Oral mRNA vaccine delivery system aiming at schistosoma japonicum katsurada insect protection host

By using Bacillus subtilis spore vectors and electroporation technology, mRNA encoding multi-stage antigens of Schistosoma japonicum was introduced into the host, solving the delivery problem of oral mRNA vaccines in the host that harbors the parasite in existing technologies, and achieving efficient and low-cost large-scale immunization.

CN121754652APending Publication Date: 2026-03-31SUN YAT SEN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511858860.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-10
Publication Date
2026-03-31

AI Technical Summary

Technical Problem

Existing technologies make it difficult to apply oral mRNA vaccines on a large scale in parasite-carrying hosts. Traditional vaccines are costly, lack immunogenicity, and existing vectors are not resistant to gastric acid degradation and have poor intestinal mucosal penetration, thus failing to effectively deliver modified mRNA molecules.

Method used

Using Bacillus subtilis spores as a carrier, mRNA encoding multi-stage antigens of Schistosoma japonicum is introduced into the spores through electroporation technology, and then freeze-dried into powder and mixed with feed to achieve oral immunization.

Benefits of technology

Stable delivery and expression of mRNA in the host organism were achieved, stimulating mucosal and systemic immune responses, significantly improving the broad-spectrum protection and efficacy of the vaccine, making it suitable for large-scale immunization and reducing production costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121754652A_ABST
    Figure CN121754652A_ABST
Patent Text Reader

Abstract

The invention relates to an oral mRNA vaccine delivery system aiming at schistosoma japonicum katsurada parasite protecting hosts. The invention discloses an oral mRNA vaccine based on a bacillus subtilis spore delivery system for schistosoma japonicum parasite protection hosts, which has the characteristics of simplicity and convenience in preparation, friendly inoculation mode, good immune effect and the like, and is particularly suitable for large-scale immunization of the schistosoma japonicum parasite protection hosts such as cattle, sheep and the like so as to block the propagation of schistosoma japonicum from the source. The invention not only provides powerful scientific and technological support for achieving the goal of eliminating schistosomiasis in Healthy China 2030, but also greatly spans and innovates on the existing oral bacterial carrier technology.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the field of prevention and control of schistosomiasis japonicus and vaccine development technology, and in particular to an oral mRNA vaccine delivery system for the reservoir host of schistosomiasis japonicus. Background Technology

[0002] Schistosomiasis japonicus is a serious zoonotic parasitic disease caused by infection with Schistosoma japonicum. The transmission chain of schistosomiasis is complex, with reservoir hosts (such as livestock like cattle and sheep, as well as wild animals) playing a key role in transmission. Studies have shown that cattle contribute up to 75% to the transmission, while wild animals such as rodents have also become important sources of infection in some areas, making the control of the source of infection extremely difficult.

[0003] Current control measures mainly rely on praziquantel treatment and environmental interventions such as snail eradication. Praziquantel can only treat infected individuals, does not provide immune protection, and carries the potential risk of drug resistance; environmental snail eradication measures are costly and difficult to implement, especially in swampy and hilly areas where drug eradication is ineffective. Therefore, it is necessary to develop a preventive vaccine that can effectively control the key source of infection—the reservoir host.

[0004] In vaccine development, although various candidate antigens (such as glutathione S-transferase SjGST and calreticulin SjCRT) have been studied, traditional vaccines (such as recombinant protein vaccines) generally suffer from problems such as long preparation cycles, high costs, and insufficient immunogenicity. To date, no commercially available schistosomiasis vaccine has been developed. mRNA vaccines are a rapidly developing new vaccine technology in recent years, demonstrating advantages such as rapid development, efficient immune responses, and good safety. Compared with traditional vaccines, mRNA vaccines do not require cell culture, can be rapidly synthesized in cell-free systems, are easy to mass-produce, and can encode multiple antigens, inducing strong humoral and cellular immune responses. Furthermore, through cap1 cap, polyA tail, HA tag state, and N1-methylpseudouracil modification, the stability of mRNA is enhanced, creating conditions for mRNA molecules to enter cells, persist, and exert their effects, thus providing direction for vaccine development.

[0005] However, current oral delivery vectors for mRNA (such as liposomes and polymer nanoparticles) suffer from drawbacks including poor resistance to gastric acid degradation, poor intestinal mucosal penetration, high production costs, and unsuitability for herd immunity in animals. Oral vaccines, on the other hand, offer advantages such as ease of administration, low cost, and ease of large-scale deployment, making them particularly suitable for herd immunity in parasite-carrying hosts such as cattle and sheep. Finding a delivery vector that can effectively protect mRNA and cross the gastrointestinal barrier is crucial for realizing oral mRNA vaccines.

[0006] Bacillus subtilis spores have been well-supported by previous research as a highly promising oral vaccine vector. These bacterial spores exhibit strong environmental resistance, tolerating the highly acidic environment of the stomach and the degradation by intestinal digestive enzymes, ensuring the safe delivery of vaccine components to the intestinal immune site. More importantly, existing literature has confirmed that Bacillus subtilis spores can serve as an effective antigen delivery system. In 2009, the team led by Yu Xinbing in the Department of Parasitology, Zhongshan School of Medicine, Sun Yat-sen University, reported the successful display of Schistosoma japonicum 26 kDa glutathione S-transferase (SjGST) on the surface of Bacillus subtilis spores. Oral immunization of mice successfully induced specific mucosal immune responses (fecal sIgA) and systemic immune responses (serum IgG), demonstrating the feasibility and effectiveness of this vector in stimulating anti-schistosomiasis immune responses. This provides a solid theoretical and experimental foundation for developing Bacillus subtilis spores as an oral mRNA delivery vector.

[0007] However, current technologies are limited to delivering protein antigens using spores. The effective introduction of modified mRNA molecules into spores and their efficient release and expression within host cells remains an unsolved technical challenge. Summary of the Invention The purpose of this invention is to overcome the technical shortcomings of existing schistosomiasis vaccines, such as inconvenient vaccination, high production costs, and difficulty in large-scale application in reservoir hosts, and to provide an oral mRNA vaccine delivery system for reservoir hosts of Schistosomiasis japonicus.

[0008] The first objective of this invention is to provide an mRNA vaccine against the reservoir host of schistosomiasis japonicus.

[0009] A second object of the present invention is to provide a method for preparing any of the mRNA vaccines described herein.

[0010] A third objective of this invention is to provide the mRNA vaccine described herein or any of the mRNA vaccines prepared by the described method for use in preparing an mRNA vaccine against the reservoir host of schistosomiasis japonicus.

[0011] To achieve the above objectives, the present invention is implemented through the following technical solution: This invention integrates multi-antigen mRNA design, electroporation, and an oral delivery system for Bacillus subtilis spores. Figure 1(Diagram of vaccine delivery system) Establish a stable, efficient, and suitable oral mRNA vaccine delivery system for parasite-carrying hosts, including: Bacillus subtilis spores; mRNA antigen components: the mRNA antigen components encode multi-stage specific antigens of Schistosoma japonicum cercariae, juvenile worms, adults, and eggs (e.g., SjGST, Sj23); the mRNA antigen components are introduced into the Bacillus subtilis spores by electroporation; the Bacillus subtilis spores are made into freeze-dried powder and mixed with feed additives to form an oral vaccine that can be directly administered.

[0012] Therefore, this invention claims protection for an mRNA vaccine against a reservoir host of schistosomiasis japonicus, said vaccine containing immunogenic mRNA that, after transformation of Bacillus subtilis, induces the formation of spores.

[0013] Preferably, the immunogenic mRNA encodes heterologous antigens of the cercariae, juveniles, adults, or eggs of Schistosoma japonicum (e.g., SjGST, Sj23).

[0014] Preferably, the spores are freeze-dried and then mixed with the insect-preserving host feed.

[0015] Preferably, the immunogenic mRNA consists of a 5' UTR, a coding mRNA, a 3' UTR, and a poly(A) tail from the 5' end to the 3' end.

[0016] Preferably, the immunogenic mRNA also has a 5'-Cap at its 5' end.

[0017] Preferably, the immunogenic mRNA also has N1-methylpseuuridine modification.

[0018] 5'-Cap, poly(A) tail, and N1-methylpseuuridine modifications make mRNA more stable.

[0019] As one specific embodiment, the nucleotide sequence encoding the mRNA is shown in SEQ ID NO:1.

[0020] SEQ ID NO:1:

[0021] As a specific embodiment, the nucleotide sequence of the 5'UTR is shown in SEQ ID NO:2.

[0022] SEQ ID NO: 2: GCUAGCAUUCUUCUGGUCCCCACAGACUCAGAGAGAACCC.

[0023] As one specific embodiment, the nucleotide sequence of the 3'UTR is shown in SEQ ID NO:3.

[0024] SEQ ID NO: 3: UAGGCUGGAGCCUCGGUGGCCAUGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCCCUCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGCACGUCUCUUAACUAACUAA.

[0025] As one specific embodiment, the nucleotide sequence of the immunogenic mRNA is shown in SEQ ID NO:4.

[0026] This invention also claims protection for a method for preparing the mRNA vaccine, comprising the following steps: Construct recombinant vectors for transcribing immunogenic mRNA; The recombinant vector was used for in vitro transcription to obtain immunogenic mRNA; Immunogenic mRNA was transformed into Bacillus subtilis to obtain Bacillus subtilis transformed with immunogenic mRNA; Inducing the transformation of Bacillus subtilis with immunogenic mRNA to produce spores; Collect spores and freeze-dry them to obtain spore freeze-dried powder, which is the mRNA vaccine.

[0027] In one specific embodiment, the Bacillus subtilis is Bacillus subtilis WB600.

[0028] Preferably, the preparation method further includes the step of mixing the spore freeze-dried powder with the insect-preserving host feed.

[0029] Preferably, the in vitro transcription is performed using T7 RNA polymerase.

[0030] Preferably, the conversion is an electric shock conversion.

[0031] As a specific implementation method, the electroporation method is as follows: the immunogenic mRNA obtained by transcription is mixed with Bacillus subtilis competent cells, and electroporation is performed with a voltage of 2.5kV, a capacitance of 25μF, a resistance of 200Ω, and an electroporation time of 4-5ms. After that, LB liquid medium containing sorbitol is added.

[0032] As a specific implementation method, the preparation method of Bacillus subtilis competent cells is as follows: Bacillus subtilis is activated and cultured to OD200. 600 =0.6~0.8, isolate the bacterial cells; resuspend the precipitate with pre-cooled electroporation buffer to obtain competent Bacillus subtilis cells.

[0033] Preferably, DSM medium is used to induce the production of spores from Bacillus subtilis transformed with immunogenic mRNA.

[0034] Preferably, the collection and freeze-drying of spores is carried out at a concentration of 1×10⁻⁶. 10 A CFU / mL spore suspension was mixed with a lyophilization protectant to achieve a skim milk concentration of 10%, a sucrose concentration of 5%, and a mannitol concentration of 2%; after equilibration in an ice bath, lyophilization was carried out.

[0035] More preferably, the freeze-drying parameters are as follows: first, pre-freeze at -40°C for 4 hours, then reduce the vacuum to below 10 Pa, raise the temperature to -10°C and maintain for 6 hours (sublimation drying), and finally raise the temperature to 25°C and maintain for 4 hours (desorption drying); freeze-drying is then complete.

[0036] This invention also claims protection for the mRNA vaccine described herein or any of the mRNA vaccines prepared by the described preparation methods in the preparation of mRNA vaccines against the reservoir host of schistosomiasis japonicus.

[0037] Preferably, the term "insect-carrying host" refers to livestock (such as cattle and sheep) and wild animals (such as wild rats) that play an important role in the transmission of schistosomiasis.

[0038] Compared with the prior art, the present invention has the following beneficial effects: 1. This invention provides an innovative oral mRNA vaccine delivery system that utilizes Bacillus subtilis spores as a natural biological carrier, overcoming the technical obstacles of traditional oral mRNA vaccine delivery.

[0039] 2. This system utilizes the acid-resistant properties of Bacillus subtilis spores to protect mRNA from the gastric environment and leverages its natural targeting properties to achieve targeted delivery from intestinal M cells to Pareto's knot. Subsequently, M cells take up Bacillus subtilis spores and transport them to lamina propria immune cells. Under the acidic environment of the immune cell phagosomes and the action of lysozyme, Bacillus subtilis spores germinate and lyse to release mRNA, thus achieving effective release and expression of mRNA.

[0040] 3. The delivery system of this invention is novel, and for the first time applies electroconversion technology to directly introduce modified mRNA into Bacillus subtilis. This delivery system avoids the complex LNP encapsulation process, is simple to prepare, and has low cost. It is particularly suitable for large-scale oral immunization of parasite-carrying hosts, providing a brand-new technical means for the source control of schistosomiasis.

[0041] 4. This invention is delivered orally, using Bacillus subtilis spores as a live bacterial carrier, which can effectively stimulate the host's mucosal immunity and systemic immunity, and is particularly suitable for stress-free, large-scale immunization of parasite-carrying hosts.

[0042] 5. This invention employs a multivalent antigen design, covering specific antigens (such as SjGST and Sj23) for four key developmental stages: cercariae, juveniles, adults, and eggs. This can stimulate a broad immune response against different life stages of schistosomiasis, achieving multi-stage blocking and significantly improving the broad-spectrum protection and effectiveness of the vaccine.

[0043] 6. The mRNA in this invention is highly efficient and stable. Through a series of modifications such as 5'-Cap, poly(A) tail, HA tag and N1-methylpseudouracil, the stability, translation efficiency and immunogenicity of the mRNA are significantly improved, while the potential risks caused by its own immunogenicity are reduced.

[0044] 7. This invention has a clear target and significant public health implications. The vaccine specifically targets the key link in the transmission of schistosomiasis—the reservoir host—providing a novel technological tool and solution for controlling and ultimately eliminating schistosomiasis at its source.

[0045] The present invention discloses an oral mRNA vaccine targeting the reservoir host of schistosomiasis japonicus, based on a Bacillus subtilis spore delivery system. Figure 2 This is a schematic diagram of the mechanism of action of a vaccine delivery system. It features simple preparation, user-friendly administration methods, and excellent immunization effects, making it particularly suitable for large-scale immunization of reservoir hosts such as cattle and sheep to block the transmission of Schistosoma japonicum at its source. This invention not only provides strong scientific and technological support for achieving the goal of eliminating schistosomiasis in "Healthy China 2030," but also represents a significant leap forward and innovation in existing oral bacterial vector technology. Attached Figure Description

[0046] Figure 1 This is a schematic diagram of a vaccine delivery system, with markings and corresponding steps: ① Construct a recombinant expression vector to produce mRNA using in vitro transcription technology; ② Introduce the mRNA sequence into competent Bacillus subtilis via electroporation; ③ Induce Bacillus subtilis spores and prepare lyophilized powder; ④ Mix the lyophilized powder with feed additives to form an oral vaccine; ⑤ The host of Schistosomiasis japonicus is immunized by consuming the oral vaccine.

[0047] Figure 2 This diagram illustrates the mechanism of action of a vaccine delivery system, with the markings and corresponding steps shown. ① Bacillus subtilis spores are taken up by M cells in the intestinal Pareto knot and transported into the intestinal lamina propria; ② Immune cells in the intestinal lamina propria recognize and phagocytose the spores; ③ The spores lyse within the immune cells; ④ The mRNA sequence within the spores is released; ⑤ The mRNA is translated into corresponding antigens within the immune cells and presented on the cell surface.

[0048] Figure 3 This is an in vitro transcription electrophoresis diagram of Sj23 antigen mRNA. Detailed Implementation

[0049] To make the objectives, technical solutions, and advantages of this application clearer, the following detailed description is provided in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the scope of this application. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods; the materials and reagents used, unless otherwise specified, are commercially available.

[0050] Example 1: Preparation of Schistosoma japonicum Sj23 antigen mRNA (1) Antigen sequence optimization and PCR amplification The conserved functional domains of the Sj23 gene from Schistosoma japonicum were optimized: the nucleotide sequence corresponding to amino acids 18-125 of Sj23 (membrane-binding domain) was selected, and the coding sequence of the HA tag (TATCCTTATGACGTGCCTGACTACGCC) was tandemly connected to the 3' end of this sequence to form a fusion fragment of "antigen coding sequence - HA tag coding sequence". The optimized complete nucleotide sequence is shown in SEQ ID NO:1 (which is recorded as RNA in the sequence listing file, and is the sequence in the sequence listing when representing DNA). The optimized DNA fragment was then synthesized by a commissioned team.

[0051] SEQ ID NO:1: .

[0052] Specific primers were designed to optimize the sequence. An EcoRI restriction site was introduced at the 5' end of the upstream primer, and an XhoI restriction site was introduced at the 3' end of the downstream primer. The primer sequences are as follows: Sj23 upstream primer: 5'-CGGAATTCATGAAGAAGAAGAAGAAG-3'; Sj23 downstream primer: 5'-CCGCTCGAGTTAGTGGTGGTGGTGGTG-3'.

[0053] PCR amplification was performed using the synthesized DNA fragment as a template. The reaction system (50 μL) consisted of: 25 μL of 2× high-fidelity DNA polymerase premix, 2 μL each of forward and reverse primers (10 μM), 1 μL of template DNA, and 20 μL of enzyme-free water. The reaction conditions were: 98℃ pre-denaturation for 3 min, 98℃ denaturation for 10 s, 58℃ annealing for 30 s, 72℃ extension for 50 s, for a total of 35 cycles, and a final extension at 72℃ for 5 min.

[0054] Take 5 μL of PCR product and perform 1.5% agarose gel electrophoresis (120V, 30min). The target fragment is recovered from the gel and the concentration is detected to be ≥50ng / μL. Sequencing confirms that there are no mutations in the sequence.

[0055] (2) Construction of recombinant transcription vector The commercially available pUC57-T7 vector containing the T7 promoter, 5'UTR (nucleotide sequence as shown in SEQ ID NO:2), 3'UTR (nucleotide sequence as shown in SEQ ID NO:3), and 100 PolyA tails was digested with EcoRI / XhoI (37℃, 3h) along with the recovered Sj23 fragment. The digestion products were then recovered by gel electrophoresis.

[0056] SEQ ID NO:2: GCTAGCATTCTTCTGGTCCCCACAGACTCAGAGAGAACCC; SEQ ID NO: 3: TAGGCTGGAGCCTCGGTGGCCATGCTTCTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAAAGTCTGAGTGGGCGGCACGTCTCTTAACTAACTAA.

[0057] SEQ ID NO:2 and SEQ ID NO:3 are recorded as RNA in the sequence listing file, and when represented as DNA, they are the sequences in the sequence listing.

[0058] The fragment was ligated to the vector using T4 DNA ligase (16°C, overnight). The ligation product was transformed into *E. coli* DH5α competent cells, plated on LB agar containing ampicillin, and incubated at 37°C for 12–16 h. Single colonies were picked and cultured, and the plasmid was extracted, then subjected to double enzyme digestion and sequencing verification to obtain the recombinant plasmid pUC57-T7-Sj23.

[0059] (3) mRNA in vitro transcription and purification The recombinant plasmid pUC57-T7-Sj23 was linearized by single enzyme digestion with XhoI (37℃, 4h). After confirming complete linearization, the template was purified and the concentration was adjusted to 1μg / μL. mRNA was synthesized using an in vitro transcription kit. The reaction system (20μL) consisted of: 2μL 10× reaction buffer, 1.5μL 2× NTP / Ribo-Cap1 Mix (containing m7G cap analogue), 2μL T7 RNA polymerase, 2μL linearized template, 2μL magnesium acetate (52mM), and enzyme-free water to a final volume of 20μL. The mixture was incubated at 37℃ for 2h. DNase I was then added (37℃, 15min) to remove residual DNA.

[0060] The transcript was purified using an RNA purification kit. 2 μL of the purified product was subjected to 1.2% agarose gel electrophoresis (80V, 40 min). The integrity of the bands was observed. The results are as follows: Figure 3 As shown (lane M: molecular marker; lanes 1-6: purified transcription product). The A260 / A280 ratio was detected to be 1.8–2.1. The concentration was adjusted to 1 μg / μL, and the antigen mRNA (nucleotide sequence as shown in SEQ ID NO:4) was successfully prepared and stored at -80℃ for later use.

[0061] SEQ ID NO:4 (To meet the format requirements in the sequence listing file, U is replaced with T in the sequence listing file)

[0062] Example 2: mRNA is electroporated into Bacillus subtilis to form spores. I. Experimental Methods (1) Preparation of competent Bacillus subtilis cells Single colonies of Bacillus subtilis WB600 were picked and inoculated into 5 mL of LB liquid medium, and cultured at 37°C with shaking at 200 rpm for 12 h. 1 mL of the bacterial culture was then transferred to 100 mL of LB liquid medium (containing 0.5 M sorbitol to improve competent cell efficiency) and cultured at 37°C with shaking at 200 rpm until OD200. 600 =0.6~0.8; Centrifuge at 4℃, 6000×g for 10 min, discard the supernatant; Resuspend the precipitate in pre-cooled electroporation buffer (0.5M sorbitol + 0.5M mannitol + 10% glycerol), wash 3 times; Finally, resuspend in 1mL of electroporation buffer, aliquot into 100μL / tube, and store at -80℃ for later use (ideally, competent cell efficiency ≥1×10⁻⁶). 6 CFU / μg DNA).

[0063] (2) mRNA is electroporated into Bacillus subtilis Take 100 μL of competent Bacillus subtilis cells, thaw them in an ice bath, add 2 μg of Sj23 mRNA prepared in Example 1, mix gently, and incubate in an ice bath for 30 min; transfer the mixture to a pre-cooled 0.2 cm electroporation cuvette, and set the electroporation parameters as follows: voltage 2.5 kV, capacitance 25 μF, resistance 200 Ω, and electroporation time 4–5 ms; immediately after electroporation, add 1 mL of LB liquid medium (containing 0.5 M sorbitol), and incubate at 37 °C and 200 rpm for 1 h with shaking to restore cell activity.

[0064] Spread 100 μL of the revived bacterial culture onto LB solid medium (containing 10 μg / mL spectinomycin for screening positive bacteria) and incubate at 37°C for 12–16 h. Pick a single colony and inoculate it into 5 mL of LB liquid medium (containing 10 μg / mL spectinomycin), incubate at 37°C and 200 rpm for 8 h, extract total RNA from the cells, and perform reverse transcription followed by PCR detection of Sj23-HA mRNA (primers same as in Example 1) to confirm successful mRNA transfer and no degradation. Adjust the positive bacteria concentration to 10⁻⁶ using a plate count method. 10 CFU / mL, store at 4℃.

[0065] (3) Inducing Bacillus subtilis to form spores Take the Bacillus subtilis culture (concentration 10) that was verified as mRNA positive by PCR in step (2).10 CFU / mL), inoculated at a volume ratio of 1:100 into spore-specific induction medium (DSM medium) (medium composition: tryptone 5g / L, yeast extract 3g / L, MgSO4). 7H2O 0.2g / L, MnSO4 The mixture was prepared by autoclaving at 121°C for 20 minutes with 0.005 g / L H2O and 1 g / L K2HPO4, pH adjusted to 7.2, and then placed in a shaker at 37°C and 200 rpm for incubation.

[0066] After 12 hours of cultivation, samples were taken every 4 hours. Gram staining combined with an optical microscope (1000× oil immersion) was used to observe spore formation. Simultaneously, the total viable cell count and spore count were determined using the plate count method (the bacterial solution was treated at 80℃ for 10 minutes to kill vegetative cells, then spread onto LB plates for spore counting). A spore formation rate (spore count / total viable cell count) ≥95% was observed under the microscope, and the plate count showed a stable spore concentration of 8×10⁻⁶. 9 ~1×10 10 When the concentration of CFU / mL reaches a certain level, the culture should be terminated.

[0067] Centrifuge the cultured bacterial solution at 4℃ and 8000×g for 15 min, discarding the supernatant; resuspend the precipitate in pre-cooled 0.85% sterile physiological saline, and repeat centrifugation and washing three times to remove residual culture medium and vegetative cells; finally, adjust the spore concentration to 1×10⁻⁶ with sterile physiological saline. 10 CFU / mL was used to obtain a spore suspension for later use (it can be stored at 4℃ for a short period of time or at -80℃ for a long period of time).

[0068] Example 3: Preparation of an oral mRNA vaccine against this schistosomiasis Take the spore suspension obtained in Example 2, add the freeze-drying protectant (mass concentration: 10% skim milk + 5% sucrose + 2% mannitol, all of which are food grade), mix gently (avoid vigorous shaking to avoid damaging the spore structure), and place in an ice bath to equilibrate for 30 minutes to obtain the equilibrated spore-protectant mixture.

[0069] Dispense the equilibrated spore-protectant mixture into 5mL sterile lyophilized vials (2mL per vial, containing 2×10⁶ spores). 10 CFU), and placed in a freeze dryer (such as the LGJ-10 model of a certain brand); set the freeze drying parameters: first pre-freeze at -40℃ for 4 hours, then reduce the vacuum degree to below 10Pa, raise the temperature to -10℃ and maintain for 6 hours (sublimation drying), and finally raise the temperature to 25℃ and maintain for 4 hours (desorption drying); after freeze drying, spore freeze-dried powder is obtained, and the freeze-dried bottle is vacuum sealed to avoid moisture absorption.

[0070] The freeze-dried spore powder was mixed with a host-specific feed additive (such as a cattle feed additive: 60% corn flour + 20% soybean meal + 15% wheat bran + 5% mineral premix, all conforming to GB / T 14924.1-2020 standard) at a mass ratio of 1:1000. The mixing process used a sterile double-spiral mixer (30 rpm, 15 min) to ensure uniform distribution of the freeze-dried spore powder in the feed, ultimately producing a feed containing 2 × 10⁶ spores per 100g of feed. 7 CFU oral vaccine.

[0071] Random sampling was used to test the quality of the oral vaccine. The indicators included: a) Spore viability: determined by plate counting method, the spore viability after freeze-drying should be ≥85%; b) Bacterial content: spread on LB agar plates (incubated at 37℃ for 24h), the bacterial colony count should be ≤10 CFU / g; c) Moisture content: determined by Karl Fischer method, the moisture content should be ≤3% (to ensure that the spore activity of the oral vaccine does not decrease significantly within 6 months of storage at 4℃).

[0072] Example 4: Immunization of mice with oral mRNA vaccine (1) Animal grouping and immunization program Thirty-six 6-8 week old SPF-grade ICR mice, weighing between 18 and 25 g, were selected. All mice were housed in individual IVC cages with constant temperature and humidity, allowing them to acclimatize to the environment for 3-7 days. The temperature in the housing was maintained at 20-26℃, and the humidity at 40-70%, following a 12-hour light / 12-hour dark circadian rhythm (light from 8 am to 8 pm, darkness from 8 pm to 8 am the next day). Sterile feed and sterilized drinking water were continuously provided throughout the experiment, and the mice had free access to food and water, ensuring that the housing environment met the standards for SPF-grade animal experiments.

[0073] After the acclimatization period, the mice were randomly divided into 4 groups of 9 mice each using a random number table. Each group was individually marked with an ear tag. The immunization regimens for each group are shown in Table 1 (the dosages in the table refer to the effective content of the active ingredient in the vaccine). Table 1:

[0074] Among them, the empty-vectored Bacillus subtilis spore vaccine was prepared according to the methods of Examples 1 to 3, the difference being that the empty pUC57-T7 vector was used for "mRNA in vitro transcription and purification".

[0075] (2) Serum-specific IgG detection Recombinant Sj23 protein was diluted to 1 μg / mL with carbonate coating buffer at pH 9.6 and added to 96-well microplates. Coating was performed overnight at 4°C. The next day, the coating solution was discarded, and the plates were washed three times with PBST buffer. Then, 5% skim milk blocking buffer was added, and the plates were incubated at 37°C for 1 h. After blocking, the blocking buffer was discarded, and mouse serum from each group was initially diluted 1:100 and then serially diluted 2-fold. 100 μL of diluted serum was added to each well and incubated at 37°C for 1 h. After incubation, the plates were washed three times, and HRP-labeled goat anti-mouse IgG secondary antibody (dilution ratio 1:5000) was added. The plates were incubated at 37°C for 1 h. After washing again, TMB chromogenic solution was added, and the plates were incubated in the dark for 15 min. The reaction was terminated with 2 mol / L sulfuric acid, and the OD value at 450 nm was measured using a microplate reader. The geometric mean titer (GMT) of serum IgG in each group was calculated using 2.1 times the OD value of group A (blank control group) as the positive criterion.

[0076] The results showed that 14 days after the third immunization, the serum specific IgG GMT values ​​of groups B, C, and D showed a dose-dependent increasing trend, and the GMT values ​​of all three groups were significantly higher than those of group A (blank control group), with statistical differences satisfying P < 0.05; among them, group D (high-dose vaccine group) had the highest IgG GMT, indicating that the oral mRNA vaccine prepared in Example 3 can effectively induce a systemic humoral immune response.

[0077] (3) Detection methods and evaluation schemes for fecal secretory IgA (sIgA) Fresh fecal samples were collected from mice 14 days after triple immunization. PBS buffer (pH 7.4) containing protease inhibitors was added at a ratio of 1:10, and the samples were homogenized on ice. The homogenate was then centrifuged at 8000 rpm for 15 min at 4°C. The supernatant was used as the sIgA detection sample. Subsequent detection steps were the same as for serum IgG, except that the secondary antibody was replaced with HRP-labeled goat anti-mouse IgA secondary antibody (dilution ratio 1:4000). The GMT value of fecal sIgA was calculated using 2.1 times the OD value of group A as the positive standard.

[0078] The results showed that 14 days after booster immunization, significant fecal sIgA responses were detected in groups B, C, and D, and the GMT value increased with increasing vaccine dose; while no sIgA was detected in group A (blank control group). The results showed that the oral mRNA vaccine prepared in Example 3 could effectively activate the mucosal immune response and provide protection for pathogens to invade the mucosa.

[0079] (4) Methods and evaluation schemes for detecting and evaluating the effectiveness of insect attack protection After all groups of mice completed their triple immunization (boost immunization) on Day 35, a further 21-day interval was added (to ensure the establishment of stable specific immune memory), and each group of mice underwent pathogen challenge treatment: Each mouse was infected with Schistosoma japonicum cercariae via abdominal skin contact, with an infection dose of 40 cercariae per mouse. The health status of the mice was continuously monitored after the infection. 42 days after the infection (to ensure that the pathogen has completed its infection cycle and formed eggs / reproductive cells in the body), all mice were euthanized, and target organs such as the liver and intestines were collected after dissection.

[0080] The following indicators were then statistically analyzed: ① Adult worm count: After dissection, the pathogenic adult worms in the intestines were isolated, and the average number of adult worms in each group of mice was counted. The worm reduction rate was calculated (worm reduction rate = [(average number of adult worms in group A - average number of adult worms in experimental group) / average number of adult worms in group A] × 100%). ② Egg count: Take the same weight of liver tissue from each group of mice, grind it, and count the number of eggs under a microscope. Calculate the egg reduction rate (egg reduction rate = [(average number of eggs in group A - average number of eggs in experimental group) / average number of eggs in group A] × 100%).

[0081] The results showed that the worm reduction rate and egg reduction rate of groups B, C, and D all increased in a dose-dependent manner, and the protective effect of the three groups was significantly better than that of group A (blank control group), with statistical differences satisfying P < 0.05; among them, the worm reduction rate of group D (high-dose vaccine group) reached more than 40%, and the egg reduction rate reached more than 45%, which can effectively reduce the colonization and reproduction of pathogens in the body, proving that the oral mRNA vaccine prepared in Example 3 has a good protective effect against pathogen infection.

[0082] (5) Safety assessment The security assessment includes the following: General observation: During the experiment (Day 0 to Day 98), the mice's mental state, food and water intake, and activity level were observed daily. They were weighed once a week, and weight changes were recorded. Organ pathological examination: After euthanasia, the morphology, color and texture of major organs such as heart, liver, spleen, lungs and kidneys were observed by the naked eye to exclude obvious damage; The above-mentioned organ and tissue samples were fixed in 4% paraformaldehyde, embedded in paraffin, sectioned, stained with hematoxylin and eosin (HE), and then observed under an optical microscope for histopathological changes.

[0083] The results showed that no mice died during the experiment, all mice were in good spirits, ate and drank normally, and their weight steadily increased (with no significant difference from group A). ​​Gross observation showed no abnormalities such as swelling, necrosis, or hemorrhage in the main organs. HE staining sections showed normal tissue cell morphology and no pathological changes such as inflammatory cell infiltration or cell necrosis, proving that the oral mRNA vaccine prepared in Example 3 has good safety and no obvious toxic side effects.

Claims

1. An mRNA vaccine targeting the reservoir host of schistosomiasis japonicus, characterized in that, The vaccine contains immunogenic mRNA that is transformed into Bacillus subtilis and then induced to produce spores.

2. The mRNA vaccine according to claim 1, characterized in that, The immunogenic mRNA encodes heteroantigens of the cercariae, juveniles, adults, or eggs of Schistosoma japonicum.

3. The mRNA vaccine according to claim 1, characterized in that, The spores were freeze-dried and then mixed with the insect-preserving host feed.

4. The mRNA vaccine according to claim 1, characterized in that, The immunogenic mRNA consists of a 5' UTR, a coding mRNA, a 3' UTR, and a poly(A) tail, from the 5' end to the 3' end.

5. The mRNA vaccine according to claim 1, characterized in that, The immunogenic mRNA also has a 5'-Cap at its 5' end.

6. The mRNA vaccine according to claim 1, characterized in that, The immunogenic mRNA is also modified with N1-methylpseuuridine.

7. The method for preparing the mRNA vaccine according to any one of claims 1 to 6, characterized in that, Includes the following steps: Construct recombinant vectors for transcribing immunogenic mRNA; The recombinant vector was used for in vitro transcription to obtain immunogenic mRNA; Immunogenic mRNA was transformed into Bacillus subtilis to obtain Bacillus subtilis transformed with immunogenic mRNA; Inducing the transformation of Bacillus subtilis with immunogenic mRNA to produce spores; Collect spores and freeze-dry them to obtain spore freeze-dried powder, which is the mRNA vaccine.

8. The preparation method according to claim 1, characterized in that, The preparation method further includes the step of mixing the spore freeze-dried powder with the insect-preserving host feed.

9. The preparation method according to claim 1, characterized in that, The in vitro transcription was performed using T7 RNA polymerase.

10. The mRNA vaccine according to claim 1 or the mRNA vaccine prepared by any of the preparation methods according to claims 7 to 9, for the preparation of an mRNA vaccine against the reservoir host of schistosomiasis japonicus.