KASP marker closely linked with wheat glume wax QTL and application of KASP marker

By developing the KASP marker for wheat hull wax QTLs, and constructing a recombinant inbred line population using Zhongmai 578 and Jimai 22, efficient detection and screening of wheat hull wax traits were achieved, improving wheat's stress resistance and yield.

CN121737337APending Publication Date: 2026-03-27LUOYANG ACADEMY OF AGRI & FORESTRY SCI +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-30
Publication Date
2026-03-27

AI Technical Summary

Technical Problem

Existing technologies make it difficult to effectively utilize molecular marker-assisted selection methods for efficient detection and breeding of wheat glumes with waxy texture, which affects the improvement of wheat's stress resistance and yield.

Method used

KASP markers closely linked to wheat glume wax QTLs were developed. Recombinant inbred line populations were constructed using Zhongmai 578 and Jimai 22. PCR amplification and fluorescence beam scanning were performed using KASP marker primer sets and kits to achieve genotyping and analysis of wheat glume wax traits.

Benefits of technology

This study enables efficient detection and screening of waxy traits in wheat husks, improving wheat's stress resistance and yield, and providing a new method for molecular marker-assisted selection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121737337A_ABST
    Figure CN121737337A_ABST
Patent Text Reader

Abstract

The invention provides a KASP marker closely linked with wheat glume wax QTL and application of the KASP marker, and belongs to the technical field of molecular genetic breeding. A recombinant inbred line group comprising 262 families is constructed by utilizing Zhongmai 578 and Jimai 22, glume wax QTL is researched and named as QGW.haust-1D, a closely linked SNP marker of the glume wax QTL is AX-109453532, a complete set of KASP primers is designed according to the glume wax QTL, the provided KASP primers are used for detecting wheat glume wax genes, the KASP primers can also be used for detecting, selecting and screening wheat glume wax traits, and the application prospect is wide. The method has important practical significance on wheat breeding research.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular genetic breeding technology and relates to the identification of a novel wheat husk wax QTL (Quantitative Trait Locus) and its linked KASP (Kompetitive Allele-Specific PCR) marker. Background Technology

[0002] As the world's largest wheat producer and consumer, my country's continued development of its wheat industry is of great strategic significance for ensuring domestic food security. Against the backdrop of global warming and frequent extreme weather events, the uncertainties of the external environment pose serious challenges to my country's wheat production and have a significant impact on the global food security landscape.

[0003] Epidermal wax refers to a layer of lipid-organic mixture covering the surface of the aboveground parts of plants, mainly composed of compounds such as fatty acids, aldehydes, alcohols, and ketones (Sturaro et al., 2006; Buschhaus and Jetter, 2011). Epidermal wax acts as a protective barrier between plants and the environment, and its most important function is to limit the loss of non-stomatal water while protecting plants from ultraviolet radiation, pests, and diseases (Yeats et al., 2013; Kim et al., 2018). Therefore, cloning genes related to glume wax is of great significance for breeding stress-resistant wheat varieties and increasing grain yield.

[0004] KASP markers have been widely used to detect SNP loci in crops such as wheat and rice, enabling high-throughput genotyping without the need for electrophoresis. Using genotypic data from wheat SNP microarrays for QTL mapping and genome-wide association analysis, linked SNPs can be converted into KASP markers, which can then be directly applied to marker-assisted selection breeding.

[0005] Zhongmai 578 is a high-yielding, multi-resistant, high-quality strong gluten wheat variety. It was approved by the National Huang-Huai-Bei Region in June 2021 and is suitable for planting in the irrigated areas of the northern part of the Huang-Huai winter wheat region, including all of Shandong Province, the southern parts of Baoding and Cangzhou in Hebei Province, and the basin irrigation areas of Yuncheng and Linfen in Shanxi Province. Jimai 22 is a high-yielding, multi-resistant, high-quality medium-gluten wheat variety. It was approved by Shandong Province and the National Huang-Huai-Bei Region in September 2006 and January 2007, respectively, and is suitable for planting in the Huai-Bei region and the northern part of the Huang-Huai winter wheat region. Summary of the Invention

[0006] To address the aforementioned problems, the purpose of this invention is to provide a KASP marker closely linked to a wheat glume wax QTL and its application. This invention utilizes Zhongmai 578 and Jimai 22 to construct a recombinant inbred line (RIL) population comprising 262 families, and identifies a glume wax QTL named QGW.haust-1D, whose closely linked SNP marker is AX-109453532, which can be used for auxiliary selection of wheat glume wax genes.

[0007] In a first aspect, the present invention provides a KASP marker primer set, wherein the KASP marker primer set is used to detect the genotype corresponding to a molecular marker closely linked to a QTL in wheat glume wax, wherein the QTL is QGW.haust-1D and the molecular marker is Kasp-AX-109453532; the KASP marker primer set comprises: Primer A, the nucleotide sequence of which is shown in SEQ ID NO: 1; Primer B, the nucleotide sequence of which is shown in SEQ ID NO: 2; Primer C, whose nucleotide sequence is shown in SEQ ID NO: 3.

[0008] Secondly, the present invention provides a kit for detecting the waxy properties of wheat husks, comprising the above-mentioned KASP-labeled primer set.

[0009] Thirdly, the present invention provides a method for genotyping detection of wheat glume waxy traits, comprising the following steps: Step 1: Extract genomic DNA from the wheat to be tested; Step 2: Using the wheat genomic DNA to be tested as a template, perform PCR amplification using the KASP marker primer set described in claim 1 to obtain the amplification product; Step 3: The amplification products obtained in Step 2 are subjected to fluorescence beam scanning. The scanning data are analyzed using AllelicDiscrimination genotyping software, and the wheat QGW.haust-1D locus genotype is determined based on the analysis results.

[0010] As a further optimization of the above method, in step three, the method for determining the wheat QGW.haust-1D locus genotype based on the analysis results is as follows: if the fluorescence signal data of the amplified product of the wheat to be tested shows blue after software analysis, then the wheat QGW.haust-1D locus genotype is TT; if the fluorescence signal data of the amplified product of the wheat to be tested shows yellow after software analysis, then the wheat QGW.haust-1D locus genotype is CC.

[0011] Fourthly, the present invention provides the application of the above-described KASP-labeled primer set, kit, or method in any of the following (A)-(C): (A): Genotype of QGW.haust-1D locus used to detect wheat or wheat hybrid offspring; (B): Used for identification or auxiliary identification of the waxy properties of wheat husks; (C): Used for breeding, screening or assisting in the screening of wheat individual plants, lines, strains or varieties with strong stress resistance.

[0012] Beneficial Effects: This invention provides a novel wheat glume wax gene QTL and its linked molecular marker, named QGW.haust-1D, located on chromosome 1D, with flanking markers AX-10945353 and AX-94438415, and a physical interval of 0.91-2.14 Mb; its closely linked SNP marker is AX-109453532. Based on these molecular markers, KASP marker primers were developed using KASP technology, which can be used for genotyping of wheat glume wax genes and for the detection, selection, and screening of wheat glume wax traits, which is of great significance to wheat breeding research. Attached Figure Description

[0013] Figure 1 The QGW.haust-1D curve is located in the RIL population of Zhongmai 578 × Jimai 22.

[0014] Figure 2 Genotyping results of 363 wheat varieties using the KASP marker Kasp-AX-109453532. Detailed Implementation

[0015] This invention relates to a novel QTL for wheat glume wax and its linked molecular markers, which can be used for marker-assisted selection of glume wax in breeding.

[0016] The present invention provides a tightly linked KASP marker, Kasp-AX-109453532, for screening QTLs in glumes and waxes. Its sequence is shown in the primer sequence listing (Table 1), wherein the nucleotide sequence of primer A is shown in SEQ ID NO: 1, the nucleotide sequence of primer B is shown in SEQ ID NO: 2, and the nucleotide sequence of primer C is shown in SEQ ID NO: 3.

[0017] Table 1. KASP primer sequence list for detecting QTL QGW.haust-1D in glumes. Marker Name Primer Name Sequence Kasp-AX-109453532 A <![CDATA[ GAAGGTGACCAAGTTCATGCT GGACGAGGATGGACATAGGAC]]> B <![CDATA[ GAAGGTCGGAGTCAACGGATT GGACGAGGATGGACATAAGGAT]]> C AGATTGAGAAGAAGATGGATGGC

[0018] Note: GAAGGTGACCAAGTTCATGCT is tag sequence A.

[0019] GAAGGTCGGAGTCAACGGATT is the tag sequence B.

[0020] The principle of KASP: Amplification requires three primers: two forward competing primers (the 5' end of the primers has a base sequence complementary to the fluorescent groups HEX and FAM, and the other sequences differ only at the SNP and InDel at the 3' end) and one reverse common primer; the PCR reaction system contains universal sequences modified with fluorescent and quenching groups (Master Mix provided by LGC). Therefore, the forward primers can specifically bind to DNA with the same genotype. The two forward primers can emit two different colors of light. If the site in the template strand is homozygous, it emits a single fluorescence that matches it; if it is heterozygous, it can emit two fluorescences simultaneously. The KASP-labeled PCR amplification system consisted of the following 5 µl reaction mixture: 0.056 μl Primer Mix, 2.5 μl Master Mix, 2.2 μl Template DNA (50 ng / μl), and 0.244 μl ddH2O. The Master Mix was purchased from LGC. The Primer Mix composition was 12% HEX primers, 12% FAM primers, and 30% Common primers. The primers were synthesized by Shanghai Yingjun Technology Co., Ltd. Amplification was performed using a 384-well PCR instrument (BIO-RAD, S1000TM Thermal Cycler) with the following program: 94℃ for 15 min; 94℃ for 20 s, 63-55℃ for 1 min (decreasing by 1℃ per cycle), 10 cycles; 94℃ for 20 s, 55℃ for 60 s, 32 cycles. PCR products were scanned using the Fluorophore beam scanning function of Bio-Rad CFX Manager software, and the scan data were genotyped using AllelicDiscrimination software. If the fluorescence signal data of the wheat amplification product appears blue when analyzed by Allelic Discrimination software, the genotype of the wheat QGW.haust-1D locus is TT; if the fluorescence signal data of the wheat amplification product appears yellow when analyzed by Allelic Discrimination software, the genotype of the wheat QGW.haust-1D locus is CC.

[0021] The method and the reagent kit described herein are both within the scope of protection of this invention.

[0022] This invention also protects a novel wheat husk wax QTL and its linked molecular markers, named QGW.haust-1D, located on chromosome 1D, with flanking markers AX-10945353 and AX-94438415, and a physical range of 0.91–2.14 Mb; its tightly linked SNP marker is AX-109453532 (see [link to SNP]). Figure 1 Under the four environmental conditions tested, the marker could explain 10.2-29.4% of the phenotypic variation. Specifically, the molecular marker could be obtained by amplifying the genomic DNA of Zhongmai 578 and Jimai 22 using the primer pair. This invention provides a novel marker for wheat glume wax QTLs, enabling marker-assisted screening of glume wax genes.

[0023] The molecular markers can be used in wheat breeding to assist in the selection of wheat husk wax.

[0024] The following examples are provided to help better understand the present invention, but are not intended to limit the invention.

[0025] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples can be purchased from regular biochemical reagent stores.

[0026] In the examples, the discovery of a novel husk wax QTL in wheat material wheat 578 and the acquisition of its KASP marker are described:

[0027] I. Obtaining the phenotype

[0028] The Zhongmai 578 / Jimai 22 RIL population was planted in Xinxiang and Shangqiu, Henan Province, and Gaoyi, Hebei Province, in the 2020-2021 experimental season. A completely randomized block design with three replicates was used, with single-row plots, row lengths of 1 m, row widths of 0.25 m, and 30 seeds evenly sown per row. Conventional management was implemented. The waxy texture of the glume was graded 20 days after flowering. Genomic DNA was extracted from the young leaves of 262 families using a modified CTAB method (Murray et al., 1980). DNA concentration was determined using a NanoDrop 2000c spectrophotometer, and the DNA samples were adjusted to a standard concentration of 50 ng / µl. DNA quality was then assessed using 0.8% agarose gel electrophoresis. SNP genotyping was performed on qualified DNA samples. SNP analysis was conducted using a 50K SNP chip developed in collaboration between the Institute of Crop Science, Chinese Academy of Agricultural Sciences, and Affymetrix Axiom.

[0029] II. Linkage Graph Construction

[0030] The 50K SNP chip contained 54,680 markers, of which 11,526 differed between parents. After removing markers that were heterozygous or had a deletion rate greater than 10%, 10,631 markers remained. Redundant markers were removed using the IciMapping 4.1 bin function, leaving 9,354 markers. These 9,354 markers were imported into the online tool MSTMap, and the SingleGL parameter was selected to construct a large linkage group. Then, based on the genetic distance and chromosome position information between markers, 34 linkage groups were constructed, containing a total of 1,507 markers.

[0031] III. QTL Analysis

[0032] QTL analysis was performed using the ICIM-ADD method of IciMapping 4.1, with a LOD value of 3.0. A stable QTL was located on chromosome 1D and named QGW.haust-1D. Figure 1 The flanking markers were AX-10945353 and AX-94438415, with a physical range of 0.91–2.14 Mb. Under different environmental conditions, they explained 10.2–29.4% of the phenotypic variation (see Table 2). Figure 1 Its closely linked marker AX-109453532 was transformed into Kasp-AX-109453532, and the genotypes of 363 wheat varieties were examined.

[0033] Table 2. QGW.haust-1D of the Zhongmai 578 × Jimai 22 RIL population detected by the composite interval mapping method. Environment Location Marker Interval Physical Location (Mb) LOD Explained Phenotypic Variation (%) Additive Effect Xinxiang 2021 0 AX-10945353-AX-94438415 0.91-2.14 9.3 10.2 -0.52 Shangqiu 2021 0 AX-10945353-AX-94438415 0.91-2.14 12.6 12.9 -0.48 Luoyang 2021 0 AX-10945353-AX-94438415 0.91-2.14 25.8 29.4 -0.66 Gaoyi 2021 0 AX-10945353-AX-94438415 0.91-2.14 15.9 16.8 -0.45 BLUE 0 AX-10945353-AX-94438415 0.91-2.14 22.6 21.7 -0.53

[0034] IV. Utilization of Primer Pairs

[0035] The experimental materials consisted of 363 wheat varieties, as detailed in Table 3.

[0036] 1. All experimental materials were planted in Luoyang, Henan Province in 2021-2022, with two rows per material and a row length of 1.5m, and were managed using standard methods. The waxy texture of the glumes was graded and identified 20 days after flowering.

[0037] 2. All experimental materials were tested using the Kasp-AX-109453532 label.

[0038] The results are shown in Table 3 and Figure 2 Of the 363 wheat varieties, 321 varieties showed the Jimai 22 genotype with a glume wax grade of 3.10; 42 varieties showed the Zhongmai 578 genotype with a glume wax grade of 2.69; statistical tests showed that the gene effect of QGW.haust-1D reached a significant difference (P < 0.05).

[0039] Table 3. Genotyping results and glume wax grading of 363 wheat varieties. Number Variety Name Marker Glume Waxiness Classification 1 Sahgiacoma CC 4 2 01073-46 CC 3 3 14080-18 CC 3 4 96 Yi 3115 CC 2 5 9773-6-2-2 CC 1 6 99041-39-3 CC 1 7 99228-20-3-4 CC 3 8 99229-5-1 CC 3 9 HF3-43 CC 2 10 Hodest CC 4 11 JK60568 CC 2 12 JM804 CC 3 13 kalepwa CC 3 14 Krata CC 3 15 Lpm No. 8 CC 3 16 Lpm No. 9 CC 3 17 LS2469 CC 3 18 LS2612 CC 2 19 LS3666 CC 3 20 M29 CC 2 21 Moieti CC 4 22 PH633 CC 2 23 SH5243 CC 3 24 SY399 CC 3 25 SY400 CC 2 26 SY402 CC 3 27 Vaidlet CC 4 28 White Hard Wheat No. 2 CC 1 29 Fengchan 3 CC 3 30 Gaoyou 503 CC 4 31 Guomai 1705 CC 4 32 Han 15276 CC 3 33 Handan 3415 CC 4 34 Hanyou 3475 CC 4 35 Hanxuan 10 CC 2 36 Hedong TX-006 CC 4 37 Heng 14-K2-3 CC 3 38 Heng 4338 CC 5 39 Huai 1917 CC 3 40 Huaiyin 9628 CC 4 41 Huiyan 1515 CC 3 42 Jimai 22 CC 4 43 Jimai 44 CC 3 44 Jimai 52 CC 4 45 Jimai 60 CC 4 46 Jinan 2 CC 2 47 Jimai 665 CC 2 48 Jimai 825 CC 4 49 Jinmai 2148 CC 2 50 Kemai 1906 CC 2 51 Kenxing 7 CC 4 52 Laizhou 95060 CC 3 53 Liangxing 66 CC 3 54 Liangxing 99 CC 3 55 Lin 091 CC 5 56 Lin 93 CC 2 57 Linhan 51329 ​ 2 58 ​ ​ 1 59 ​ ​ 3 60 ​ ​ 2 61 ​ ​ 1 62 ​ ​ 5 63 ​ ​ 3 64 ​ ​ 2 65 ​ ​ 3 66 ​ ​ 5 67 ​ ​ 4 68 ​ ​ 1 69 ​ ​ 1 70 ​ ​ 1 71 ​ ​ 2 72 ​ ​ 3 73 ​ ​ 3 74 ​ ​ 2 75 ​ ​ 4 76 ​ ​ 4 77 ​ ​ 4 78 ​ ​ 4 79 ​ ​ 2 80 ​ ​ 2 81 ​ ​ 3 82 ​ ​ 2 83 ​ ​ 3 84 ​ ​ 3 85 ​ ​ 3 86 ​ ​ 2 87 ​ ​ 3 88 ​ ​ 4 89 ​ ​ 5 90 ​ ​ 2 91 ​ ​ 4 92 ​ ​ 4 93 ​ ​ 3 94 ​ ​ 1 95 ​ ​ 1 96 ​ CC 1 97 Stone 114195 CC 2 98 Shimai 15 CC 3 99 Su Yanmai 018 CC 4 100 Mount Tai 23 CC 5 101 Taitian wheat 125 CC 3 102 Tian 95-3 CC 3 103 Copper Wheat No. 4 CC 2 104 Copper Wheat No. 6 CC 4 105 Wanyuan Little Ice Wheat CC 5 106 Anhui Wheat 50-51-7 CC 3 107 Wei Mai No. 15 CC 3 108 Northwest A&F University 418 CC 2 109 Northwest A&F University 794-3 CC 2 110 Xiao Yan No. 4 CC 3 111 Xinmai 45 CC 2 112 Xinmai 58 CC 2 113 D27 cigarettes CC 4 114 Tobacco farmer 0428 CC 4 115 Tobacco farmer 173 CC 3 116 144 in the smoke CC 5 117 Yanbo169 CC 5 118 wildcat CC 2 119 wildcat mutation CC 5 120 12 CC 2 121 Yumai No. 2 CC 2 122 Yunfenghan No. 10 CC 3 123 Transporting drought 137 CC 1 124 Yunhan 1512 CC 1 125 Early-maturing ryegrass CC 5 126 4640 CC 1 127 4853 CC 2 128 7211 CC 4 129 8744 CC 1 130 Changyou 173 CC 2 131 Zhengmai 136 CC 5 132 Zhengmai 369 CC 2 133 Zhengmai 379 CC 5 134 Zhengzhou 15 CC 2 135 Zhengzhou 15 CC 2 136 Zhengzhou 5118 CC 3 137 Chinese Spring CC 3 138 Zhongliang 12173-6-27-1 CC 3 139 Zhongliang 13065-3-1 CC 2 140 Zhongliang 13288-3-2 CC 2 141 Zhongliang 14580 CC 4 142 Zhongmai 175 CC 2 143 Zhongxin 4899 CC 3 144 Zhongxin5128 CC 5 145 Zhongxin5199 CC 3 146 Zhongxin 7503 CC 3 147 Zhongxin8678 CC 3 148 Zibo Wheat 70 CC 3 149 0020F3-95W-13-1-2-1 CC 4 150 03CA42 CC 3 151 06H732 CC 5 152 07022-130-13-8 CC 4 153 09H89-7-2-5 CC 4 154 10133-19-7 (6 lines) CC 5 155 10133-8-16-0-5-4-2 CC 3 156 11070-13-1-3-2 CC 4 157 13089-6-1-3 CC 5 158 1343HPGSF2BG CC 3 159 2016 F3 selection of Da Sui CC 4 160 9909-15-1 CC 2 161 99226-10-6 CC 4 162 Ackarma CC 3 163 CP20-3-3-4-1 CC 3 164 D16H580-73 CC 5 165 HF2-52 HY18129-2 6 / fr10-8-2 CC 2 166 hpg 13001-8-2 CC 4 167 HPG95 CC 3 168 Kvemwa CC 4 169 PH822-10 CC 2 170 Samgiacomo CC 4 171 SN105678 CC 5 172 SY397(LS4211) CC 2 173 Hengke 6021 CC 2 174 Shan Nong 981 CC 3 175 The Sage 178 CC 3 176 W52 CC 1 177 X9614 Tianshui-2 CC 4 178 Af CC 2 179 58 Low resistance CC 5 180 Anqing No. 1 CC 3 181 White Jade 119 CC 3 182 207 droughts CC 5 183 207 Bai Nong CC 4 184 3217 Bai Nong CC 3 185 416 Bai Nong CC 4 186 418 Bai Nong CC 3 187 Bai Nong 889 CC 5 188 Bima No. 3 CC 2 189 Bima No. 4 CC 4 190 Caiyuan No. 7 CC 5 191 Da Sui 02 CC 3 192 Panmai No. 8 CC 5 193 Pan-Yew Wheat 17 CC 4 194 Fengde Wheat Storage 16 CC 4 195 Gao9415 CC 3 196 Gaoyou 5766 CC 3 197 Gongjiao No. 1 CC 3 198 Handan 6050 CC 3 199 Handan 6172 CC 3 200 Handan 9024 CC 3 201 Hangyu 33 CC 2 202 Hemai 601 CC 3 203 Heng 6092 CC 2 204 Heng 7004 CC 2 205 Heng H13 View 26 CC 3 206 Heng Y165305 CC 3 207 Huimai 399 CC 3 208 Jimai 20 CC 3 209 Jimai No. 2 CC 4 210 Jimai No. 6 CC 3 211 Jimai 080 CC 3 212 Jimai 520 CC 2 213 Jinkemai No. 1 CC 3 214 Jinmai 97 CC 2 215 Komai No. 1 CC 3 216 Lennon 03101 CC 3 217 Lankao 86 (79) 2-2-3 CC 2 218 Drought 6057 CC 3 219 Longyu0825 CC 2 220 Longyuan 95-111-3 CC 2 221 Longyuan 98-178-3-1 CC 2 222 Longyuan 98-86 CC 3 223 Longyuan 98t-23-101 CC 5 224 Longzhong No. 5 CC 3 225 Luo 07419 CC 3 226 Luo 11070-10-29-1 CC 3 227 Luo 11071-82-8 CC 3 228 Luo 13001-7 CC 4 229 Luohan No. 10 CC 3 230 Luohan No. 11 CC 2 231 Luohan No. 15 CC 5 232 Luohan No. 22 CC 5 233 Luohan No. 26 CC 3 234 Luohan No. 27 CC 3 235 Luohan No. 30 CC 5 236 Luohan No. 31 CC 4 237 Luohan No. 32 CC 5 238 Luohan No. 33 CC 4 239 Luohan No. 34 CC 3 240 Luohan No. 36 CC 4 241 Luohan No. 38 CC 5 242 Luohan No. 3 CC 4 243 Luohan No. 6 CC 2 244 Luohan No. 7 CC 4 245 Luohan No. 8 CC 3 246 Luohan No. 9 CC 4 247 Loma 28 CC 3 248 Lomai 37 CC 5 249 Loma 42 CC 4 250 Lomai 47 CC 4 251 Lomai 93353 CC 4 252 South NIZIJA CC 4 253 South NS90 / 92 CC 2 254 Nanjing Agricultural University 06y607 CC 3 255 Neixiang 6028 CC 2 256 Ping An 518 CC 3 257 Three subjects 301 CC 3 258 Shan Nong 25 CC 3 259 Shan Nong 611436 CC 4 260 Shan Nong 981 CC 2 261 Shi Luan 02-1 CC 3 262 Stone 12-4025 CC 2 263 No. 8 Shijiazhuang CC 3 264 Shimai 12 CC 2 265 Sumai No. 3 / 13 CC 5 266 Matthew 714 CC 2 267 Tycoon 38 CC 4 268 Tycoon 41 CC 3 269 Taitian wheat 126 CC 3 270 Tian9857-531 CC 4 271 Tianshui 98SF531-1-1-1-18-1 CC 3 272 Tianshui 98SF531-1-11-33-1 CC 3 273 Tianshui 98SF542-8-1-2 CC 4 274 Tian Feng 182 CC 2 275 Copper Wheat No. 3 CC 2 276 Anonymous-1 CC 2 277 Northwest A&F University 11 CC 2 278 Northwest A&F University 121 CC 4 279 Northwest A&F University 213 CC 3 280 Xinnong 28 CC 3 281 6861 Wheat CC 3 282 Little Blue Wheat CC 2 283 Xiao Yan 22 CC 5 284 Xinmai 38 CC 2 285 Xinmai 39 CC 3 286 Xinmai 60 CC 4 287 Xinyuan 9304 CC 2 288 Xinhua Mai 818 CC 3 289 Xu Ke 718 CC 4 290 21 cigarettes CC 2 291 Tobacco Farmer 1212 CC 4 292 Tobacco farmer 21 CC 3 293 Yanbo505 CC 4 294 Yanda 25 CC 5 295 167 cm tall CC 3 296 Yufengshuo 002 CC 4 297 Yumai No. 38 CC 2 298 Yumai 48 CC 3 299 Henan Agricultural 4023 CC 4 300 Gimbal 301 CC 3 301 Transporting drought 115 CC 4 302 Transporting drought 139-2 CC 2 303 6878 CC 2 304 Changzhi 03-6216 CC 4 305 Zhengfeng No. 7 CC 1 306 Zhengmai 1860 CC 4 307 Zhengmai 6687 CC 3 308 Zhongliang 12173-10-18-1 CC 3 309 Zhongliang 12173-6-1-22 CC 2 310 Zhongliang 13065 - 3 - 2 CC 3 311 Zhongliang 38 CC 3 312 Zhongmai 30 CC 4 313 Zhongmai 895 CC 4 314 Zhongyou 9507 CC 4 315 Zhongyu 1702 CC 3 316 Central Plains 20 CC 3 317 Zhongxin 6186 CC 2 318 Zhoumai 22 CC 5 319 Zhoumai 32 CC 3 320 Zhoumai 36 CC 3 321 207-25 CC 2 322 Fengdecun No. 5 TT 2 323 Fengde Cunmai No. 5 TT 2 324 South Ilataka TT 3 325 Neixiang 36 TT 2 326 Youth 18 TT 2 327 Shannong 06-278 TT 1 328 U10 TT 1 329 Northwest A&F University 20 TT 2 330 Northwest A&F University 22 TT 2 331 Zhoumai 28 TT 2 332 09231 TT 3 333 10020-7 TT 2 334 98138-2-1 TT 2 335 GDR2(6-4) TT 4 336 J08H270-3-5-5-2 TT 3 337 Q104-3 TT 3 338 419 Bai Nong TT 4 339 Huayu 166 TT 3 340 Jimai No. 3 TT 4 341 Jinong No. 6 TT 3 342 Insect-resistant No. 1 TT 3 343 Lantian 43 TT 2 344 Lantian 48 TT 1 345 Longping Wheat No. 13 TT 2 346 Longjian 385 TT 3 347 Longyuan 935 TT 3 348 Longyuan 98t-23-2-3 TT 1 349 Luohan No. 19 TT 4 350 Luohan No. 1 TT 3 351 Loma 34 TT 4 352 Tai Nong 771 TT 4 353 Tian912 TT 4 354 Tianshui 9998-3-1-1-1 TT 3 355 Northwest A&F University 535 TT 3 356 Yumai No. 8 TT 3 357 Henan Agricultural University 523 TT 3 358 Changwu 863 TT 1 359 Zhengmai 7698 TT 3 360 Zhongmai 578 TT 2 361 16th of the week TT 4 362 Zhoumai 18 TT 4 363 Zhoumai 30 TT 3

Claims

1. A KASP-labeled primer set, characterized in that: The KASP marker primer set is used to detect the genotype corresponding to a molecular marker closely linked to a wheat glume wax QTL, wherein the QTL is QGW.haust-1D and the molecular marker is Kasp-AX-109453532; the KASP marker primer set includes: Primer A, the nucleotide sequence of which is shown in SEQ ID NO: 1; Primer B, the nucleotide sequence of which is shown in SEQ ID NO: 2; Primer C, whose nucleotide sequence is shown in SEQ ID NO:

3.

2. A reagent kit for detecting the waxy properties of wheat husks, characterized in that: It includes the KASP-tagged primer set as described in claim 1.

3. A method for genotyping detection of the waxy trait in wheat husks, characterized in that: Includes the following steps: Step 1: Extract genomic DNA from the wheat to be tested; Step 2: Using the wheat genomic DNA to be tested as a template, perform PCR amplification using the KASP marker primer set described in claim 1 to obtain the amplification product; Step 3: The amplification products obtained in Step 2 are subjected to fluorescence beam scanning. The scanning data are analyzed using Allelic Discrimination genotyping software, and the wheat QGW.haust-1D locus genotype is determined based on the analysis results.

4. The method according to claim 3, characterized in that: In step three, the method for determining the wheat QGW.haust-1D locus genotype based on the analysis results is as follows: if the fluorescence signal data of the amplified product of the wheat to be tested shows blue after software analysis, then the wheat QGW.haust-1D locus genotype is TT; if the fluorescence signal data of the amplified product of the wheat to be tested shows yellow after software analysis, then the wheat QGW.haust-1D locus genotype is CC.

5. The application of the KASP-labeled primer set according to claim 1, the kit according to claim 2, or the method according to any one of claims 3-4 in any one of the following (A)-(C): (A): Genotype of QGW.haust-1D locus used to detect wheat or wheat hybrid offspring; (B): Used for identification or auxiliary identification of the waxy properties of wheat husks; (C): Used for breeding, screening or assisting in the screening of wheat individual plants, lines, strains or varieties with strong stress resistance.