SSR (simple sequence repeat) molecular markers closely linked with maize fusarium verticillium ear rot resistant QTL (quantitative trait loci) and detection method

Abstract

The invention relates to the technical field of molecular biology, in particular to a group of SSR (Simple Sequence Repeat) molecular markers closely linked with a maize fusarium verticillium ear rot resistant QTL (Quantitative Trait Locus) and a detection method. As an SSR molecular marker, nucleic acid fragment SSR-51 and SSR-56 molecular markers are closely linked with the maize fusarium verticillium ear rot resistant gene, the recombination rate is low, the marker stability is high, and the primer can be used for effective detection, so that the molecular marker can be directly used for breeding links such as maize germplasm resource improvement, selfing line breeding and hybrid seed selection; according to the method, the disease-resistant genotype is identified through DNA detection in the corn seedling stage, and plant diseases do not need to be waited; the method has the advantages of high efficiency in detection, small quantity of required DNA samples, low requirement on DNA, simplicity in operation, high reliability, great allelic difference and no need of radioisotope.

Description

Technical Field

[0001] This invention relates to the field of molecular biology, and more specifically, to a set of SSR molecular markers and detection methods closely linked to QTLs for maize resistance to Fusarium wilt. Background Technology

[0002] Maize *Fusarium oxysporum* ear rot, a global fungal disease, not only causes yield loss but also produces mycotoxins such as fumonisin, threatening human and animal health. Its resistance is controlled by multiple genes with minor effects and often involves co-infection with various pathogens, posing a significant challenge to the accuracy of current molecular marker development. While existing technologies have located numerous resistance loci such as UMC23, UMC42, NBL15, and qRfv2 through linkage mapping and genome-wide association analysis, and have preliminarily identified candidate genes such as ZmXYXT2, they generally suffer from three main shortcomings: First, most markers are designed for a single pathogen, Fusarium graminearum, but in actual production, Fusarium graminearum, Pythium spp., and other pathogens often cause mixed infections, resulting in a serious deviation between the prediction results of single pathogen markers and the broad-spectrum resistance phenotype in the field.

[0003] Secondly, the reported QTL intervals are broad (e.g., the initial localization interval of qRfv2 is 7Mb), lacking the development of functional causal variations. Most of them are linkage markers, which lose accuracy due to frequent recombination in breeding populations, and there are no mature commercial functional markers available for application.

[0004] Third, resistance to ear rot, as a typical quantitative trait, is significantly affected by environmental stress and genetic background. Existing biomarkers have failed to effectively analyze the genotype-environment interaction effect. Phenotypic identification itself suffers from technical bottlenecks such as inconsistent maturity judgment standards and lagging toxin content detection, which further amplify the deviation between the predicted values ​​of molecular markers and the actual resistance level. This makes traditional breeding, which relies on phenotypic screening, inefficient and costly, and molecular breeding is difficult to break through.

[0005] Therefore, there is an urgent need for effective methods and related molecular markers to screen for genes that resist Fusarium wilt in maize. Summary of the Invention

[0006] The technical problem to be solved by the present invention is to provide SSR molecular marker primers, kits and detection methods for maize resistance to Fusarium wilt.

[0007] The technical solution of the present invention to solve the above-mentioned technical problems is as follows: This invention provides a set of SSR molecular markers closely linked to QTLs for resistance to Fusarium wilt in maize. The molecular markers are nucleic acid molecules. The nucleic acid molecules include nucleic acid fragment SSR-51 between bases 157010935 and 157010949 on maize chromosome 3, and nucleic acid fragment SSR-56 between bases 157059530 and 157059543.

[0008] This product also provides SSR molecular marker primers for maize resistance to Fusarium wilt, including primer sets for detecting the nucleic acid fragment SSR-51 as described above, and primer sets for detecting the nucleic acid fragment SSR-56 as described above.

[0009] Furthermore, the primer set used to detect the nucleic acid fragment SSR-51 includes a first forward primer as shown in sequence SEQ ID NO.1 and a first reverse primer as shown in sequence SEQ ID NO.2.

[0010] Furthermore, the primer set used to detect the nucleic acid fragment SSR-56 includes a second forward primer as shown in sequence SEQ ID NO.3 and a second reverse primer as shown in sequence SEQ ID NO.4.

[0011] The present invention also provides a detection kit for maize resistance to Fusarium wilt, comprising the SSR molecular marker primers for maize resistance to Fusarium wilt as described above.

[0012] Furthermore, it also includes a 2×M5 HiPer plus Taq HiFi PCR mix and genome extraction reagents.

[0013] The present invention also provides a method for detecting the genotype of maize resistant to Fusarium wilt, using the kit described above to detect the gene lengths of the nucleic acid fragments SSR-51 and SSR-56 in the genome of the maize sample, and determining whether the maize sample has the genotype of resistance to Fusarium wilt based on the detection results.

[0014] Furthermore, the specific process for determining the genotype of resistance to Fusarium wilt is as follows: when the length of the nucleic acid fragment SSR-51 in the maize sample is 95 bp and the length of the nucleic acid fragment SSR-56 is 50 bp, the maize sample is determined to have the genotype of resistance to Fusarium wilt.

[0015] Furthermore, the following steps are included: Step 1: Extract total genomic DNA from maize leaves using the CTAB method as a DNA template; Step 2: Perform PCR amplification on the DNA template using the kit described above; Step 3: Determine the length of the PCR amplification product using polyacrylamide gel electrophoresis; Step 4: Determine the genotype of the corn sample based on the gene length results.

[0016] Furthermore, the PCR amplification system includes 1.5 μL of 50 ng / μL DNA template, 1 μL of primers, 5 μL of 2×M5HiPer plus Taq HiFi PCR mix, and 2.5 μL of ddH2O; The PCR reaction procedure was as follows: 94 °C pre-denaturation for 3 min; 94 °C denaturation for 30 s, 55–60 °C annealing for 30 s, 72 °C extension for 2 min, 35 cycles; 72 °C extension for 10 min; storage at 4 °C.

[0017] The beneficial effects of this invention are as follows: (1) The SSR molecular marker for maize resistance to Fusarium oxysporum ear rot of the present invention is closely linked to the QTL for maize resistance to Fusarium oxysporum ear rot, with low recombination rate and high marker stability, and can be used to track disease resistance genes; (2) The SSR molecular marker primers for maize resistance to Fusarium oxysporum ear rot of the present invention can effectively detect SSR-51 molecular markers and SSR-56 molecular markers, determine the QTL for maize resistance to Fusarium oxysporum ear rot, so that the molecular marker can be directly used in breeding links such as maize germplasm resource improvement, inbred line selection, and hybrid selection; (3) The method for detecting the genotype of maize resistant to Fusarium wilt of the corn in this invention can identify the resistant genotype by DNA detection during the maize seedling stage, without waiting for the plant to develop the disease; (4) The method for detecting the maize genotype resistant to Fusarium wilt of Verticillium in this invention is highly efficient, requires a small amount of DNA sample, has low requirements for DNA, is simple to operate, has high reliability, has a large number of allelic differences, and does not require the use of radioactive isotopes. Attached Figure Description

[0018] Figure 1 This is a gel image showing the expression of SSR-51 and SSR-56 molecular markers in the parent in Example 1 of the present invention; Figure 2 In Example 1 of the present invention, the SSR-51 molecular marker is located at F 3:4 Performance in a subset of groups; Figure 3 In Example 1 of the present invention, the SSR-56 molecular marker is located at F 3:4 Performance in a subset of groups; Figure 4 This is the genetic linkage map of SSR-51 and SSR-56 on the chromosome in Embodiment 2 of the present invention; Figure 5 In Embodiment 1 of the present invention, a QTL mapping genetic map is provided. Figure 6 In Example 1 of the present invention, the CIM method was used to locate the QTL map of resistance to corn ear rot. Detailed Implementation

[0019] The principles and features of the present invention are described below. The examples given are only for explaining the present invention and are not intended to limit the scope of the present invention.

[0020] The present invention relates to an SSR molecular marker closely linked to the QTL for resistance to Fusarium wilt in maize, characterized in that the molecular marker is a nucleic acid molecule; the nucleic acid molecule includes nucleic acid fragment SSR-51 between bases 157010935 and 157010949 on maize chromosome 3, and nucleic acid fragment SSR-56 between bases 157059530 and 157059543.

[0021] The SSR molecular markers of this invention, SSR-51 and SSR-56, are closely linked to the QTL for maize resistance to Fusarium wilt, located within the resistance functional region on chromosome 3 (156327595bp-157801329bp). Through F1 testing... 2:3 F 3:4 After multiple generations of population validation, the recombination rate is low, the marker stability is high, and the disease resistance gene can be tracked.

[0022] The aforementioned SSR molecular markers can be used to identify disease-resistant genotypes through DNA detection during the corn seedling stage, without waiting for the plants to develop symptoms. Seedling-stage detection can replace autumn disease selection, enabling early selection or elimination, which can greatly reduce field production costs, avoid environmental interference with phenotypic identification, and shorten the breeding cycle by 2-3 generations.

[0023] Specifically, the maize gene is the maize reference gene sequence AGPv5.

[0024] Preferably, the corn variety used in this invention is B73.

[0025] The aforementioned SSR molecular markers can be applied to maize breeding to obtain plants resistant to Fusarium wilt.

[0026] Preferably, the above-mentioned SSR molecular markers can be directly used in breeding processes such as maize germplasm resource improvement, inbred line selection, and hybridization, and have the advantage of wide application range. They also have important practical value in improving the breeding efficiency of maize resistance to Fusarium wilt.

[0027] The SSR molecular marker primers for maize resistance to Fusarium wilt of Verticillium include primers for detecting the genotype of the SSR molecular markers as described above.

[0028] The preferred and specific primers are as follows: Primer set for amplifying SSR-51: The first forward primer, CTACTAGTCCACCGTACGCG (SEQ ID NO.1), is designed based on the 157010935bp site on chromosome 3.

[0029] The first reverse primer, GTCGTAGTGCGGTGCTGG (SEQ ID NO.2), is designed based on the 157010949bp site on chromosome 3.

[0030] Primer set for amplifying SSR-56: The second forward primer, GCATCAGCTAGCATTTGGCC (SEQ ID NO.3), is designed based on the 157059530bp site on chromosome 3.

[0031] The second reverse primer, GTCCCTCCATCCTGGTTTGG (SEQ ID NO.4), is designed based on the 157059543bp site on chromosome 3.

[0032] The maize resistance test kit for Fusarium wilt of Verticillium spp. of the present invention includes primers as described above.

[0033] Preferably, it also includes 2×M5 HiPer plus Taq HiFi PCR mix and genome extraction reagents.

[0034] The present invention also provides a method for detecting QTLs of resistance to Fusarium oxysporum ear rot in maize. The method uses the kit described above for detection and determines whether the maize sample has a genotype resistant to Fusarium oxysporum ear rot based on the genotype band lengths of SSR-51 and SSR-56 in the genome of the maize sample.

[0035] Specifically, for SSR-51, when its genotype band length is 95bp, it is determined to be a genotype containing the QTL for resistance to Fusarium wilt, and when its genotype band length is 80bp, it is determined to be a genotype that does not contain the QTL for resistance to Fusarium wilt.

[0036] For SSR-56, when its genotype band length is 50 bp, it is determined to be a genotype containing the QTL for resistance to Fusarium wilt, and when its genotype band length is 60 bp, it is determined to be a genotype that does not contain the QTL for resistance to Fusarium wilt.

[0037] Based on the length of the genotype bands mentioned above, the specific process for determining the genotype resistant to Fusarium wilt is as follows: When the genotype band length of SSR-51 in the maize sample is 95bp and the band length of SSR-56 is 50bp, the maize sample is determined to have a QTL for resistance to Fusarium wilt. When the SSR-51 genotype band is 80bp or the SSR-56 genotype band is 60bp in a maize sample, the maize sample is determined to not have the QTL for resistance to Fusarium wilt, and is therefore a susceptible genotype for Fusarium wilt.

[0038] Preferably, it includes the following steps: Step 1: Extract total genomic DNA from maize leaves using the CTAB method as a DNA template.

[0039] Step 2: Perform PCR amplification on the DNA template using the kit.

[0040] The PCR amplification system included 1.5 μL of 50 ng / μL DNA template, 1 μL of primers, 5 μL of 2×M5 HiPerplus Taq HiFi PCR mix, and 2.5 μL of ddH2O.

[0041] The PCR reaction program was as follows: 94 °C pre-denaturation for 3 min; 94 °C denaturation for 30 s, 55–60 °C annealing for 30 s, 72 °C extension for 2 min, 35 cycles; 72 °C extension for 10 min; storage at 4 °C. Step 3: Genuine the PCR amplification products using 8% polyacrylamide gel electrophoresis.

[0042] Step 4: Determine the genotype of the maize sample based on the typing results.

[0043] The molecular markers of this invention can be used for assisted breeding, and the specific steps are as follows: Maize plants containing the SSR molecular marker disease-resistant QTLs described above in their genome were selected as parents; the parents were crossed with maize plants to be improved to obtain offspring plants; the offspring plants were genotyped using the detection methods described above, and plants carrying both SSR-51 and SSR-56 disease-resistant genotypes were screened to complete the breeding selection.

[0044] The present invention will be illustrated by specific embodiments below.

[0045] Example 1: Obtaining and Validating SSR Molecular Markers An F2 population was constructed by crossing the inbred line Liao 3012 (resistant parent) and the susceptible inbred line Liao C468 (susceptible parent) with Fusarium wilt resistant to Verticillium rot. QTL mapping was performed using a 10K liquid-phase chip, and the mapping results are as follows: Figure 6 As shown, the QTL positioning process is as follows: Using Liao 3012 as the disease-resistant material and Liao C468 as the disease-susceptible material, a hybrid combination was prepared, and F2 segregating populations were planted. The disease severity of individual F2 plants was identified by inoculation with Fusarium verticillatum. A total of 275 individual plants were harvested. The disease severity of the ears was determined using an AI recognition system. Based on the theory that recombination and exchange generally occur at fragment levels, SMOOTH software was used to correct potential errors in the progeny genotypes and fill in some missing sites according to genes before and after specific loci, thus obtaining the origin of individual plants. This allows for a direct understanding of the gene origin of different plant samples.

[0046] Genetic maps were constructed using the `mstmap` function in the R package `ASMap`. The map displays the location and density of each marker, with each 1 cM color representing 30 cM divided by the number of markers within a 15 cM range upstream and downstream of that 1 cM. QTL mapping was performed using the CIM complex localization method, employing the `cim` function in R / qtl to set specific scan steps for each trait.

[0047] Using LOD=3 as the threshold for QTL screening, the horizontal axis represents the genetic location on the chromosome (linkage group), and the vertical axis represents the LOD value. The blue curve is the LOD value curve, the short black vertical line below the blue curve indicates the location of the marker, and the red dashed line is the threshold line. The LOD value in the interval 149016912-161602963 on chromosome 3 is higher than the threshold, representing the candidate interval for ear rot resistance genes screened in this example.

[0048] The gel images of the SSR-51 and SSR-56 molecular markers in the parents are shown below. Figure 1 As shown in the diagram. Left image: SSR-51 molecular marker: The arrow on the left points to the marker; the middle band (approximately 95 bp) represents the genotype containing the QTL for resistance to *Fusarium oxysporum* rot, while the right band (approximately 80 bp) represents the genotype not containing the QTL for resistance to *Fusarium oxysporum* rot. Right image: SSR-56: The arrow on the left points to the marker; the middle band (approximately 50 bp) represents the genotype containing the QTL for resistance to *Fusarium oxysporum* rot, while the right band (approximately 60 bp) represents the genotype not containing the QTL for resistance to *Fusarium oxysporum* rot.

[0049] Further utilize F 2:3 F 3:4The population was finely localized, and by developing SSR markers and combining them with phenotypic association analysis, SSR-51 and SSR-56, which were significantly associated with disease resistance, were screened out.

[0050] Using F 3:4 The SSR-51 and SSR-56 molecular markers were validated in 63 exchange strains (out of a total of 4375 isolates) of the population, as follows: Leaf DNA was extracted using the CTAB method and used as a DNA template; the DNA template was then amplified by PCR.

[0051] The PCR amplification system consisted of 1.5 μL of 50 ng / μL DNA template, 1 μL of primers, 5 μL of 2×M5 HiPer plusTaq HiFi PCR mix, and 2.5 μL of ddH2O.

[0052] The PCR reaction program was as follows: pre-denaturation at 94 °C for 3 min; 35 cycles (94 °C, 30 s; 55–60 °C, 30 s; 72 °C, 2 min); extension at 72 °C for 10 min; and storage at 4 °C.

[0053] SSR molecular markers in F 3:4 Performance in some groups, such as glucographs Figure 2 and Figure 3 As shown. After molecular markers SSR-51 and SSR-56 were subjected to polyacrylamide gel electrophoresis, the presence of resistance to Fusarium wilt QTLs in the population could be determined by the position of the bands. Bands of approximately 95 bp and 50 bp (containing resistance to Fusarium wilt QTLs) were denoted as A, bands of approximately 80 bp and 60 bp (not containing resistance to Fusarium wilt QTLs) were denoted as B, bands containing both 95 bp and 80 bp were denoted as H, and bands containing both 50 bp and 60 bp were denoted as H.

[0054] Results Verification: As shown in Table 1, using part of F... 3:4 The accuracy of population-based detection of molecular markers SSR-51 and SSR-56 was assessed by calculating the disease index (DSI) for each population, including those with and without disease-resistant QTLs. 3:4 The population with DSI containing disease-resistant QTLs was larger than that without disease-resistant QTLs, and the overall population showed resistance to Fusarium wilt, demonstrating the high accuracy of SSR markers.

[0055] Table 1 Part F 3:4 Statistical table of disease resistance DSI and disease susceptibility DSI of the population Example 2: Chain Strength Verification This embodiment verifies the linkage strength of SSR-51 and SSR-56 obtained in Example 1, and the results are as follows: Figure 5 As shown. According to Figure 5 It can be seen that SSR-51 and SSR-56 can be linked to chromosome 3 simultaneously, indicating that they are highly stable as SSR molecular markers for maize resistance to Fusarium wilt.

[0056] Example 3: Application in Assisted Breeding This technology was used to improve the susceptible maize inbred line Liao 50518 using molecular markers. The inbred line Liao 3012, which carries the SSR molecular marker disease resistance allele, was crossed with the susceptible inbred line Liao 50518 to obtain the F1 generation. The F1 generation was obtained by backcrossing Liao 50518 to obtain the first backcross generation (BC1F1). The method of this invention was used to test 200 F2 plants, and 30 plants carrying two SSR molecular marker disease resistance alleles were selected. These plants were backcrossed again to obtain the second generation (BC2F1). After inoculation with Fusarium verticillatum in the field, the proportion of disease-resistant plants reached 90%, which was significantly higher than that of the randomly selected population.

[0057] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention.

Claims

1. A set of SSR molecular markers closely linked to a QTL for resistance to Gaeumannomyces graminis head smut in maize, characterized in that, The molecular marker is a nucleic acid molecule; the nucleic acid molecule comprises a nucleic acid fragment SSR-51 between base 157010935 and base 157010949 of chromosome 3 of corn, and a nucleic acid fragment SSR-56 between base 157059530 and base 157059543.

2. A SSR molecular marker primer for corn resistance to Gaeumannomyces graminis spike blight, characterized in that, The kit comprises a primer set for detecting the nucleic acid fragment SSR-51 of claim 1, and a primer set for detecting the nucleic acid fragment SSR-56 of claim 1.

3. The corn anti-P. teres ear rot SSR molecular marker primer of claim 2, wherein, The primer set for detecting the nucleic acid fragment SSR-51 comprises a first forward primer as shown in sequence SEQ ID NO. 1 and a first reverse primer as shown in sequence SEQ ID NO.

2.

4. The corn anti-P. teres ear rot SSR molecular marker primer of claim 2, wherein, The primer set for detecting the nucleic acid fragment SSR-56 comprises a second forward primer as shown in sequence SEQ ID NO. 3 and a second reverse primer as shown in sequence SEQ ID NO.

4.

5. A corn test kit for resistance to Gaeumannomyces graminis var. tritici foot blight, characterized by, The kit comprises the SSR molecular marker primer of corn resistance to Microdochium patch tip rot of any one of claims 2-4.

6. The maize resistance to Fusarium wilt disease according to claim 5, characterized in that, The kit further comprises 2xM5 HiPer plus Taq HiFi PCR mix and genomic extraction reagent.

7. A method for detecting a genotype of corn resistant to Gaeumannomyces graminis var. avena, characterized by, The kit of claim 5 or 6 is used to detect the gene length of the nucleic acid fragment SSR-51 and the nucleic acid fragment SSR-56 in the genome of a corn sample, and determine whether the corn sample has a genotype of resistance to Microdochium patch tip rot according to the detection result.

8. The method for detecting the genotype of maize resistant to Fusarium wilt according to claim 7, characterized in that, The specific process of determining the genotype of resistance to Microdochium patch tip rot is that when the length of the nucleic acid fragment SSR-51 is 95 bp and the length of the nucleic acid fragment SSR-56 is 50 bp in the corn sample, it is determined that the corn sample has a genotype of resistance to Microdochium patch tip rot.

9. The method for detecting the genotype of maize resistant to Fusarium wilt according to claim 7, characterized in that, The kit comprises the following steps: Step 1: total DNA of corn leaf genome is extracted by CTAB method as a DNA template; Step 2: the DNA template is subjected to PCR amplification using the kit; Step 3: the length of the PCR amplification product is determined by polyacrylamide gel electrophoresis; Step 4: the genotype of the corn sample is determined according to the gene length result.

10. The detection method of a genotype of corn resistance to Microdochium patch tip rot of claim 9, wherein The PCR amplification system comprises 1.5 μL of 50 ng / μL DNA template, 1 μL primer, 5 μL of 2xM5 HiPer plus Taq HiFi PCR mix, and 2.5 μL ddH2O; The PCR reaction program is: 94 ℃ pre-denaturation for 3 min; 94 ℃ denaturation for 30 s, 55-60 ℃ annealing for 30 s, 72 ℃ extension for 2 min, 35 cycles; 72 ℃ extension for 10 min; 4 ℃ storage.

Images