression element encoding a Cas13d protein or a functional variant thereof; and (b) an expression element encoding at least one guide RNA (crRNA) designed to specifically target the mRNA transcript of the target gene. The Cas13d protein is activated by its non-specific RNase (incidental) activity after binding to the target mRNA under the guidance of the crRNA, which will cause extensive transcriptome perturbation and cytotoxicity in the cells. The introduction operation is performed within about 24 to 72 hours after step S1 to ensure that the gene editing event has occurred, and the cell population has not been amplified on a large scale; then, the cells introduced with the above system are cultured under suitable conditions. During the culture process, the following selective survival competition occurs: (1) for cells that successfully achieve target gene knockout, the Cas13d-crRNA complex cannot effectively find and activate its incidental activity due to the absence or extremely low abundance of the target gene mRNA transcript, so that the cells can survive and proliferate normally. (2) For cells that have not successfully knocked out the target gene, the continuously expressed target gene mRNA will become an effective target for the Cas13d-crRNA complex, thereby strongly activating the incidental activity of Cas13d, triggering cytotoxicity, and causing the cells to be inhibited or die. This process completely utilizes the differences in the intrinsic molecular state of the cells as the basis for screening, without relying on exogenous antibiotics or fluorescent reporter genes, and can automatically and continuously enrich the cells that have successfully knocked out the target gene from the mixed population under conventional culture conditions. The screening culture period usually lasts for about 5 to 14 days. The screening of the present application is started 48 hours after the first electroporation (CRISPR-Cas9 editing), and the second electroporation (CRISPR-Cas13d editing) is performed to introduce the Cas13d expression plasmid targeting the mRNA of the target gene (e.g. VB287-1). After electroporation, the cells are inoculated into culture vessels and cultured in a normal manner in an incubator. The maintenance phase of the screening of the present application is observed 48 hours after electroporation.Afterwards, the cells are continuously cultured without any physical sorting or drug treatment, only regular medium change and observation. The cells experience growth competition based on the presence or absence of mRNA during the culture: cells that failed to knock out are inhibited from growing / dead due to the activation of Cas13d collateral activity; cells that successfully knocked out are normal proliferating. After a period of culture, the cells are digested and counted. The surviving cells are seeded for single colony culture. After the colonies grow out, the genomes are extracted for PCR identification to assess the proportion of homozygous knockout cells.

[0028] The mechanism of the present application: the present application designs primer pair 1 for sgRNA1 of the target gene, primer pair 2 for sgRNA2 of the target gene, and primer pair 3 for both sgRNA1 and sgRNA2 of the target gene, respectively, wherein the primer pair 1 and the primer pair 2 are used to detect whether the wild-type genomic structure still exists at the target site of sgRNA1 and sgRNA2 in the target gene, respectively; and the primer pair 3 spans the region between the two target sites of sgRNA1 and sgRNA2, and is used to distinguish whether there is a fragment deletion between the two target sites and the corresponding amplified fragment size. In the wild type or allele without deletion, the primer pair 3 can amplify a larger PCR product spanning the complete sgRNA1-sgRNA2 region, and whether the product can be detected depends on the distance between the two target sites and the PCR amplification conditions.

[0029] Advantages: Compared with the prior art, the present application has the following advantages:

[0030] 1. The present application discards the introduction of exogenous reporter genes or resistance markers, and completely utilizes the intrinsic molecular difference of "target gene transcript deletion" caused by the gene editing event itself as the screening basis. The possible cell function interference, expression silencing and safety hazards in clinical application caused by exogenous genes are avoided, and the purity of the cell population characteristics is ensured.

[0031] 2. The traditional single clone screening strategy needs to identify the genotype of dozens to hundreds of independent clones one by one, which has high sequencing and related reagent cost, and the operation is extremely cumbersome. Since the proportion of the target genotype in the cell population after screening is highly enriched, only a small amount of sampling analysis of the mixed cell pool after screening is needed to quickly and reliably confirm the high knockout efficiency of the population. This makes the sequencing cost and workload in the verification link reduced by more than one order of magnitude, greatly saving the research time and funds, and greatly reducing the sequencing cost and workload.

[0032] 3. Screening efficiency is improved: the time-consuming physical screening and sequencing process is changed into automatic biological screening in cell culture process. The efficiency of obtaining homozygous knockout cells is greatly improved, the proportion of target cells in the mixed population is greatly improved, and the screening efficiency is greatly improved.

[0033] 4. The application is suitable for any target gene that can be effectively knocked out and expresses a detectable transcript in principle, showing excellent universality. The technology can seamlessly connect with mainstream gene editing platforms such as CRISPR-Cas9, naturally embedded into the existing workflow, forming a set of efficient and coherent "gene editing-cell screening" integrated solution, which has good applicability and generalizability in different research scenarios and cell types. BRIEF DESCRIPTION OF DRAWINGS

[0034] Figure 1 Figure 1 is a diagram of the PCR identification strategy in Example 1; including designing sgRNA1 and sgRNA2 for the target gene, designing primer pair 1 (region1-F and region1-R) for sgRNA1; designing primer pair 1 (region2-F and region2-R) for sgRNA2; designing primer pair 3 (region3-F and region3-R) for sgRNA1 and sgRNA2;

[0035] Figure 2 Figure 2 is an agarose gel electrophoresis diagram of PCR products of hGLYR1 gene of the same surviving cell in Example 3; M: Marker; Lane 1-2: Representative homozygous knockout monoclonal samples; WT: Unedited wild type monoclonal sample, wherein Figure 2 A in the above is the result of amplification of the surviving cell with primer pair 1, B is the result of amplification of the surviving cell with primer pair 2, and C is the result of amplification of the surviving cell with primer pair 3.

[0036] Figure 3 Figure 2 is an agarose gel electrophoresis diagram of PCR products of hGLYR1 gene of the same surviving cell in Example 3; M: Marker; Lane 1-2: Representative homozygous knockout monoclonal samples; WT: Unedited wild type monoclonal sample, wherein Figure 3 A in the above is the result of amplification of the surviving cell with primer pair 1, B is the result of amplification of the surviving cell with primer pair 2, and C is the result of amplification of the surviving cell with primer pair 3.

[0037] Figure 4 Figure 2 is an agarose gel electrophoresis diagram of PCR products of hGLYR1 gene of the same surviving cell in Example 3; M: Marker; Lane 1-2: Representative homozygous knockout monoclonal samples; WT: Unedited wild type monoclonal sample, wherein Figure 4A is the result of amplification of surviving cells using primer pair 1, B is the result of amplification of the surviving cells using primer pair 2, and C is the result of amplification of the surviving cells using primer pair 3. DETAILED DESCRIPTION

[0038] Example 1 Verification of the screening principle of the Cas13d system

[0039] The Cas13d plasmid was verified for the accompanying activity on wild-type human cervical squamous carcinoma SiHa cells and SiHa cell hGLYR1 knockout homozygotes.

[0040] (1) Design a crRNA targeting the mRNA of the target gene hGLYR1, and concatenate the crRNA sequence: aacccctaccaactggtcggggtttgaaacagtgacggtgtcagcgtccactgaacccctaccaactggtcggggtttgaaacgcgaaagtgatgtcgcaggttgaaacccctaccaactggtcggggtttgaaacattgcctggtaacagacagctgg (as shown in SEQ ID NO. 1);

[0041] (2) Construct the sequence into the plasmid VB287 containing the Cas13d protein expression box (Suzhou Haixing Biotechnology Co., Ltd., Cat# VB287), and the specific steps are as follows: digest VB287 and the concatenated crRNA with restriction enzyme BbsI, then connect to obtain, and after construction, mark as VB287-1 (the complete sequence of VB287-1 is shown in SEQ ID NO. 5);

[0042] (3) The instrument used for electroporation is Neon™ Transfection Instrument (Thermo Fisher Scientific, Cat# MPK5000), and the experimental operation is strictly in accordance with the instrument official website instructions;

[0043] (4) Take the well-grown logarithmic phase SiHa cells (Suzhou Haixing Biotechnology Co., Ltd., Cat# TCH-C326) and SiHa cell hGLYR1 knockout homozygote cells (Suzhou Haixing Biotechnology Co., Ltd., Cat# CGKO-M3516) respectively, digest, centrifuge and remove the supernatant, resuspend (pH 7.2~7.4) with 1×PBS, count and take 1×10 6 cells to EP tubes, centrifuge to obtain cell precipitate;

[0044] (5) Resuspend the cells with electrotransfection buffer (Thermo Fisher Scientific, Cat# 11739010) and add 10 μg of the plasmid VB287-1 or the control plasmid VB287, mix well;

[0045] (6) Input the optimal electrotransfection parameters (1500v, 20ms, 1 pulse), and perform electrotransfection on the mixture, with 3 repeats for each of the experimental and control groups, and ensure the same amount of cells for each group;

[0046] (7) Transfer the electrotransfected cells of each group to a 10cm culture dish, and use the SiHa cell-specific culture medium (Suzhou Haixing Biotechnology Co., Ltd., Cat# TCH-G326) for culture in the incubator, and observe the cell state after 24h, and use a cell counter to count the number of live cells in each group. The statistical results are shown in Tables 1 and 2.

[0047] Table 1 Influence of Cas13d collateral activity on SiHa cell line

[0048] Table 2 Influence of Cas13d collateral activity on SiHa cell hGLYR1 knockout homozygous cells

[0049] The above results show that in wild-type cells, the CRISPR-Cas13d system targeting a specific gene mRNA can trigger strong cytotoxicity due to its collateral activity, resulting in a significant decrease in survival rate to about 22%; while in the knockout homozygous cells of the gene, the same system has no significant toxicity, and the cell survival rate remains at about 88%. This comparison directly proves that the cytotoxicity of Cas13d is strictly dependent on the presence of target mRNA. Therefore, by taking advantage of the endogenous difference caused by gene knockout, the CRISPR-Cas13d system can be used as a specific biological filter: in the mixed cell population after editing, selectively remove cells that have not been successfully knocked out, thereby enriching cells that have been successfully knocked out, thus providing core principle support for the present application.

[0050] Example 2

[0051] The same method as in Example 1 was used to verify the screening principle of the Cas13d system in different cell lines, except that different cell lines were used. The results are shown in Table 3.

[0052] Table 3 Influence of Cas13d collateral cleavage activity on other different cell lines

[0053] The above results show that the Cas13d system (targeting hGLYR1 mRNA) can trigger significant collateral activity in different types of wild-type cells, leading to a significant decrease in cell survival rate. It is proved that the collateral activity of Cas13d has a broad-spectrum cell-killing effect, not limited to a single cell type, thereby verifying the potential of the system as a universal screening tool at the principle level.

[0054] Example 3 Knocking out hGLYR1 gene in SiHa cells and efficiently screening homozygous cells by using Cas13d system

[0055] Experimental design and grouping: To verify the effect of the present application, a total of 9 groups of experiments were set. Groups 1-3: no second treatment, simulating the traditional screening process; Groups 4-6: second time electroporation of empty control plasmid VB287; Groups 7-9: second time electroporation of Cas13d expression plasmid VB287-1 targeting hGLYR1 mRNA (i.e. the method of the present application). The specific process is as follows:

[0056] 1) One sgRNA was designed upstream and downstream of the target gene hGLYR1, and the complete sgRNA was finally synthesized by solid-phase phosphoramidite triester method through continuous cycle of 4 steps of detritylation-activation and coupling-capping-oxidation (sgRNA1: TGTCCGTCTCAGGAGAACTC, sgRNA1: ACACACAGCCACCTCGTCCG);

[0057] 2) Take well-grown SiHa cells in the logarithmic growth phase, digest, centrifuge and remove the supernatant, resuspend and count with PBS, and take 1×10 6 cells to an EP tube, centrifuge to obtain a cell pellet;

[0058] 3) Take 1 μL of each of the two 50 μM sgRNA solutions, mix with 2.5 μL HyCyte® Starfish Cas9 Nuclease Multi-NLS (Suzhou Starfish Biotechnology Co., Ltd., Catalog No. GUCN-R003), add 10 μL of electroporation buffer (Thermo Fisher Scientific, Catalog No. 11739010), and incubate for 20 minutes to form an RNP complex, i.e. to obtain an RNP reaction system. Resuspend the cell pellet after centrifugation in step 2) with 10.5 μL of the same electroporation buffer, and transfer it to the obtained 14.5 μL RNP reaction system, mix evenly by gently blowing, to obtain a mixture;

[0059] 4) Input the optimal electroporation parameters (1500v, 20ms, 1 pulse) to perform electroporation on the mixture obtained in step 3). The electroporation instrument used is Neon™ Transfection System (Thermo Fisher Scientific, Cat# MPK5000), and the specific steps are performed according to the instructions of the instrument.

[0060] 5) Repeat steps 1)~4) for each group according to the above grouping, and a total of 9 groups of cells 1~9 groups are obtained by electroporation.

[0061] 6) Transfer each group of cells after electroporation into a 10cm culture dish and place it in an incubator for culture. Observe the cell state after 48h.

[0062] 7) Groups 1~3 directly enter step 13, and groups 4~9 start from step 8.

[0063] 8) 48h after the first electroporation, digest and centrifuge to remove the supernatant, collect all cells in the culture dish, resuspend with PBS, and centrifuge to obtain cell pellets.

[0064] 9) Resuspend the cells with electroporation buffer and add 10 μg of control plasmid VB287 (groups 4~6) or target plasmid VB287-1 (groups 7~9), and mix thoroughly.

[0065] 10) Input the optimal electroporation parameters (1500v, 20ms, 1 pulse) to perform electroporation on the mixture. Each group is repeated 3 times to ensure that the cell amount is consistent during electroporation.

[0066] 11) Transfer each group of cells after electroporation into the corresponding culture dish and place it in an incubator for culture. Observe the cell state after 48h.

[0067] 12) Digest and count the cells, and inoculate monoclonal cells. Observe the growth state of the clones and replace the liquid in time.

[0068] 13) When the clones grow to a sufficient number, extract the clone sample genome for PCR detection to identify the sgRNA targeting site and knockout band, and determine the number of knockout successful monoclonal cell lines.

[0069] To accurately identify the knockout of hGLYR1 gene, three pairs of PCR primers (see Table 4) were designed for PCR amplification.

[0070] Table 4 PCR primers

[0071] PCR identification strategy was as follows: using 2x P112 Taq Master Mix (Nanjing Novogene Bioinformatics Technology Co., Ltd., item number: P112-01) and the upstream and downstream primers, genomic DNA of each monoclonal was used as a template for PCR amplification. Figure 1 The PCR reaction system was as shown in Table 5, and the reaction procedure was as shown in Table 6.

[0072] Table 5 PCR system

[0073] Table 6 PCR reaction procedure

[0074] Note: 2-4 steps were cycled 35 times

[0075] The PCR products were analyzed by agarose gel electrophoresis, and the results were as shown in Figures 2-4 As shown in Figure 2 , lanes 1 and 2 of A and B in Figure 2 did not amplify the same PCR product as the wild type (lane WT), while lanes 1 and 2 of C in Figure 2 amplified a clear shorter product characteristic of the deletion type, indicating that the surviving cells in lanes 1 and 2 were homozygous cells successfully knocked out; as shown in Figure 3 , lanes 1 of A and B in Figure 3 were consistent with the wild type control (lane WT) and amplified the same band, while lane 1 of C in Figure 3 should have amplified a wild type size product and a shorter product characteristic of the deletion type, but since the distance between the two target sites in this example was too large (≥5 kb), the wild type band could not be amplified, only the shorter product characteristic of the deletion type was amplified, while lane WT of C in Figure 3 also did not amplify the wild type band, which comprehensively inferred that the surviving cells in lane 1 were heterozygous cells. As shown in Figure 4 , lanes 1 of A, B and C in Figure 4 were completely consistent with the amplification results of the wild type control (lane WT), indicating that the monoclonal was a wild type cell. The above results completely met the homozygote determination criteria described in Table 7. To ensure the accuracy of the results, each of the above experiments was repeated 3 times.

[0076] Table 7 PCR homozygote determination criteria

[0077] The identification results of each group in this example were as shown in Table 8.

[0078] Table 8 Experimental grouping and identification results

[0079] From the results of Table 8, it can be seen that the traditional method group (groups 1-3) and the control group (groups 4-6) screened an average of about 174 monoclonals per group, and only obtained an average of about 6.5 homozygous clones; while the method group of the present application (groups 7-9) screened an average of about 178 monoclonals per group, and obtained an average of about 76 homozygous clones. The present application increased the absolute number of homozygous knockout monoclonals by about 11.7 times, and the positive rate increased from an average of about 3.5% to an average of about 42.5%. This example demonstrates that after CRISPR-Cas9 editing, the introduction of a CRISPR-Cas13d system targeting the same gene can serve as an efficient biological filter, increasing the efficiency of obtaining homozygous knockout cells by more than an order of magnitude.

[0080] Example 4 Effect of knocking out hGLYR1 gene in other cell lines

[0081] The hGLYR1 gene was knocked out in other cell lines using a method similar to that of Example 3, and homozygous cells were screened using the Cas13d system. The results are shown in Table 9.

[0082] Table 9 Effect of knocking out hGLYR1 in other cell lines

[0083] From the results of Table 9, it can be seen that in HCT116, MDA-MB-231, Mv-4-11, 293T and BXPC-3 multiple cells, this method can greatly increase the acquisition rate of hGLYR1 gene homozygous knockout cells, with an increase of several times to several tens of times, strongly proving that the "CRISPR-Cas9 editing + Cas13d system screening" integrated strategy proposed by the present application is a reliable method that is efficient, universal and can greatly improve the construction efficiency of gene knockout cells.

[0084] Example 5 Knocking out other genes in SiHa cells and efficiently screening homozygous cells using the Cas13d system

[0085] The crRNAs designed for the mRNA of the target gene are shown in Table 10. Plasmids VB287-2 (for hSLC2A3 gene), VB287-3 (for hCPB1 gene) and VB287-4 (for hMMP1 gene) were constructed using the same method as Example 1. The sequences of plasmids VB287-2, VB287-3 and VB287-4 are identical to plasmid VB287-1 except for the sequence of crRNA.

[0086] Table 10 crRNA sequences corresponding to different genes

[0087] The sgRNA sequence corresponding to different genes is shown in Table 11, and the same method as in Example 3 was used to perform the electroporation experiment to obtain the number of knockout successful monoclonal cell strains.

[0088] Table 11 sgRNA sequence corresponding to different genes

[0089] To accurately identify the knockout of each gene, three pairs of primers for different genes were designed as shown in Table 12, and PCR amplification was performed. The PCR identification method, amplification system and amplification conditions were the same as in Example 3, and the results are shown in Table 13.

[0090] Table 12 PCR primers

[0091] Table 13 Effect of SiHa cell line knockout of other genes

[0092] From the results in Table 13, it can be seen that when knocking out three different genes hSLC2A3, hCPB1 and hMMP1 in SiHa cells, the acquisition rate of homozygous cells was increased by more than ten times (33.05%, 21.49% and 48.74% respectively) after using the method, thereby strongly proving that the method is a universal and efficient screening platform independent of specific target genes.

[0093] SEQ ID NO. 1:

[0094] aacccctaccaactggtcggggtttgaaacagtgacggtgtcagcgtccactgaacccctaccaactggtcggggtttgaaacgcgaaagtgatgtcgcaggttgaaacccctaccaactggtcggggtttgaaacattgcctggtaacagacagctgg

[0095] SEQ ID NO. 2:

[0096] aacccctaccaactggtcggggtttgaaacaaaggaattaagtagcagcattcaacccctaccaactggtcggggtttgaaacaagatccaacaaaccgcagcctt

[0097] SEQ ID NO. 3:

[0098] aacccctaccaactggtcggggtttgaaacAGTCCATGAAAATGGCAGGCTTAaacccctaccaactggtcggggtttgaaacctggattctcagtggcgacttgtaacccctaccaactggtcggggtttgaaacaatattgagcacaggcaggacat

[0099] SEQ ID NO. 4

[0100] aacccctaccaactggtcggggtttgaaacACAAAGAAGTAGGTTTTTCCAGTGTTTaacccctaccaactggtcggggtttgaaacGATGGGCTGGACAGGATTTTGGGAACGaacccctaccaactggtcggggtttgaaacACTGTCACACGCTTTTGGGGTTTGTGG

[0101] SEQ ID NO. 5

[0102]

Claims

1. A CRISPR-Cas13d system comprising: (a) an expression element encoding a Cas13d protein or a functional variant thereof; and (b) an expression element encoding at least one crRNA designed to specifically target the mRNA transcript of the target gene, preferably the crRNA sequence is as shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO.

4.

2. The method of constructing a CRISPR-Casl3d system of claim 1, wherein, The method comprises the following steps: constructing a crRNA into a plasmid containing a Cas13d protein expression frame, preferably the crRNA sequence is as shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO.

4. 3.A gene knockout cell comprising the CRISPR-Cas13d system of claim 1. 4.Use of the CRISPR-Cas13d system of claim 1 in efficient screening of gene knockout cells.

5. A method for efficient screening of gene knockout cells based on CRISPR-Cas13d system, characterized in that, The method comprises the following steps: (1) introducing a CRISPR-Cas9 system into target cells for specific cutting or editing of target genes to obtain treated cells; (2) introducing a CRISPR-Cas13d system into the treated cells of step (1) and culturing the cells; the system is constructed by constructing a crRNA into a plasmid containing a Cas13d protein expression frame; (3) inoculating the surviving cells after step (2) and culturing them into single clones, extracting the genome for PCR identification, and the homozygous cell clones are the cells in which the target gene is successfully knocked out.

6. The method for high-efficiency screening of gene knockout cells based on the CRISPR-Cas13d system according to claim 5, characterized in that, The target cells in step (1) include SiHa cells, SiHa cell hGLYR1 knockout homozygous cells, HCT116 cells, MDA-MB-231 cells, Mv-4-11 cells, 293T cells, BXPC-3 cells or other animal cells or human cells.

7. The method for high-efficiency screening of gene knockout cells based on the CRISPR-Cas13d system according to claim 5, characterized in that, The target genes in step (1) include hGLYR1 gene, hSLC2A3 gene, hCPB1 gene, hMMP1 gene or other genes.

8. The method for high-efficiency screening of gene knockout cells based on the CRISPR-Cas13d system according to claim 5, characterized in that, The introduction method of step (1) and step (2) is electroporation, and the introduction time of step (2) is preferably 24 hours or more after the treatment of step (1).

9. The method for high-efficiency screening of gene knockout cells based on the CRISPR-Cas13d system according to claim 5, characterized in that, The step (3) has the steps that: a primer pair 1 for the sgRNA1 of the target gene, a primer pair 2 for the sgRNA2 of the target gene and a primer pair 3 for the sgRNA1 and the sgRNA2 of the target gene are respectively designed, the three primer pairs are used for PCR amplification of all the surviving cells, if the primer pair 1 and the primer pair 2 do not amplify the wild-type PCR product, and the primer pair 3 only amplifies the PCR product corresponding to the sequence deletion between the two sgRNAs, it is determined that the single clone is homozygous deletion, and the surviving cell is the homozygous cell in which the target gene is successfully knocked out; if the primer pair 1 and the primer pair 2 amplify the PCR product consistent with the wild-type control, and the primer pair 3 amplifies the wild-type size product and the shorter product with the deletion type characteristics, it is determined that the single clone is heterozygous deletion, and the surviving cell is the heterozygous cell; when the three primer pairs can all amplify the PCR product completely same as the wild-type control, the surviving cell is the wild-type cell.

10. The cell obtained by the method for efficiently screening gene knockout cells based on the CRISPR-Cas13d system according to any one of claims 5-9.

Images