Method for improving salt tolerance of wheat by knocking out TaDST gene

Abstract

The invention provides a method for improving the salt tolerance of wheat by knocking out a salt-tolerant gene TaDST. The purpose of improving the salt tolerance of the wheat is achieved by reducing or silencing the TaDST gene expression of the wheat, and the method comprises the following steps: designing two specific sgRNAs which simultaneously target three groups of sequences 5A, 5B and 5D of the DST gene according to sequence information, so that the target site of the gene is mutated and the gene function is deleted, thereby improving the salt tolerance of the wheat. The invention provides a method for improving the salt tolerance of wheat by simultaneously editing three homologous genes of a TaDST gene by utilizing a gene editing technology, and a salt-tolerant wheat plant can be obtained.

Description

Technical Field

[0001] This application relates to the field of biotechnology, specifically to a method that involves knocking out... TaDST Methods to improve wheat salt tolerance through genetic modification. Background Technology

[0002] Soil salinization severely impacts crop growth and yield. Globally, there are approximately 16.5 billion mu (110 million hectares) of salinized land, including 500 million mu (33 million hectares) in my country. Furthermore, with accelerated industrialization, rising temperatures, and drought, the area of ​​salinized land is trending towards further increase, posing a significant threat to food security and sustainable agricultural development.

[0003] Wheat, as one of the world's three major food crops, has significant implications for human life. Cloning wheat salt-tolerance genes and elucidating its molecular mechanisms is crucial, providing the theoretical foundation for breeding new salt-tolerant wheat varieties, effectively utilizing saline-alkali land, and increasing grain yields. It also holds significant importance for ensuring food security, sustainable agricultural development, and social stability.

[0004] DST The gene (drought and salt tolerance) encodes a C2H2-type zinc finger transcription factor involved in regulating H2O2 homeostasis. Rice mutants isolated and cloned by Lin Hongxuan's research group using map-based cloning were validated through transgenic complementation. The results showed that DST is a protein carrying a C2H2-type zinc finger domain of unknown function, with two amino acids mutated in the mutant. dst The mutation of two amino acids in the mutant significantly reduced the transcriptional activation activity of DST. DST protein can affect rice salt tolerance by regulating the opening degree of stomata in rice leaves. As a negative regulator of stress resistance, the loss of DST function directly downregulates the expression of genes related to hydrogen peroxide metabolism, reducing the ability to clear hydrogen peroxide and increasing its accumulation. This leads to stomatal closure, reducing water evaporation, and thus enhancing the stress resistance of rice. OsDST After gene mutation, the salt tolerance of rice is significantly improved. Currently, the salt tolerance of wheat... DST There is limited research on the role of genes under abiotic stress. TaDST No research has been reported on genes that improve wheat salt tolerance.

[0005] Wheat is an allohexaploid crop, composed of three genomes (A, B, and D) with high homology. Using CRISPR / Cas9 gene editing technology, specific sgRNAs were designed based on conserved regions to simultaneously target the ABD genome. This invention provides a method for knocking out wheat... TaDST The gene significantly improved the salt tolerance of wheat, which will have important guiding significance for wheat salt tolerance breeding. SUMMARY

[0006] In view of the deficiencies of the prior art, the present application provides a method for improving the salt tolerance of wheat by knocking out salt-tolerant genes TaDST The present application provides a method for improving the salt tolerance of wheat by simultaneously editing three homologous genes of TaDST5A, TaDST5B and TaDST5D using gene editing technology. TaDST The present application provides a method for improving the salt tolerance of wheat by simultaneously editing three homologous genes of TaDST5A, TaDST5B and TaDST5D using gene editing technology.

[0007] To achieve the above object, the present application realizes the following technical scheme: a wheat TaDST gene, or a wheat TaDST gene encoding protein, or a wheat TaDST application of a gene editing vector of the wheat

[0008] Further, the nucleic acid sequence of the wheat TaDST gene is selected from one or more of the following (a1) and (a2): (a1) the cDNA sequence of the wheat TaDST5A gene shown in SEQ ID No: 1, the cDNA sequence of the wheat TaDST5B gene shown in SEQ ID No: 2, or the cDNA sequence of the wheat TaDST5D gene shown in SEQ ID No: 3. (a2) a nucleotide sequence having a sequence identity of 75% or more with the nucleic acid sequence of SEQ ID No: 1, SEQ ID No: 2 or SEQ ID No: 3.

[0009] Further, the protein encoded by the wheat TaDST gene has an amino acid sequence selected from one or more of the following (b1) and (b2): (b1) the TaDST5A protein sequence shown in SEQ ID No: 4, the TaDST5B protein sequence shown in SEQ ID No: 5, and the TaDST5D protein sequence shown in SEQ ID No: 6.

[0010] (b2) a protein having the same function obtained by substituting, deleting and / or adding one or more amino acid residues in the sequence of SEQ ID No: 4, SEQ ID No: 5 or SEQ ID No: 6.

[0011] A method for improving the salt tolerance of wheat by reducing or silencing the expression of the wheat TaDST gene, the method comprising the following steps: according to the sequence information, designing a gene editing vector for simultaneously targeting the wheat DSTTwo specific sgRNAs in the three sequences of gene 5A, 5B and 5D cause mutations at the target sites of the gene, resulting in loss of gene function and thus increasing the salt tolerance of wheat.

[0012] A method for improving the salt tolerance of wheat includes the following steps: (1) Target DST Design specific sgRNAs at multiple sites in different subgenomes of the gene; (2) The multiple sgRNAs from the previous step are tandemly linked together and then ligated into the pBUE411 vector to become a single transcription unit vector, which can simultaneously knock out wheat germ cells. TaDST5A, TaDST5B and TaDST5D pBUE411-DST binary vector for gene function; (3) The constructed vector was transformed into wheat using Agrobacterium to obtain wheat DST Wheat mutants with lost gene function can be obtained with improved salt tolerance.

[0013] A type of wheat knockout DST The pBUE411-DST binary vector for the gene, which has the function of knocking out wheat TaDST The pBUE411-DST binary vector for gene function includes expression cassette A and expression cassette B; The expression cassette A, from upstream to downstream, specifically includes the following components in sequence: the TaU3 promoter A from wheat, the... TaDST The gene's sgRNA and terminator A; The expression box B, from upstream to downstream, specifically includes the following components: the promoter B, the corn Cas9 encoding sequence, and the terminator B.

[0014] Application of transgenic cell lines or recombinant bacteria containing the pBUE411-DST binary vector in the cultivation of wheat with improved salt tolerance.

[0015] Application of pBUE411-DST binary vector in the breeding of salt-tolerant wheat.

[0016] This invention constructs a system that can achieve specific guidance single-stranded sgRNA design. TaDST5A , TaDST5B and TaDST5D Expression vectors that edit three homologous genes can simultaneously knock out wheat. TaDST Three copies of a gene. TaDST In wheat, the gene is located at 5A, 5B, and 5D, and is named as follows: TaDST5A , TaDST5B and TaDST5DThe full length of the genomic sequence on 5A, 5B and 5D is 873, 891 and 819 bases respectively, and the three homologous genes are all composed of one exon without intron. TaDST5A , TaDST5B , TaDST5D The open reading frames with 873, 891 and 819 bases respectively encode polypeptide chains with 290, 296 and 272 amino acid residues respectively. TaDST5A , TaDST5B , TaDST5D The similarity of the coding regions among the three homologous genes is very high, which provides a theoretical basis for simultaneously knocking out the three sites by using gene editing technology.

[0017] Beneficial effects: In practical application, by one gene transformation process, the genome level TaDST gene knockout can be realized. TaDST The gene knockout is to knockout TaDST the three homologous genes by using gene engineering technology. BRIEF DESCRIPTION OF DRAWINGS

[0018] Figure 1 The design diagram of the target site of the CRISPR / Cas9 gene editing vector of the gene is shown. TaDST Figure 2 The Bar test strip is used for detecting the transgenic wheat plants. Figure 3 The editing type of the target site of the gene editing plant is shown. TaDST Figure 4 The seed germination rate under the same salt concentration treatment is shown. Figure 5 The salt tolerance phenotype of the wheat seedling stage under salt stress is shown. DETAILED DESCRIPTION

[0019] In order to make the purposes, steps and advantages of the embodiments of the present application clearer, the steps in the embodiments of the present application will be described clearly and completely below in combination with the drawings in the embodiments of the present application. Obviously, the described embodiments are only some of the embodiments of the present application, not all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor are within the protection scope of the present application.

[0020] ​​The following examples facilitate a better understanding of the present application, but do not limit the present application. The experimental methods in the following examples are conventional methods, unless otherwise specified. The test materials used in the following examples are commercially available from conventional biochemical reagent stores, unless otherwise specified. In the quantitative tests in the following examples, three repeated experiments were set, and the results were averaged. The high-fidelity enzyme required for PCR amplification, T4 ligase required for DNA fragment ligation, gel recovery kit required for enzyme-digested fragment recovery, and plasmid extraction kit were purchased from Dalian Baosheng Biotechnology Co., Ltd. The plasmid extraction kit was purchased from Tiangen Biotech, the inorganic salts required for medium preparation were purchased from the National Pharmaceutical Group, and the vitamins, antibiotics, and hormones were purchased from Sigma Company. The plant CRISPR / Cas9 gene editing vector is pBUE411, which contains the wheat U3 promoter TaU3 to initiate sgRNA, and Cas9p simulates the characteristics of higher 5' end GC content of grass plant genes, which is a plant optimized codon gene designed and synthesized. The E. coli strain used in the laboratory is E. coli DH5α.

[0021] T4 ligase, DNA Marker DL2000, etc. were purchased from Takara Company; FastPfu, 2*Taq Mix, DH5α, etc. were purchased from Beijing Quanshi Gold Company; restriction endonuclease Bsa I-HF was purchased from NEB Company; the primers used were synthesized by Qingdao Qinkexi Biotechnology Co., Ltd., and the sequences are as follows: Table 1 Primers used in this study

[0022] Wheat variety JW1 is a new germplasm with good tissue culture ability selected by Crop Institute of Shandong Academy of Agricultural Sciences, which is available from Crop Institute of Shandong Academy of Agricultural Sciences.

[0023] Plasmid pBUE411 (17430 bp) was provided by Professor Sun Qixin's research group of China Agricultural University; it is available from China Agricultural University.

[0024] Experimental Example 1 Construction of Expression Vector 1. Targeting TaDST Design of sgRNA of Target Gene Two suitable targeting sites were found in the coding region of TaDST gene by using the website CRISPRdirect (http: / / crispr.dbcls.jp / ), and 20 bp sequence fragments were found before PAM structure to set as target sequences, TaDST The sgRNA sequence of CGG CACAAGAAGGAGCGCAGCAT and AGAAGGAGCGCAGCATCGGCTGG .

[0025] 2. Synthesis of sgRNA-tRNA sequence The sgRNA-tRNA part was synthesized by Beijing Qianke Biotechnology Co., Ltd. Qingdao Branch, and then amplified by PCR method using the same as a template. The reaction system was 10 μmol / L of upper and lower primers pBUE411-F and pBUE411-R, 1.5 μL each, 25 μL of 2x Mix, and 21 μL of ddH2O. The PCR reaction program was 98°C for 3 min, 98°C for 10 s, 55°C for 5 s, 68°C for 10 s, 35 cycles, and 68°C for 7 min.

[0026] 3. Linearization of pBUE411 vector The pBUE411 vector was digested with endonuclease I, and the linear vector fragment was recovered after electrophoresis. Bsa

[0027] 4. Connection reaction of pBUE411 vector and sgRNA The connection reaction system was 5x ligation Buffer 2 μL, annealed oligo duplex 4 μL, pBUE411 / I 2 ul (100 ng), T4 ligase 1 μL, and ddH2O to 10 μL. The connection reaction was carried out at 25°C for 30 min. Bsa

[0028] 5. Transformation verification The connection product was transformed into E. coli, and the recombinant plasmid was transformed into DH5α competent cells. After culturing on LB (kan) plate until the clones grew out, single clones were picked for bacterial liquid PCR identification and sequencing. The primers used were pBUE411-F and pBUE411-R. The sequencing result detected the target sequence of sgRNA, and the sequencing result showed that the sgRNA expression cassette was successfully constructed and successfully assembled into the pBUE411 dual expression vector, proving that the CRISPR / Cas9 gene editing vector was successfully constructed.

[0029] Experimental Example 2: Transformation of gene editing vector into common wheat 1. Medium preparation: see literature Kan Wang (ed.), Agrobacterium Protocals: Volume 1, Methods in Molecular Biology, vol. 1223 DOI 10.007 / 978-1-4939-1695-5_15, Spring Science+Businedd Media New York 2015​​ 2. Agrobacterium transformation: Take the wheat ear pollinated for about 15 days, take the grain and peel the embryo. The day before the test, shake the agrobacterium suspension, 160r, 28 degrees for 24 hours, after the ear is ready, start preparing the agrobacterium suspension, take 1ml of bacterial solution in 1.5ml centrifuge tube, add 1.4ul of acetyl syringone (0.1M) and mix well. After 5 minutes of infection with the prepared bacterial solution, put it on the co-culture medium, 23 degrees dark culture for 3 days. After co-culture, put it on the rest medium and dark culture for 5 days at 25 degrees. Transfer the callus to screening medium 1. Seal the culture dish with sealing film and dark culture in 25.5 degree incubator for 2 weeks. Cut the callus and transfer it to screening medium 2.

[0030] Seal the culture dish with sealing film and dark culture in 25.5 degree incubator for 2 weeks. After 2 weeks of callus cutting and screening, the callus showing resistance is transferred to the regeneration medium. The resistant callus usually has green sprouts or green spots, or beautiful beige spherical structures.

[0031] Do not transfer the paste-like and brown callus. The callus with hyperplasia can be cut into smaller calli. Small pieces from the same callus should be placed on the same line. Pay attention to the direction of the callus, for example, green sprouts and green spots upward.

[0032] Seal the culture dish and place it in a 25-degree incubator with light (16h) for 2 weeks. After 2 weeks of regeneration, transfer the healthy growing seedlings to new resistant regeneration boxes. When the seedlings grow to a certain size, they can be sampled for detection.

[0033] 3. Transgenic seedling mutant detection Because the T-DNA region of the vector used in this transformation has cas9, bar and gRNA three expression frames, the expression detection of bar gene is very mature, and there is a commercial detection reagent strip. After rough grinding, the sample can be judged whether it contains bar gene within 10 minutes, which is faster and more efficient than PCR amplification. Therefore, we use untransgenic plants as negative control, and use bar gene detection kit quickstixTM to detect T0 transgenic wheat plants, and the specific operation is as follows: Take the transgenic seedlings 3-5cm, put them into 1.5m centrifuge tube, grind them with a grinding rod, then add Buffer 500µL, insert Bar test strip, stand for 5 min, record the data according to the number of test strips, 2 strips represent positive, 1 strip represents negative. The above reagent kit is purchased from Maidesen Technology Co., Ltd.

[0034] The results are as follows: Figure 2As shown, samples 1-8 are T0 generation regenerated seedlings, 9 is a negative control, and 10 is a positive control. Samples 1-8 show two bands, consistent with the result of positive control 10, indicating they are positive seedlings. The numbers 1-8 represent eDST-01, -02, -03, -04, -05, 06, -07, and -08, respectively.

[0035] 4. Specific amplification of target sites and identification of mutants in transgenic plants Successful gene editing requires sequencing for verification. This experiment used the Hi-TOM gene editing site detection kit manufactured by Xi'an Qingxue Biotechnology Co., Ltd. This kit automates the high-throughput library construction process using PCR and directly analyzes the variation information of multiple samples and multiple sites using Hi-TOM online software. Specific primers flanking the target sequence (DST-HF and DST-HR in Table 1) were then used to detect the gene editing site. TaDST Amplification was performed, and the amplified products were then sent to Xi'an Qingxue Biotechnology Co., Ltd. for sequencing after library construction. Target gene. TaDST The wild-type nucleotide sequence is shown in SEQ ID NO.1-3, and its deduced amino acid sequence is as follows: Figure 1 As shown, the nucleotide sequence of the target gene can also be obtained after sequencing the mutant, and its deduced amino acid sequence is as follows. Figure 2 As shown. Mutation types at sgRNA target sites are as follows. Figure 3 The diagram shows base insertions or deletions. After comparison, TaDST mutants in TaDST-5A The deletion of one G base at position +245 of the CDS sequence caused a change in the amino acid sequence of the CDS region, resulting in premature termination of translation. The amino acid sequence of this gene mutant is only 219 amino acids. TaDST mutants in TaDST-5B The CDS sequence has a missing C base at +243 and a missing G base at +245, a total of 2 missing bases. This changes the amino acid sequence and causes premature termination of translation, resulting in only 293 amino acids. TaDST mutants in TaDST-5D The CDS sequence has a deletion of 17 amino acids at position +244, causing premature termination of translation, resulting in only 267 amino acids.

[0036] First round PCR reaction system: with TaDSTMutant wheat plant leaf DNA as template 1 μL, 2x Taq Master Mix in the kit 10 μL, Primer-F and Primer-R (Table 1) (10 μM) 0.5 μL each, Nuclease-free Water to make up the volume to 20 μL. PCR reaction conditions: 94°C denaturation 2 min; 94°C denaturation 30 s, 65°C annealing 30 s, 72°C extension 20 s, a total of 33 cycles; finally 72°C extension 5 min. After PCR, 5 μL of the PCR product was taken for agarose gel electrophoresis to detect the PCR product, to ensure the presence of the target product and good specificity.

[0037] Then the second round of PCR reaction was carried out, Hi-TOM Mix in the kit 12 μL, 1 μL of the first round of PCR product as template, Nuclease-free Water to make up the volume to 20 μL. PCR reaction program: 94°C denaturation 2 min; 94°C denaturation 30 s, 57°C annealing 30 s, 72°C extension 25 s, a total of 33 cycles; finally 72°C extension 5 min.

[0038] 5. NaCl treatment Selecting the same size homozygous mutant TaDST Wheat seeds and wild type control seeds were disinfected with 1% sodium hypochlorite for 10 minutes, washed with water three times, and then placed in a culture dish with filter paper with the seed furrow facing down. The seeds were germinated in water. When the roots were 2-3 cm long, the seeds were placed in a hydroponic box and treated with 100 mM NaCl and 200 mM NaCl, respectively. Hoagland's nutrient solution was used as a blank control to ensure that the roots were immersed in the solution. The hydroponic box was placed in an incubator for culture, and the phenotype was photographed and recorded in time.

Claims

1. Wheat TaDST Genes, or wheat TaDST Gene-encoded proteins, or wheat TaDST The application of gene-editing vectors in improving wheat salt tolerance is characterized by, The editing targets of the gene editing vector are shown in SEQ ID NO: 7 and SEQ ID NO:

8.

2. The application according to claim 1, characterized in that, The TaDST The nucleic acid sequence of the gene is selected from any one or more of the (a1) and (a2) sequences: (a1) As shown in SEQ ID No: 1 TaDST5A The cDNA sequence of the gene, shown in SEQ ID No: 2 TaDST5B The cDNA sequence of the gene or shown in SEQ ID No: 3 TaDST5D The cDNA sequence of the gene; (a2) Nucleotide sequences that are 75% or more identical to the nucleic acid sequences of SEQ ID No: 1, SEQ ID No: 2 or SEQ ID No: 3 respectively.

3. The application according to claim 1, characterized in that, The wheat TaDST The protein encoded by the gene has an amino acid sequence that selects one or more of the following: (b1) The TaDST5A protein sequence shown in SEQ ID No: 4; the TaDST5B protein sequence shown in SEQ ID No: 5; and the TaDST5D protein sequence shown in SEQ ID No:

6. (b2) A protein having the same function by substituting and / or deleting and / or adding one or more amino acid residues of the sequences SEQ ID No: 4, SEQ ID No: 5, and SEQ ID No:

6.

4. A method according to claim 1 TaDST The method for improving wheat salt tolerance through gene therapy is characterized by, Reduce or silence wheat TaDST Gene expression, the method of which is based on sequence information, designs simultaneous targeting DST Two specific sgRNAs in the three sequences of gene 5A, 5B and 5D cause mutations at the target sites of the gene, resulting in loss of gene function and thus increasing the salt tolerance of wheat.

5. The method for improving the salt tolerance of wheat according to claim 4, characterized in that, It includes the following steps: (1) Target DST Design specific sgRNAs at multiple sites in different subgenomes of the gene; (2) The multiple sgRNAs from the previous step are tandemly linked together and then ligated into the pBUE411 vector to become a single transcription unit vector, which can simultaneously knock out wheat germ cells. TaDST5A, TaDST5B and TaDST5D pBUE411-DST binary vector for gene function; (3) The constructed vector was transformed into wheat using Agrobacterium to obtain wheat DST Wheat mutants with lost gene function can be obtained with improved salt tolerance.

6. A method for knocking out wheat DST The pBUE411-DST binary vector for the gene is characterized by: The aforementioned wheat knockout TaDST The pBUE411-DST binary vector for gene function includes expression cassette A and expression cassette B; The expression cassette A, from upstream to downstream, specifically includes the following components in sequence: the TaU3 promoter A from wheat, the... TaDST The gene's sgRNA and terminator A; The expression box B, from upstream to downstream, specifically includes the following components: the promoter B, the corn Cas9 encoding sequence, and the terminator B.

7. Application of transgenic cell lines or recombinant bacteria containing the pBUE411-DST binary vector in the cultivation of wheat with improved salt tolerance.

8. Application of pBUE411-DST binary vector in the breeding of salt-tolerant wheat.

Images