Efficient enzymatic DNA synthesis method

Abstract

The invention discloses an efficient enzymatic DNA synthesis method, and belongs to the technical field of DNA synthesis. The technical problem to be solved by the invention is how to reduce the probability of formation of a secondary structure in the enzymatic DNA synthesis process or damage the formation of the secondary structure and improve the accuracy and yield of enzymatic DNA synthesis. In order to solve the technical problem, the invention provides the efficient enzymatic DNA synthesis method, the method can comprise the steps of providing a composition for enzymatic DNA synthesis reaction, enabling the composition to react to obtain DNA, and the composition comprises the following components: a starting chain, TdT enzyme, 7-deaza-dGTP modified with a reversible blocking group at the 3'end and nucleotide modified with a reversible blocking group at the 3 'end; and the nucleotides are dATP, dCTP, dGTP and dTTP.

Description

Technical Field

[0001] This application relates to the field of DNA synthesis technology, and specifically to an efficient enzymatic DNA synthesis method. Background Technology

[0002] In recent years, research interest in enzymatic DNA synthesis has been steadily increasing. This trend reflects the growing demand for customized DNA synthesis in key fields such as synthetic biology, gene editing technology, and high-throughput sequencing. Traditional chemical synthesis methods have inherent limitations in terms of synthesis length, reaction efficiency, organic solvent use, and processing. In contrast, enzymatic DNA synthesis stands out due to its high specificity and high reaction efficiency. Enzymatic DNA synthesis can be carried out under mild aqueous conditions, significantly reducing its environmental impact compared to traditional chemical synthesis methods, thus lowering the technical threshold for DNA synthesis.

[0003] Currently, most enzymatic DNA synthesis methods rely on terminal deoxyribonucleoside transferase (TdT), which can sequentially add deoxyribonucleoside triphosphate monomers containing blocking groups to single-stranded initiators or extended strands immobilized on supports, and progressively construct the desired polynucleotide sequence through a deblocking step (Publication No.: CN112746063B). However, although this method performs well in the synthesis of conventional sequences, its synthesis efficiency drops significantly for complex polynucleotide structures, such as sequences with hairpin structures, stem-loop structures, high GC content, and G-quadruplexes. These structures form stable secondary structures: in high GC-content regions, the DNA strands have stronger base stacking forces due to the three hydrogen bonds between guanine (G) and cytosine (C), easily forming complex secondary structures. These secondary structures are difficult to untie during synthesis, hindering contact between the 3' end of the primer and the enzyme, thus affecting the elongation efficiency. These complex structures play crucial roles in natural processes, such as regulating gene expression and participating in cell signaling. Therefore, improving their synthetic capabilities is of significant scientific and practical value. Currently, enzymatic DNA synthesis technology still faces challenges in synthesizing polynucleotide sequences with such complex structures. Terminal deoxyribonucleoside transferases often fail to effectively extend the sequence when encountering complex secondary structures. Therefore, developing efficient enzymatic DNA synthesis methods is of great importance for achieving the efficient synthesis of complex polynucleotide structures. This will not only help advance basic scientific research but also promote the development of novel therapeutic drugs, diagnostic tools, and biotechnology products, further broadening the application scope and influence of enzymatic synthesis technology. Summary of the Invention

[0004] The technical problem this application aims to solve is: how to reduce the probability of secondary structure formation or disrupt the formation of secondary structures during DNA synthesis, thereby improving the accuracy and yield of synthesis. To solve this technical problem, this application provides the following technical solution: This application provides a method for enzymatic DNA synthesis, the method comprising providing a composition for an enzymatic DNA synthesis reaction, and reacting the composition to obtain DNA. The composition may include the following components: a starting strand, a TdT enzyme, 7-deaza-dGTP modified with a reversible blocking group at the 3' end, dATP modified with a reversible blocking group at the 3' end, dCTP modified with a reversible blocking group at the 3' end, dGTP modified with a reversible blocking group at the 3' end, and dTTP modified with a reversible blocking group at the 3' end.

[0005] In this application, reacting the composition includes performing four or three, two or one of the following four reactions: dGTP addition reaction, dATP addition reaction, dCTP addition reaction and dTTP addition reaction; The dGTP addition reaction includes adding dGTP modified with a reversible blocking group at the 3' end to the 3' end of the starting strand. The dGTP addition reaction is carried out in a dGTP-added enzymatic DNA synthesis reaction system, which includes the starting strand, TdT enzyme, 7-deaza-dGTP modified with a reversible blocking group at the 3' end, and the dGTP modified with a reversible blocking group at the 3' end. The dATP addition reaction includes adding dATP modified with a reversible blocking group at the 3' end to the 3' end of the starting strand. The dATP addition reaction is carried out in a dATP-added enzymatic DNA synthesis reaction system, which includes the starting strand, TdT enzyme, and the dATP modified with a reversible blocking group at the 3' end. The dCTP addition reaction includes adding dCTP with a reversible blocking group at the 3' end to the 3' end of the starting strand. The dCTP addition reaction is carried out in a dCTP-added enzymatic DNA synthesis reaction system, which includes the starting strand, TdT enzyme, and the dCTP with a reversible blocking group at the 3' end. The dTTP addition reaction includes adding dTTP with a reversible blocking group modified at the 3' end to the 3' end of the starting strand. The dTTP addition reaction is carried out in a dTTP-added enzymatic DNA synthesis reaction system, which includes the starting strand, TdT enzyme, and the dTTP modified with a reversible blocking group at the 3' end.

[0006] The method described is an in vitro enzymatic DNA synthesis method.

[0007] In this application, the four reactions of adding dGTP, adding dATP, adding dCTP, and adding dTTP are selected or the order is determined according to the nucleotide sequence of the fitted target DNA fragment.

[0008] In the composition described above, the molar ratio of the 7-deaza-dGTP modified with a reversible blocking group at the 3' end to the dGTP modified with a reversible blocking group at the 3' end is 1:99 to 99:1.

[0009] In the composition described above, the molar ratio of the 7-deaza-dGTP modified with a blocking group at the 3' end to the dGTP modified with a reversible blocking group at the 3' end is 1:10 to 10:1.

[0010] In the composition described above, the molar ratio of the 7-deaza-dGTP modified with a reversible blocking group at the 3' end to the dGTP modified with a reversible blocking group at the 3' end is 1:4 to 4:1.

[0011] In some embodiments of this application, in the dGTP-added enzymatic DNA synthesis reaction system, the molar ratio of the 7-deaza-dGTP modified with a reversible blocking group at the 3' end to the dGTP modified with a reversible blocking group at the 3' end is 4:1. In one embodiment of this application, in the dGTP-added enzymatic DNA synthesis reaction system, the content of the 7-deaza-dGTP modified with a reversible blocking group at the 3' end is 0.20 mM, and the content of the dGTP modified with a reversible blocking group at the 3' end is 0.05 mM.

[0012] In the composition described above, the dATP modified with a reversible blocking group at the 3' end, the dCTP modified with a reversible blocking group at the 3' end, and the dTTP modified with a reversible blocking group at the 3' end are each packaged separately.

[0013] In the composition described above, the 7-deaza-dGTP modified with a reversible blocking group at the 3' end and the dGTP modified with a reversible blocking group at the 3' end can be packaged separately or in combination.

[0014] The composition described above further includes betaine and DMSO, wherein the ratio of betaine to DMSO is 1.5 mol betaine: 100 mL DMSO.

[0015] In the composition described above, the reversible blocking group at the 3' end is 3'-O-amino, 3'-O-methyl, 3'-phosphate, 3'-azido, 3'-O-azidomethyl, or 3'-O-allyl.

[0016] In some embodiments of this application, the reversible blocking group is a 3'-O-amino group. The 7-deaza-dGTP modified with a reversible blocking group at the 3' end is 3-O-NH2-7-deaza-dGTP. The nucleotides modified with a reversible blocking group at the 3' end are 3-O-NH2-dATP, 3-O-NH2-dTTP, 3-O-NH2-dCTP, and 3-O-NH2-dGTP.

[0017] In this application, the composition further includes a buffer solution.

[0018] In this application, the buffer solution comprises one or more buffer solutions (e.g., Tris, Hepes, Mops, phosphates, carbonates, or dimethylarsine salts, etc.) and one or more salts (e.g., Na+, K+, Mg2+). 2+ Mn 2+ Cu 2+ Zn 2+ Co 2+ All of these have appropriate equilibrium ions, such as Cl. - ).

[0019] It should be understood that the choice of buffer and salt in the reaction system depends on optimal enzyme activity and stability.

[0020] In one specific embodiment of this application, the buffer solution comprises potassium dihydrogen phosphate with a final concentration of 50 mM, sodium chloride with a final concentration of 100 mM, and cobalt chloride with a final concentration of 0.25 mM, and the solvent is ddH2O.

[0021] This application also provides compositions that are the compositions described in the above methods.

[0022] This application also provides at least one of the following applications: A1) The application of the above-mentioned 7-deaza-dGTP modified with a reversible blocking group at the 3' end in improving the catalytic efficiency of TdT enzyme in DNA synthesis. A2) The application of the above-mentioned 7-deaza-dGTP modified with a reversible blocking group at the 3' end in the preparation of products that improve the catalytic efficiency of TdT enzyme in DNA synthesis; A3) Application of the above composition in improving the catalytic efficiency of TdT enzyme in enzymatic DNA synthesis; A4) Application of the above composition in the preparation of products that improve the catalytic efficiency of TdT enzyme in enzymatic DNA synthesis.

[0023] In this application, the catalytic efficiency includes single-step catalytic efficiency and / or average yield.

[0024] In this application, the application of the enzymatic DNA synthesis can be the enzymatic DNA synthesis of long fragments of 50 to 300 nt.

[0025] In one specific embodiment of this application, the enzymatic DNA synthesis is the enzymatic DNA synthesis of a long fragment of 150 nt.

[0026] In this application, the working concentration refers to the final concentration of the component in the reaction system.

[0027] This application also provides a kit containing the above-described composition.

[0028] In the kit described in this application, each component of the kit is packaged separately.

[0029] In this application, the product may be a reagent or a kit.

[0030] In this application, "working concentration" refers to the final concentration in the reaction system.

[0031] The beneficial technical effects achieved by this application are as follows: The technical solution provided in this application reduces the formation of secondary structures in the high GC sequence synthesis process by adding at least one of betaine, dimethyl sulfoxide (DMSO), and formamide to the enzymatic DNA synthesis reaction system and / or replacing a certain proportion of 3-OX-dGTP in the enzymatic reaction system with 3-OX-7-deaza-dGTP, thereby achieving unexpected technical effects.

[0032] The technical solution provided in this application makes the enzyme-catalyzed DNA synthesis system more compatible and helps to solve the problem of low efficiency in synthesizing complex sequences. Attached Figure Description

[0033] Figure 1 This is a schematic diagram of the TdT catalytic reaction.

[0034] Figure 2 The effect of different working concentrations of betaine on catalytic efficiency.

[0035] Figure 3 The effect of different working concentrations of betaine on the yield of long fragment synthesis.

[0036] Figure 4 The effect of different working concentrations of dimethyl sulfoxide on catalytic efficiency.

[0037] Figure 5 The effect of different working concentrations of dimethyl sulfoxide on the yield of long fragment synthesis.

[0038] Figure 6 The effect of different working concentrations of formamide on catalytic efficiency.

[0039] Figure 7 The effect of different working concentrations of formamide on the yield of long fragment synthesis.

[0040] Figure 8 The effect of different mixed reagents on catalytic efficiency.

[0041] Figure 9 The effect of different reagent mixtures on the yield of long fragment synthesis.

[0042] Figure 10 The chemical structural formula of 7-deaza-dGTP (3-OX-7-deaza-dGTP) with a reversible blocking group at the 3' end.

[0043] Figure 11 The effect of different amounts of 7-deaza-dGTP in the reaction system on the yield of long fragment synthesis was investigated.

[0044] Figure 12 The effect of adding mixed reagent 1 and 80% 7-deaza-dGTP to the synthesis reagent on the yield of long fragment synthesis. Detailed Implementation

[0045] I. Terms used in this application: For ease of understanding this application, several terms and abbreviations used herein are defined as follows: When used in a list of two or more items, the term "and / or" means that any of the listed items can be used alone or in combination with any one or more of the listed items. For example, the expression "A and / or B" is intended to mean either or both of A and B, i.e., A alone, B alone, or a combination of A and B. The expression "A, B and / or C" means A alone, B alone, C alone, a combination of A and B, a combination of A and C, a combination of B and C, or a combination of A, B and C.

[0046] The term "comprising" is not intended to be restrictive, but rather inclusive and implies the presence of other elements besides those listed, and can be interpreted as "including but not limited to". The term "comprising" also encompasses the terms "consisting of" and "substantially consisting of". In this document, the terms "including" and "comprise" are used interchangeably.

[0047] The terms “modified” and “blocked” are used interchangeably and are intended to refer to a portion covalently linked to a specific group that prevents the chemical change of that group during a chemical or enzymatic process. The prevented chemical change is achieved by further or subsequently extending the extended fragment (or “extension intermediate”) through an enzymatic linking reaction, provided the specified group is the 3’-hydroxyl group of a nucleoside triphosphate, or an extension fragment (or “extension intermediate”) of a 3’-modified / protected / or blocked nucleoside triphosphate incorporated therein.

[0048] The term TdT enzyme, as used herein, refers to terminal deoxynucleotidyl transferase, including references to the purified and recombinant forms of the enzyme. TdT enzyme synthesis is template-free, using only single-stranded DNA for DNA synthesis, thus enabling de novo creation of genomic material and making it a key biological enzyme in three generations of DNA synthesis. Synthetic strategies primarily involve terminating the reaction through modified nucleotides, the addition of reagents with specific chemical groups, or coupling TdT enzyme with nucleotides. In this application, TdT enzyme includes, but is not limited to, the enzyme-catalyzed DNA synthesis kit purchased from Tianjin Zhonghe Gene Technology Co., Ltd., or the expression cassette containing all elements for expressing TdT enzyme disclosed in patents CN112746063B and CN110331136B. The bases can be conventional bases (A, G, C, T), non-natural nucleotides such as isocytosine and isoguanine and their analogues (such as inosine), derivatives of purine and pyrimidine bases such as N4-methyldeoxyguanosine, aza or acridine, aza or acridine, purines or pyrimidines with altered or substituted substituents at any series of chemical sites, such as 2-amino-6-methylaminopurine, O6-methylguanine, 4-thio-pyrimidine, 4-amino-pyrimidine, 4-dimethylhydrazine-pyrimidine and O4-alkyl-pyrimidine, or pyrazolone compounds such as unsubstituted or 3-substituted pyrazolone [3,4-d]pyrimidine.

[0049] II. Implementation Examples This application relates to improvements in enzymatic DNA synthesis methods. These methods improve the synthesis efficiency of complex sequences (hairpin structures, stem-loop structures, high-GC sequences, and G-quadruplexes, etc.) by providing conditions (reaction systems) that inhibit or disrupt the formation of secondary structures in high-GC DNA sequences, thereby increasing the accuracy and yield of long polynucleotides. This application is not intended to be limited to any particular theory or hypothesis. The inventors believe that the formation of such secondary structures restricts the access of synthetic reagents, such as template-free polymerases, thereby inhibiting chain elongation and increasing the variability of product length. This application is based on the understanding that the negative impact of such secondary structures on product accuracy and yield can be mitigated or inhibited by selectively adding additives or base analogs to the synthetic reagents.

[0050] The present application will now be described in further detail with reference to specific embodiments. The embodiments given are merely illustrative of the present application and are not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the present application in any way.

[0051] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0052] Unless otherwise specified, all materials and reagents used in the following examples are commercially available. The TdT enzyme and enzymatic DNA synthesis kit used in this application are from Tianjin Zhonghe Gene Technology Co., Ltd., catalog number DBS-01.

[0053] Unless otherwise specified, the quantitative experiments in the following examples were performed in triplicate, and the results were averaged.

[0054] In the following examples, the basic enzymatic DNA synthesis reaction system consisted of: 2 μM starting strand, 0.25 mM modified nucleotides (nucleotides modified with a reversible blocking group at the 3' end, 3-ONH2-dATP, 3-ONH2-dTTP, 3-ONH2-dGTP, or 3-ONH2-dCTP, each at a concentration of 0.25 mM), 0.5 U of TdT enzyme, and reaction buffer (a final concentration of 50 mM potassium dihydrogen phosphate, a final concentration of 100 mM sodium chloride, and 0.25 mM cobalt chloride in the basic enzymatic DNA synthesis reaction system, with ddH2O as the solvent). The corresponding reaction systems were named according to the type of nucleotide added: dATP-added enzymatic DNA synthesis reaction system, dTTP-added enzymatic DNA synthesis reaction system, dGTP-added enzymatic DNA synthesis reaction system, and dCTP-added enzymatic DNA synthesis reaction system. Taking the addition of dGTP as an example, the schematic diagram of the TdT-catalyzed DNA synthesis reaction is shown below. Figure 1 As shown.

[0055] The nucleotide sequence of the starting chain is TAATACGACTCACTCC (16nt, SEQ ID NO:1) or TTTTTGGCTAGAGACTCCTACGCGACTTGA (30nt, SEQ ID NO:2).

[0056] Example 1, Additives: Betaine, DMSO, Formamide In this embodiment, betaine, DMSO, or formamide, solvents that inhibit the formation of secondary structures from DNA sequences with high GC content, are added to the basic enzymatic DNA synthesis reaction system.

[0057] 1.1 Detection of the effect of different concentrations of betaine on enzyme catalytic efficiency 1) To detect the effect of different concentrations of betaine on the enzyme catalytic efficiency in the enzyme-catalyzed DNA synthesis reaction system, betaine was added to the basic enzyme-catalyzed DNA synthesis reaction system (where the nucleotide sequence of the starting strand is SEQ ID NO:1, and the modified nucleotide of 0.25 mM is 3-ONH2-dATP) to make the working concentrations of betaine 0, 0.5 M, 1.0 M, 1.5 M, 2.0 M, 3.0 M, 4.0 M, and 5.0 M.

[0058] The basic enzymatic DNA synthesis reaction system without additives was used as a control.

[0059] Catalytic reaction conditions: 3-ONH2-dATP was added to the starting strand via enzymatic DNA synthesis. The reaction was carried out at 30℃ for 1 min, followed by protein inactivation at 95℃. The supernatant was collected by centrifugation. 10 µL of sample was added to 10 µL of 2* loading buffer and mixed thoroughly. A 20% urea-PAGE assay was performed, and the proportions of N (16nt) and N+1 (17nt) were analyzed using gel imaging software. The single-step catalytic efficiency was calculated as the proportion of N+1 (17nt): Single-step catalytic efficiency = (N+1) / (N+(N+1))*100. The single-step catalytic efficiency was output by the gel imaging software. Results are as follows: Figure 2 As shown.

[0060] Figure 2 The results showed that betaine at working concentrations below 1.5 M (0, 0.5 M, 1 M, 1.5 M) had no inhibitory effect on the catalytic efficiency of TdT enzyme; however, working concentrations of betaine above 1.5 M reduced the catalytic efficiency of TdT enzyme.

[0061] 2) The role of betaine in the synthesis of longer DNA fragments The effects of betaine concentrations of 0, 0.5 M, 1 M, and 1.5 M on the synthesis of longer DNA fragments were verified.

[0062] Specifically, this can be implemented through the following steps: a) Provide a starter with a free 3'-hydroxyl group, the starter being 30 nt in length, and the nucleotide sequence being: TTTTTGGCTAGAGACTCCTACGCGACTTGA (SEQ ID NO:2); b) Repeat the following cycles (i) and (ii) until a target oligonucleotide of 150 nt in length is synthesized, the nucleotide sequence of which is SEQ ID NO:3; GGCAGGTCGTCAGGATGGTCCGGTTCGTGAAAGTATTCGTGAACAGCCACGTATTGAACTGGGTCTGAAAGCATTTCTGCAAGATGGTAATTTTACCGCATTTACCACCTTTGAAGATCTGCATGGTATGAAACAGCTGCCTGGTCT (SEQ ID NO: 3).

[0063] (i) Under elongation conditions, an initiator or elongation fragment with a free 3'-hydroxyl group is contacted with 3'-O-blocked nucleoside triphosphates (3-ONH2-dATP, 3-ONH2-dTTP, 3-ONH2-dGTP or 3-ONH2-dCTP) and TdT enzyme, thereby elongating the initiator or elongation fragment through the incorporation of 3'-O-blocked nucleoside triphosphates to form a 3'-O-blocked elongation fragment; The reaction system consisted of an initiator or elongation fragment with a free 3'-hydroxyl group, 50 mM potassium dihydrogen phosphate, 100 mM sodium chloride, 0.25 mM cobalt chloride, 0.25 mM modified nucleotide, 0.5 U TdT enzyme, and betaine at working concentrations of 0, 0.5 M, 1.0 M, and 1.5 M, with water as the solvent.

[0064] In this reaction system, the 0.25 mM modified nucleotide is a nucleotide with a reversible blocking group at the 3' end, selected from 3-ONH2-dATP, 3-ONH2-dTTP, 3-ONH2-dGTP, or 3-ONH2-dCTP. Based on the sequence of the target oligonucleotide, the corresponding modified nucleotide is added sequentially to each reaction system to achieve a concentration of 0.25 mM.

[0065] Reaction conditions: 30℃, reaction time 1-5 min.

[0066] (ii) Deblocking the 3'-O-blocked elongation fragment to form an elongation fragment with a free 3'-hydroxyl group.

[0067] Deprotect the reaction system: Deprotect with 0.7M sodium nitrite at room temperature for 1 min, remove the supernatant; then wash twice with phosphate buffer (50 mM potassium dihydrogen phosphate, 100 mM sodium chloride, water as solvent).

[0068] Next-generation sequencing validation: (I) Add polyA tail to the sample, referring to the instructions for terminal transferase (M0315S, NEB).

[0069] (II) Indexing and product enrichment: PCR amplification.

[0070]

[0071] After adding polyA tails to the magnetic beads, PCR amplification liquid was added. PCR was performed according to the PCR program: 95℃, 3 min; 95℃, 15 s, 50℃, 15 s, 72℃, 15 s, 26 cycles; 72℃, 5 min; 12℃, ∞. The amplified liquid was then sent for library construction and sequencing. Sequencing result analysis: The synthesized results were sequenced, and the sequencing results were filtered by the pre-target and post-target (polyA) sequences. The yield of complete target oligonucleotides (150 nt) was calculated (number of reads that perfectly matched the target sequence / total number of reads).

[0072] The synthesis results are as follows Figure 3 The results showed that the yield of long DNA fragment synthesis increased with increasing betaine concentration, with the highest increase observed when 1.5M betaine was added.

[0073] 1.2. Detection of the effect of adding different proportions of DMSO on enzyme catalytic efficiency 1) To detect the effect of different proportions of DMSO on the enzyme catalytic efficiency in the enzyme-catalyzed DNA synthesis reaction system, DMSO was added to the basic enzyme-catalyzed DNA synthesis reaction system (where the nucleotide sequence of the starting chain is SEQ ID NO:1, and the 0.25 mM modified nucleotide is 3-ONH2-dATP) to make the working concentrations of DMSO 0, 2%, 5%, 10%, and 15% (v / v).

[0074] The basic enzymatic DNA synthesis reaction system without additives was used as a control.

[0075] The single-step catalytic efficiency was calculated using the method described in section 1.1, and the results are as follows: Figure 4 As shown.

[0076] The results showed that DMSO concentrations below 10% (v / v) (0, 2%, 5%, 10%) had no significant effect on catalytic efficiency; however, DMSO concentrations above 10% had an inhibitory effect on catalytic efficiency.

[0077] 2) The role of DMSO in the synthesis of longer DNA fragments Refer to section 1.1, “2) The effect of betaine on the synthesis of longer DNA fragments” to verify the effect of different concentrations of DMSO on the synthesis of longer DNA fragments.

[0078] The results are as follows Figure 5 As shown in the figure. The results indicate that a working concentration of 10% (v / v) DMSO can improve the yield of TdT enzyme for the synthesis of long fragments.

[0079] 1.3. Effect of different working concentrations of formamide on enzyme catalytic efficiency. 1) To detect the effect of different working concentrations of formamide on the enzyme catalytic efficiency in the enzymatic DNA synthesis reaction system, formamide was added to the basic enzymatic DNA synthesis reaction system (where the nucleotide sequence of the starting strand is SEQ ID NO:1, and the 0.25 mM modified nucleotide is 3-ONH2-dATP) to make the working concentrations of formamide 0, 0.5%, 1%, 2%, 3%, and 5% (v / v).

[0080] The single-step catalytic efficiency was calculated using the method described in section 1.1, and the results are as follows: Figure 6 As shown in the figure, the results indicate that formamide at working concentrations below 2% (0, 0.5%, 1%, 2% (v / v)) does not affect the catalytic efficiency of TdT enzyme.

[0081] 2) The role of formamide in the synthesis of longer DNA fragments Refer to section 1.1, “2) The effect of betaine on the synthesis of longer DNA fragments” to verify the effect of different concentrations of formamide on the synthesis of longer DNA fragments.

[0082] The results are as follows Figure 7 As shown, the results again demonstrate that the addition of formamide to the reaction system did not promote the synthesis yield.

[0083] Example 2: Detection of the effect of mixed reagents on the catalytic efficiency of TdT enzyme In Example 1, it was found that the highest accuracy in synthesizing 150 nt was achieved when 1.5 M betaine, 10% (v / v) DMSO, and 2% (v / v) formamide were added to the basic enzymatic DNA synthesis reaction system. The above additives were mixed together as a composition and added to the basic enzymatic DNA synthesis reaction system (where the nucleotide sequence of the starting strand is SEQ ID NO:1, and the 0.25 mM modified nucleotide is 3-ONH2-dATP). The optimal working concentrations were then used in the enzymatic DNA synthesis reaction system.

[0084] Specifically as follows: Mixed reagent 1: 1.5 mol betaine, 100 mL DMSO.

[0085] Mixed reagent 2: 1.5 mol betaine, 20 mL formamide.

[0086] Mixed reagent 3: 100 mL DMSO, 20 mL formamide.

[0087] Mixed reagent 4: 1.5 M betaine, 100 mL DMSO, 20 mL formamide.

[0088] The optimized enzymatic DNA synthesis reaction system corresponding to Mixed Reagent 1 is to add Mixed Reagent 1 to the basic enzymatic DNA synthesis reaction system until the final concentration of betaine in the reaction system is 1.5 M and the final concentration of DMSO is 10% (v / v).

[0089] The optimized enzymatic DNA synthesis reaction system corresponding to Mixed Reagent 2 is to add Mixed Reagent 2 to the basic enzymatic DNA synthesis reaction system until the final concentration of betaine in the reaction system is 1.5 M and the final concentration of formamide is 2% (v / v).

[0090] The optimized enzymatic DNA synthesis reaction system corresponding to Mixed Reagent 3 is to add Mixed Reagent 3 to the basic enzymatic DNA synthesis reaction system until the final concentration of DMSO in the reaction system is 10% (v / v) and the final concentration of formamide is 2% (v / v).

[0091] The optimized enzymatic DNA synthesis reaction system corresponding to Mixed Reagent 4 is to add Mixed Reagent 4 to the basic enzymatic DNA synthesis reaction system until the final concentration of betaine in the reaction system is 1.5 M, the final concentration of DMSO is 10% (v / v), and the final concentration of formamide is 2% (v / v).

[0092] The single-step catalytic efficiency was measured according to the method described in Example 1, and the results are as follows: Figure 8 As shown, the results indicate that none of the reagents 1 to 4 affect the catalytic efficiency of TdT enzyme.

[0093] Refer to section 1.1, “2) The effect of betaine on the synthesis of longer DNA fragments” to verify the effect of the four mixed reagents on the synthesis of longer DNA fragments.

[0094] The results are as follows Figure 9 As shown, the verification results indicate that mixed reagent 1 can significantly improve the yield of long DNA fragment synthesis, and the improvement is greater than that of adding betaine and DMSO alone.

[0095] Example 3, Base analog: 7-deaza-dGTP with a reversible blocking group at the 3' end (i.e., the abbreviation of 3-OX-7-deaza-dGTP). This application uses a base analogue (7-deaza-dGTP with a reversible blocking group at the 3' end, structural formula as follows) Figure 10The dGTP with a reversible blocking group at the 3' end (represented by 3-OX-7-deaza-dGTP) in the reaction system can be replaced, or incorporated in a certain proportion. When 3-OX-7-deaza-dGTP is incorporated into the newly synthesized DNA strand, it can replace part of the natural dGTP that pairs with C. This can be accomplished by using a mixture of 3-OX-dGTP and 3-OX-7-deaza-dGTP in a random addition step of one or more Gs in a high-GC-content sequence of the polynucleotide being synthesized. In this example, 3-OX-dGTP is 3-O-NH2-dGTP, and 3-OX-7-deaza-dGTP is 3-O-NH2-7-deaza-dGTP (product of Tianjin Quanhecheng Biotechnology Co., Ltd.).

[0096] The effect of adding different proportions of 3-O-NH2-7-deaza-dGTP on the accuracy of synthesizing longer DNA fragments was tested. The proportions of 3-O-NH2-7-deaza-dGTP added were 0%, 20%, 40%, 50%, 60%, 80%, and 100%.

[0097] The reaction system with an input ratio of 0 for 3-O-NH2-7-deaza-dGTP is the basic enzymatic DNA synthesis reaction system described above.

[0098] In the optimized enzymatic DNA synthesis reaction system with an input ratio of 20% of 3-O-NH2-7-deaza-dGTP, the molar ratio of 3-O-NH2-7-deaza-dGTP to 3-ONH2-dGTP was 1:4, and the sum of the final concentrations of 3-O-NH2-7-deaza-dGTP and 3-ONH2-dGTP in the reaction system was 0.25 mM.

[0099] In the optimized enzymatic DNA synthesis reaction system with an input ratio of 40% for 3-O-NH2-7-deaza-dGTP, the molar ratio of 3-O-NH2-7-deaza-dGTP to 3-ONH2-dGTP was 2:3, and the sum of the final concentrations of 3-O-NH2-7-deaza-dGTP and 3-ONH2-dGTP in the reaction system was 0.25 mM.

[0100] In the optimized enzymatic DNA synthesis reaction system with a 3-O-NH2-7-deaza-dGTP input ratio of 50%, the molar ratio of 3-O-NH2-7-deaza-dGTP to 3-ONH2-dGTP was 1:1, and the sum of the final concentrations of 3-O-NH2-7-deaza-dGTP and 3-ONH2-dGTP in the reaction system was 0.25 mM.

[0101] In the optimized enzymatic DNA synthesis reaction system with a 3-O-NH2-7-deaza-dGTP input ratio of 60%, the molar ratio of 3-O-NH2-7-deaza-dGTP to 3-ONH2-dGTP was 3:2, and the sum of the final concentrations of 3-O-NH2-7-deaza-dGTP and 3-ONH2-dGTP in the reaction system was 0.25 mM.

[0102] In the optimized enzymatic DNA synthesis reaction system with an 80% input ratio of 3-O-NH2-7-deaza-dGTP, the molar ratio of 3-O-NH2-7-deaza-dGTP to 3-ONH2-dGTP was 4:1, and the sum of the final concentrations of 3-O-NH2-7-deaza-dGTP and 3-ONH2-dGTP in the reaction system was 0.25 mM.

[0103] In the optimized enzymatic DNA synthesis reaction system with a 100% 3-O-NH2-7-deaza-dGTP addition ratio, the final concentration of 3-O-NH2-7-deaza-dGTP in the reaction system was 0.25 mM, without the addition of 3-ONH2-dGTP.

[0104] Specifically, this can be implemented through the following steps: a) Provide an initiator (30nt) with a free 3'-hydroxyl group; b) Repeat the following cycles (i) and (ii) until the polynucleotide (150 nt) is synthesized: (i) Under elongation conditions, an initiator or elongation fragment with a free 3'-hydroxyl group is contacted with 3'-O-blocked nucleoside triphosphates (3-ONH2-dATP, 3-ONH2-dTTP, 3-ONH2-dCTP, 3-O-NH2-7-deaza-dGTP or / and 3-ONH2-dGTP) and TdT enzyme, thereby elongating the initiator or elongation fragment by incorporation of 3'-O-blocked nucleoside triphosphates to form a 3'-O-blocked elongation fragment; Reaction system: Initiator or elongation fragment with free 3'-hydroxyl group, 50 mM potassium dihydrogen phosphate, 100 mM sodium chloride, 0.25 mM cobalt chloride, 0.25 mM modified nucleotide (modified nucleotide with reversible blocking group at 3' end, 3-ONH2-dATP, 3-ONH2-dTTP or 3-ONH2-dCTP at 0.25 mM each; 3-O-NH2-7-deaza-dGTP or / and 3-ONH2-dGTP added in the above proportions, the sum of their final concentrations being 0.25 mM), 0.5-1 U TdT enzyme, solvent is water.

[0105] Reaction conditions: 30℃, reaction time 1-5 min.

[0106] (ii) Deblocking the 3'-O-blocked elongation fragment to form an elongation fragment with a free 3'-hydroxyl group.

[0107] Deprotect the reaction system: Deprotect with 0.7M sodium nitrite at room temperature for 1 min, remove the supernatant; then wash twice with phosphate buffer (50 mM potassium dihydrogen phosphate, 100 mM sodium chloride, water as solvent).

[0108] The yield was calculated using the method described in section 1.1, and the results are as follows: Figure 11 As shown in the figure. The results indicate that when the proportion of 7-deaza-dGTP (i.e., 3-O-NH2-7-deaza-dGTP) in dGTP is 80%, the synthesis yield of long DNA fragments can be improved.

[0109] Example 4: Effects of additives and 7-deaza-dGTP on the catalytic efficiency of TdT enzyme The results of Example 2 show that the highest yield of 150 nt was achieved in the reaction system with added mixed reagent 1 (1.5 mol betaine, 100 mL DMSO). The results of Example 3 show that the highest yield of 150 nt was achieved in the reaction system with a ratio of 3-O-NH2-7-deaza-dGTP to 3-O-NH2-dGTP of 4:1.

[0110] Add Mixed Reagent 1 to the basic enzymatic DNA synthesis reaction system, and add 3-O-NH2-7-deaza-dGTP at an 80% ratio (i.e., the ratio of 3-O-NH2-7-deaza-dGTP to 3-O-NH2-dGTP is 4:1). The final enzymatic DNA synthesis reaction system for efficient DNA synthesis includes: 2 μM starting strand (SEQ ID NO:2), 0.25 mM modified nucleotides (nucleotides modified with a reversible blocking group at the 3' end, wherein the concentrations of 3-ONH2-dATP, 3-ONH2-dTTP, or 3-ONH2-dCTP are 0.25 mM each; 3-O-NH2-7-deaza-dGTP and 3-ONH2-dGTP are added at a 4:1 ratio, with a final concentration of 0.25 mM), 0.5 U of TdT enzyme, and reaction buffer (final concentration of 50 U / mL in the basic enzymatic DNA synthesis reaction system). The reaction mixture consisted of mM potassium dihydrogen phosphate, 100 mM sodium chloride, and 0.25 mM cobalt chloride, in ddH2O solvent. A basic enzymatic DNA synthesis reaction system was used as a control group.

[0111] The test was performed according to the steps in Example 3, and the results are as follows: Figure 12 In the enzymatic DNA synthesis reaction system integrating mixed reagent 1 and 80% 3-O-NH2-7-deaza-dGTP, the yield of long fragment synthesis was further improved, reaching 40%, which was significantly higher than that of the control group.

[0112] The present application has been described in detail above. Those skilled in the art will recognize that the present application can be implemented in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments are given in this application, it should be understood that further modifications can be made to the present application. In summary, in accordance with the principles of this application, this application is intended to include any changes, uses, or improvements to the present application, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. A method for enzyme-catalyzed DNA synthesis, characterized in that: The method includes providing a composition for an enzymatic DNA synthesis reaction, reacting the composition to obtain DNA, the composition comprising the following components: a starting strand, a TdT enzyme, 7-deaza-dGTP modified with a reversible blocking group at the 3' end, dATP modified with a reversible blocking group at the 3' end, dCTP modified with a reversible blocking group at the 3' end, dGTP modified with a reversible blocking group at the 3' end, and dTTP modified with a reversible blocking group at the 3' end.

2. The method according to claim 1, characterized in that: The reaction of the composition includes performing four or three, two or one of the following four reactions: dGTP addition reaction, dATP addition reaction, dCTP addition reaction, and dTTP addition reaction. The dGTP addition reaction includes adding dGTP modified with a reversible blocking group at the 3' end to the 3' end of the starting strand. The dGTP addition reaction is carried out in a dGTP-added enzymatic DNA synthesis reaction system, which includes the starting strand, TdT enzyme, 7-deaza-dGTP modified with a reversible blocking group at the 3' end, and the dGTP modified with a reversible blocking group at the 3' end. The dATP addition reaction includes adding dATP modified with a reversible blocking group at the 3' end to the 3' end of the starting strand. The dATP addition reaction is carried out in a dATP-added enzymatic DNA synthesis reaction system, which includes the starting strand, TdT enzyme, and the dATP modified with a reversible blocking group at the 3' end. The dCTP addition reaction includes adding dCTP with a reversible blocking group at the 3' end to the 3' end of the starting strand. The dCTP addition reaction is carried out in a dCTP-added enzymatic DNA synthesis reaction system, which includes the starting strand, TdT enzyme, and the dCTP with a reversible blocking group at the 3' end. The dTTP addition reaction includes adding dTTP with a reversible blocking group modified at the 3' end to the 3' end of the starting strand. The dTTP addition reaction is carried out in a dTTP-added enzymatic DNA synthesis reaction system, which includes the starting strand, TdT enzyme, and the dTTP modified with a reversible blocking group at the 3' end.

3. The method according to claim 1 or 2, characterized in that: In the composition, the molar ratio of the 7-deaza-dGTP modified with a reversible blocking group at the 3' end to the dGTP modified with a reversible blocking group at the 3' end is 1:99 to 99:

1.

4. The method according to claim 3, characterized in that: In the composition, the molar ratio of the 7-deaza-dGTP modified with a reversible blocking group at the 3' end to the dGTP modified with a reversible blocking group at the 3' end is 1:4 to 4:

1.

5. The method according to claim 4, characterized in that: The composition further includes betaine and DMSO, wherein the ratio of betaine to DMSO is 1.5 mol betaine: 100 mL DMSO.

6. The method according to claim 1, characterized in that: The reversible blocking group is 3'-O-amino, 3'-O-methyl, 3'-phosphate, 3'-azido, 3'-O-azidomethyl or 3'-O-allyl.

7. The composition, characterized in that: The composition is the composition described in any one of claims 1 to 6.

8. A reagent, characterized in that: The reagent contains the composition of claim 7. Application of 7-deaza-dGTP modified with a reversible blocking group at the 9.3' end in the preparation of products that improve the catalytic efficiency of TdT enzyme in DNA synthesis.

10. The use of the composition of claim 7 in the preparation of products that improve the catalytic efficiency of TdT enzyme in enzymatic DNA synthesis.

Images