Treg programmed necrosis type autoimmune disease treatment method

Abstract

The invention provides a method for treating autoimmune diseases mediated by regulatory T cell (Treg) programmed necrosis. Specifically, the invention provides application of an O-linked beta-N-acetylglucosamine glycosylation (O-GlcNAcylation) accelerant, and the O-linked beta-N-acetylglucosamine glycosylation accelerant is used for preparing a medicine or a preparation for treating programmed necrosis type autoimmune diseases. It is found for the first time that when the O-GlcNAcylation promoter is used for improving the O-GlcNAcylation level of RIPK1 / 3 protein, Treg programmed necrosis can be effectively inhibited, and therefore autoimmune diseases are improved.

Description

Technical Field

[0001] This invention relates to the field of biomedicine, and more specifically, to a treatment method for regulatory T cell (Treg) programmed necrosis type autoimmune diseases. Background Technology

[0002] Autoimmune diseases, such as multiple sclerosis, systemic lupus erythematosus, and rheumatoid arthritis, are caused by abnormal disorders of the immune system, leading to damage to the body's own tissues and organ dysfunction. Overactivity of T cells, B cells, or other immune cells derived from hematopoietic stem cells can result in persistent inflammation and damage to target organs.

[0003] The hexosamine biosynthesis pathway (HBP) is one of the intracellular glucose metabolic pathways. The final product of the hexosamine biosynthesis pathway, UDP-GlcNAc, is a substrate modified by O-GlcNAcylation. O-GlcNAcylation of RIPK1 and RIPK3 can prevent the interaction between RIPK1 and RIPK3, thereby inhibiting the subsequent programmed necrosis signaling cascade.

[0004] Programmed necrosis (PCN) is a highly inflammatory form of programmed cell death. The PCN process is initiated when the inflammatory cytokine TNFα binds to its receptor TNFR1, thereby activating RIPK1. RIPK1 activation further activates RIPK3 and triggers the assembly of the RIPK1 / RIPK3 complex (called necrosomes), which subsequently activates MLKL. Once activated, MLKL oligomerizes and translocates to the cell membrane, forming pores that cause membrane rupture, leading to cellular dysfunction and ultimately cell death accompanied by the release of inflammatory cellular contents.

[0005] Regulatory T cells (Tregs) are a subtype of CD4 T cells that play a crucial role in regulating and suppressing inflammatory responses. Patients with various autoimmune diseases often exhibit deficiencies in the number or function of Treg cells.

[0006] Currently, there are no reports on the relationship and potential interactions between HBP, programmed necrosis, Treg, and autoimmune diseases, and there are no treatments for Treg-related programmed necrosis autoimmune diseases. Therefore, there is an urgent need to develop a treatment method for Treg-related programmed necrosis autoimmune diseases. Summary of the Invention

[0007] The purpose of this invention is to provide a treatment method for Treg programmed necrosis type autoimmune diseases.

[0008] In a first aspect of the invention, the use of an O-linked beta-N-acetylglucosaminylation (O-GlcNAcylation) promoter is provided for the preparation of a drug or formulation for the treatment of Treg programmed necrosis type autoimmune diseases.

[0009] In another preferred embodiment, the O-GlcNAcylation promoter is selected from the group consisting of small molecules, antibodies, peptides, oligonucleotides, aptamers, gene editing reagents, or combinations thereof.

[0010] In another preferred embodiment, the O-GlcNAcylation promoter is selected from the group consisting of shRNA, interfering RNA, siRNA, microRNA, or combinations thereof.

[0011] In another preferred embodiment, the O-GlcNAcylation promoter is selected from the group consisting of: OGA (N-acetylglucosamine glycosidase) inhibitors, OGT (N-acetylglucosamine transferase) agonists, OGT expression vectors, O-GlcNAcylation modified donors, or combinations thereof.

[0012] In another preferred embodiment, the O-GlcNAcylation modification promoter is selected from the group consisting of: compounds that downregulate OGA expression, compounds or antibodies that reduce the stability of OGA proteins, compounds or antibodies that downregulate OGA activity, gene editing tools that downregulate or knock out OGA expression, antibodies or aptamers that inhibit OGA activity, oligonucleotides that inhibit OGA expression, compounds that promote OGT activity, OGT enzyme preparations, mRNA for expressing OGT, gene editing tools that promote OGT overexpression, or combinations thereof.

[0013] In another preferred embodiment, the O-GlcNAcylation promoter increases the O-GlcNAcylation level of RIPK1 protein and / or the O-GlcNAcylation level of RIPK3 protein, thereby inhibiting or slowing down Treg programmed necrosis.

[0014] In another preferred embodiment, the substance includes an OGA inhibitor or antagonist.

[0015] In another preferred embodiment, the OGA inhibitor or antagonist is selected from the group consisting of small molecule compounds or pharmaceutically acceptable salts thereof, antibodies, peptides, nucleic acids, or combinations thereof.

[0016] In another preferred embodiment, the OGA inhibitor includes Thiamet-G (TMG) or a pharmaceutically acceptable salt or ester thereof.

[0017] In another preferred embodiment, the Treg programmed necrosis type autoimmune disease is a Treg programmed necrosis-associated autoimmune disease.

[0018] In another preferred embodiment, the Treg programmed necrosis type of autoimmune disease is primarily mediated or caused by Treg programmed necrosis.

[0019] In another preferred embodiment, the autoimmune disease is selected from the group consisting of multiple sclerosis, systemic lupus erythematosus, rheumatoid arthritis, or combinations thereof.

[0020] In another preferred embodiment, the Treg programmed necrosis-type autoimmune disease has one or more features selected from the group consisting of:

[0021] (a) The O-GlcNAcylation level of RIPK1 protein was significantly reduced;

[0022] (b) The O-GlcNAcylation level of RIPK3 protein was significantly reduced;

[0023] (c) The number or level of activated RIPK1 (pRIPK1) protein is significantly increased;

[0024] (d) The number or level of activated RIPK3 (pRIPK3) protein was significantly increased;

[0025] (f) The number or level of activated MLKL (pMLKL) protein was significantly increased;

[0026] (g) Treg cells showed a significantly decreased level of O-GlcNA cylation;

[0027] (h) The proportion of programmed necrosis in Treg cells is significantly increased.

[0028] In another preferred embodiment, the significant decrease or significant increase means that the decrease or increase is statistically significant.

[0029] In another preferred embodiment, for the O-GlcNAcylation level of the protein, "significantly reduced" means that, compared with the corresponding O-GlcNAcylation level C0 in the control (e.g., Treg cells of a healthy individual), the O-acetylglucosamine glycosyl level C1 of the RIPK1 or RIPK3 protein in the subject's Treg cells is statistically significantly reduced, for example, the C1 / C0 ratio is ≤2 / 3, preferably ≤1 / 2, and more preferably ≤1 / 3.

[0030] In another preferred embodiment, for the quantity or level of a protein, "significantly increased" means that, compared with the quantity or level L0 of the corresponding protein (pRIPK1, pRIPK3, or pMLKL) in the Treg cells of the subject, there is a statistically significant increase in the quantity or level L1 of pRIPK1, pRIPK3, or pMLKL, for example, an L1 / L0 ratio ≥1.5, preferably ≥2, and more preferably ≥3.

[0031] In another preferred embodiment, for the O-GlcNAcylation level of cells, "significantly reduced" means that, compared with the O-GlcNAcylation level C0 of the control (e.g., Treg cells of a healthy individual), the O-acetylglucosamine glycosyl level C1 of the subject's Treg cells is statistically significantly reduced, for example, the C1 / C0 ratio is ≤2 / 3, preferably ≤1 / 2, and more preferably ≤1 / 3.

[0032] In another preferred embodiment, for the proportion of Treg cells undergoing programmed necrosis, "significantly increased" means that, compared with the proportion of Treg cells undergoing programmed necrosis R0 in the control (e.g., Treg cells of a healthy individual), the proportion of Treg cells undergoing programmed necrosis R1 in the subject's Treg cells is statistically significantly increased, for example, the R1 / R0 ratio is ≥1.5, preferably ≥2, and more preferably ≥3.

[0033] In a second aspect of the invention, a method for inhibiting Treg cell necrosis in vitro is provided, the method comprising the steps of:

[0034] (a) Treg cells were cultured in the presence of O-GlcNAcylation promoter, thereby inhibiting Treg cell necrosis.

[0035] In another preferred embodiment, the method induces changes in the Treg cells selected from the group consisting of, in the presence of an O-GlcNAcylation promoter:

[0036] (a) Increases the O-GlcNAcylation level of RIPK1 protein;

[0037] (b) Increase the O-GlcNAcylation level of RIPK3 protein;

[0038] (c) Reduce the amount or level of activated RIPK1 (pRIPK1) protein;

[0039] (d) Reduce the number or level of activated RIPK3 (pRIPK3) protein;

[0040] (f) Reduce the number or level of activated MLKL (pMLKL) protein;

[0041] (g) Increase the O-GlcNAcylation level in Treg cells;

[0042] Or a combination thereof.

[0043] In another preferred embodiment, the Treg cell necrosis includes programmed necrosis of Treg cells.

[0044] In another preferred embodiment, the O-GlcNAcylation promoter includes an OGA inhibitor.

[0045] In another preferred embodiment, the OGA inhibitor includes TMG.

[0046] In another preferred embodiment, the in vitro application concentration of the O-GlcNAcylation promoter is 1-30 μM.

[0047] In another preferred embodiment, the in vivo concentration of the O-GlcNAcylation promoter is 10-30 mg / kg.

[0048] In another preferred embodiment, the Treg cells are human Treg cells.

[0049] In a third aspect of the invention, a reagent combination is provided, the reagent combination comprising:

[0050] (Z1) A diagnostic reagent for detecting Treg programmed necrosis; and

[0051] (Z2) A first drug for the treatment of autoimmune diseases, said first drug including O-GlcNAcylation promoter.

[0052] In another preferred embodiment, the detection reagent for detecting Treg programmed necrosis is selected from the group consisting of:

[0053] (Za) A detection reagent for detecting O-GlcNAcylation levels of RIPK1 protein;

[0054] (Zb) is a detection reagent used to detect the O-GlcNAcylation level of RIPK3 protein;

[0055] (Zc) is a detection reagent used to detect the quantity or level of activated RIPK1 (pRIPK1) protein;

[0056] (Zd) is a detection reagent used to detect the quantity or level of activated RIPK3 (pRIPK3) protein;

[0057] (Zf) is a detection reagent used to detect the quantity or level of activated MLKL (pMLKL) protein;

[0058] (Zg) is a detection reagent used to detect the O-GlcNAcylation level in Treg cells;

[0059] (Zh) is a detection reagent used to detect the proportion of programmed necrosis in Treg cells;

[0060] Or a combination thereof.

[0061] In another preferred embodiment, the reagent combination further includes (Z3) a second drug, different from the first drug, for treating autoimmune diseases.

[0062] In a fourth aspect of the invention, a kit is provided, the kit comprising:

[0063] (Z1) A diagnostic reagent for detecting Treg programmed necrosis; and

[0064] (Z2) A first drug for the treatment of autoimmune diseases, said first drug including O-GlcNAcylation promoter.

[0065] In another preferred embodiment, the detection reagent for detecting Treg programmed necrosis is selected from the group consisting of:

[0066] (Za) A detection reagent for detecting O-GlcNAcylation levels of RIPK1 protein;

[0067] (Zb) is a detection reagent used to detect the O-GlcNAcylation level of RIPK3 protein;

[0068] (Zc) is a detection reagent used to detect the quantity or level of activated RIPK1 (pRIPK1) protein;

[0069] (Zd) is a detection reagent used to detect the quantity or level of activated RIPK3 (pRIPK3) protein;

[0070] (Zf) is a detection reagent used to detect the quantity or level of activated MLKL (pMLKL) protein;

[0071] (Zg) is a detection reagent used to detect the O-GlcNAcylation level in Treg cells;

[0072] (Zh) is a detection reagent used to detect the proportion of programmed necrosis in Treg cells;

[0073] Or a combination thereof.

[0074] In another preferred embodiment, the kit further includes (Z3) a second drug, different from the first drug, for treating autoimmune diseases.

[0075] In another preferred embodiment, the drug is a pharmaceutical composition containing an active ingredient and a pharmaceutically acceptable carrier.

[0076] In another preferred embodiment, the pharmaceutical composition comprises:

[0077] (A) O-GlcNAcylation accelerator; and / or

[0078] (B) Pharmaceutically acceptable carriers.

[0079] In another preferred embodiment, the pharmaceutical composition is liquid, solid, or semi-solid.

[0080] In another preferred embodiment, the dosage form of the pharmaceutical composition includes tablets, granules, capsules, oral liquids, or injections.

[0081] In another preferred embodiment, the component (A) accounts for 1-99 wt% of the total weight of the pharmaceutical composition, more preferably 10-90 wt%, and more preferably 30-70 wt%.

[0082] In another preferred embodiment, the composition further includes other drugs for treating autoimmune diseases.

[0083] In another preferred embodiment, the other drugs or therapies for treating autoimmune diseases are selected from the group consisting of chimeric antigen receptor T-cell therapy, nonsteroidal anti-inflammatory drug therapy, immunosuppressant therapy, or combinations thereof.

[0084] In another preferred embodiment, the kit further includes an instruction manual describing the detection method and administration method.

[0085] In a fifth aspect of the invention, the use of the reagent combination described in the third aspect of the invention is provided for preparing a kit for treating Treg programmed necrosis type autoimmune diseases.

[0086] In another preferred embodiment, the kit is the kit described in the fourth aspect of the present invention.

[0087] In a sixth aspect of the invention, a method is provided for screening potential compounds for treating Treg-mediated necrosis-type autoimmune diseases, comprising the steps of:

[0088] (i) In the experimental group, Treg cells were cultured in the presence of the test compound; and in the control group, Treg cells were cultured under the same conditions as the experimental group but in the absence of the test compound.

[0089] (ii) Detect the level of O-GlcNAcylation in the experimental and control groups;

[0090] In this study, if the experimental group meets one or more of the following criteria compared to the control group, it suggests that the test compound is a potential compound for treating Treg-mediated necrotizing autoimmune diseases:

[0091] (a) The O-GlcNAcylation level of RIPK1 protein was significantly increased;

[0092] (b) The O-GlcNAcylation level of RIPK3 protein was significantly increased;

[0093] (c) The number or level of activated RIPK1 (pRIPK1) protein was significantly reduced;

[0094] (d) The number or level of activated RIPK3 (pRIPK3) protein was significantly reduced;

[0095] (f) The number or level of activated MLKL (pMLKL) protein was significantly reduced;

[0096] (g) Treg cells showed a significantly increased level of O-GlcNAcylation.

[0097] In another preferred embodiment, the method further includes:

[0098] (iii) Further test the effects of the potential compounds selected in the previous step on programmed necrosis of Treg cells.

[0099] In another preferred embodiment, in step (iii), the verification is performed by in vivo or in vitro experiments.

[0100] In a seventh aspect of the invention, a method for identifying Treg-mediated programmed necrosis-type autoimmune diseases is provided, comprising the steps of:

[0101] (a) Providing T cells to the subject;

[0102] (b) Detection was performed using a test kit for detecting Treg programmed necrosis;

[0103] (c) Analyze the test data to identify whether the subject has Treg programmed necrosis type autoimmune disease.

[0104] In another preferred embodiment, the T cells may be obtained from the following group: peripheral blood, bone marrow, or cerebrospinal fluid.

[0105] In another preferred embodiment, the method is a non-diagnostic and non-therapeutic method.

[0106] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Attached Figure Description

[0107] Figure 1 The study showed: (a) clinical scores of EAE mice; (b) RIPK1 activation in peripheral immune cells of EAE mice at different time points; (c) RIPK1 activation in cells of WT and D138N mice not immunized with MOG35-55 (myelin antigen); (d) activation of the NF-κB inflammatory pathway, apoptosis, and programmed necrosis pathway in CD4 T cells of EAE mice at different time points; and (e) MOG35-55 immunization-induced EAE in Rag2-KO mice after transplantation of CD4 T cells from D138N, MLKL-KO, and WT mice. Clinical phenotypes of the mice were assessed, MBP staining characterized the degree of spinal cord demyelination, and the activation of microglia and astrocytes characterized neuroinflammation.

[0108] Figure 2 The results showed: (a) CD4 T cell subset typing; (b) expression levels of programmed necrosis-related markers in Treg cells during EAE; (c) staining of programmed necrosis-related markers in Treg cells using imaging flow cytometry; (d) inhibition of the programmed necrosis pathway in Treg cells significantly protected the pathological progression of EAE; (e) knockout of Caspase1 did not provide further protection against EAE; and (f) during EAE development, the expression level of ASC in Treg cells was significantly reduced compared to Tcons cells.

[0109] Figure 3 The results showed that: (a) TNF induced more significant activation of the programmed necrosis pathway in mouse peripheral blood Treg cells; (b) Treg cells and Tcons cells were stained with programmed necrosis markers after TNF treatment by imaging flow cytometry; (c) TNF treatment of cultured Th1 and Treg cells induced more severe cell death in Treg cells, and this cell death could be protected by the RIPK1 kinase inhibitors Nec1 and Gsk-872; (d) the expression of programmed necrosis markers pRIPK1, pRIPK3, and pMLKL in Th1 and Treg cells after TNF treatment was detected by Western blotting; and (e) the inflammatory factor IFNγ induced significant programmed necrosis in Treg cells.

[0110] Figure 4The results showed that: (a) Glut1 expression was decreased in Treg cells compared to Tcons cells; (b) A20 expression did not differ significantly among the cell types; (c) HBP metabolic pathway product levels were significantly downregulated in Treg cells; (d) Total O-GlcNAcylation was significantly decreased in Treg cells; (e) RIPK1 and RIPK3 O-GlcNAcylation levels were significantly decreased in Treg cells compared to Tcons cells; (f) TMG treatment increased total O-GlcNAcylation in Treg cells; (g) TMG treatment significantly increased RIPK1 and RIPK3 O-GlcNAcylation levels in Treg cells; and (h) TMG did not affect Foxp3 expression in Treg cells, and CTV staining analysis of cell proliferation revealed that the inhibitory effect of Treg cells on Tcons cell proliferation was unaffected by TMG.

[0111] Figure 5 The results showed that: (a) TNF treatment significantly reduced the expression levels of TNF-induced programmed necrosis markers in Treg cells in both the PBS and TMG-treated mice; (b) TMG administration significantly reduced TNF-induced cell death in Treg cells; (c) TMG administration reduced the clinical disease severity in EAE mice compared to the PBS-treated group; (d) damage to the spinal cord white matter in mice was improved; (e) TMG administration reduced the expression levels of inflammatory factors in the spinal cord of EAE mice, and significantly improved the activation levels of microglia and astrocytes in the spinal cord; (f) The effects of TMG reduced the expression levels of programmed necrosis markers in Treg cells of EAE mice; (g) TMG administration reduced the Th1 / Treg and Th17 / Treg ratios in EAE mice; (h) TMG administration no longer protected against EAE disease severity after knocking out Treg cells in mice; (i) Knockdown of OGA in Treg cells with lentivirus increased the O-GlcNAcylation levels of RIPK1 and RIPK3 in Treg cells; (j) Knockdown of OGA in Treg cells with lentivirus did not alter the phenotype of Treg cells; (k) OGA knockout Treg cells showed a significant protective effect against EAE disease severity induced by Th1 and Th17 cells compared to shNC Treg cells.

[0112] In each figure, Tcons cells are conventional CD4 T cells, including CD4 T cells that do not express FOXP3 protein; Treg cells are regulatory CD4 T cells, including CD4 T cells that express FOXP3 protein; and D138N mice are mutant mice with inactivated RIPK1 kinase activity. Detailed Implementation

[0113] Through extensive and in-depth research, the inventors have developed, for the first time, a treatment method for Treg-mediated programmed necrosis (CNN) autoimmune diseases. The inventors unexpectedly discovered that, compared to other T cells, Treg cells are more prone to CNN in inflammatory environments. By inhibiting or knocking down acetylglucosaminease (OGA) to increase O-GlcNAcylation levels, the activation of the CNN pathway in Treg cells under inflammatory conditions can be effectively reduced, preventing Treg cell death and subsequent functional impairment, thus benefiting the control and remission of autoimmune diseases. This invention was completed based on this finding.

[0114] the term

[0115] To facilitate understanding of the invention, certain technical and scientific terms are specifically defined below. Unless otherwise expressly defined herein, all other technical and scientific terms used herein have the meanings commonly understood by one of ordinary skill in the art to which this invention pertains. Before describing the invention, it should be understood that the invention is not limited to the specific methods and experimental conditions described, as such methods and conditions can vary. It should also be understood that the terminology used herein is intended only to describe particular embodiments and is not intended to be restrictive; the scope of the invention will be limited only by the appended claims.

[0116] As used herein, when referring to a specific enumerated value, the term “about” means that the value can vary by no more than 1% from the enumerated values. For example, as used herein, the expression “about 100” includes all values ​​between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

[0117] As used herein, the terms “comprising,” “including,” and “containing” are used interchangeably and include not only closed definitions but also semi-closed and open definitions. In other words, the terms include “consisting of” and “substantially consisting of”.

[0118] As used herein, the terms “OGA inhibitor” or “OGA antagonist” are used interchangeably to refer to substances or agents that reduce or decrease the quantity and / or activity of OGA, and representative examples include (but are not limited to): compounds that downregulate OGA expression, compounds or antibodies that reduce the stability of OGA proteins, compounds or antibodies that downregulate OGA activity, gene editing tools that downregulate or knock out OGA expression, antibodies or aptamers that inhibit OGA activity, oligonucleotides that inhibit OGA expression, etc.

[0119] EAE

[0120] Experimental autoimmune encephalomyelitis is an animal model of multiple sclerosis.

[0121] CD4 T cells

[0122] CD4 T cells mainly consist of four subsets: Th1, Th2, Th17, and Treg, each playing a different role in the development of acute exacerbation of immune encephalopathy (EAE). Antigen-activated Th1 and Th17 cells infiltrate the central nervous system, activating microglia and astrocytes by releasing chemokines and inflammatory cytokines, thus promoting the progression of EAE. Meanwhile, Treg cells reduce the severity of the disease and promote recovery by inhibiting the proliferation and effector function of other immune cells.

[0123] Programmed cell death

[0124] Programmed cell death is a cell death process mediated by molecular programs regulated by specific genes within the cell. Currently known forms of programmed cell death include apoptosis, programmed necrosis, and pyroptosis. Apoptosis is primarily caused by the activation of caspase enzymes, which degrade intracellular components, leading to cell death. Programmed necrosis is caused by the activation of MLKL, which disrupts cell membrane integrity, resulting in cell death. Pyroptosis is caused by the activation of Gasdermin protein, which also disrupts cell membrane integrity, leading to cell death.

[0125] RIPK1-RIPK3-MLKL pathway

[0126] When RIPK1 is activated by external stimuli, it further activates RIPK3 and triggers the assembly of the RIPK1 / RIPK3 complex (called necrosomes), which in turn activates MLKL. This signaling pathway is called the RIPK1-RIPK3-MLKL pathway.

[0127] O-GlcNAcylation

[0128] O-linked beta-N-acetylglucosaminylation (O-GlcNAcylation) is a rich and dynamic post-translational modification process. Unlike other modifications, O-GlcNAcylation is catalyzed by a pair of opposing enzymes: O-linked glycosyltransferase (OGT) and OGA. OGT transfers beta-N-acetylglucosamine (O-GlcNAc) to the hydroxyl groups of serine / threonine residues in nucleoplasmic proteins, while OGA removes the modification. This modification utilizes UDP-GlcNAc as a donor substrate and is generated through the hexosylaminoglycoside biosynthesis pathway (HBP), which integrates glucose, amino acid, fatty acid, and nucleotide metabolism.

[0129] O-GlcNAcylation Accelerator

[0130] As used herein, the O-GlcNAcylation promoter of the present invention refers to an O-GlcNAcylation modification promoter, or a pharmaceutically acceptable salt thereof, or an optical isomer thereof, or a racemic mixture thereof, or a solvate thereof. It should be understood that the term also includes mixtures of the above components.

[0131] TMG

[0132] N-acetylglucosamine transferase (OGT) induces O-GlcNAcylation in proteins, a modification that is reversibly removed by N-acetylglucosamine hydrolase (OGA). Thiamet G (TMG) is a potent OGA inhibitor that enhances O-GlcNAcylation both in vitro and in vivo.

[0133] The structural formula of TMG is:

[0134]

[0135] Pharmaceutical Compositions and Administration

[0136] The O-GlcNAcylation promoters of the present invention (such as small molecule compounds and their various crystal forms, pharmaceutically acceptable inorganic or organic salts, hydrates or solvates), and pharmaceutical compositions containing the O-GlcNAcylation promoters of the present invention as the main active ingredient, can be used to treat Treg programmed necrosis type autoimmune diseases.

[0137] The pharmaceutical compositions of the present invention comprise, within a safe and effective range, the compound of the present invention or a pharmacologically acceptable salt thereof, and a pharmacologically acceptable excipient or carrier. "Safe and effective range" refers to an amount of the compound sufficient to significantly improve the condition without causing serious side effects. Typically, the pharmaceutical composition contains 1-2000 mg of the compound of the present invention per dose, more preferably, 10-1000 mg of the compound of the present invention per dose. Preferably, "one dose" is one capsule or tablet.

[0138] "Pharmaceutically acceptable carriers" refers to one or more compatible solid or liquid fillers or gelling substances that are suitable for human use and must have sufficient purity and sufficiently low toxicity. "Compatibility" here means that the components in the composition can be mixed with and with the compounds of the present invention without significantly reducing the efficacy of the compounds. Examples of pharmaceutically acceptable carriers include cellulose and its derivatives (such as sodium carboxymethyl cellulose, sodium ethyl cellulose, cellulose acetate, etc.), gelatin, talc, solid lubricants (such as stearic acid, magnesium stearate), calcium sulfate, vegetable oils (such as soybean oil, sesame oil, peanut oil, olive oil, etc.), polyols (such as propylene glycol, glycerin, mannitol, sorbitol, etc.), emulsifiers (such as... Wetting agents (such as sodium dodecyl sulfate), colorants, flavoring agents, stabilizers, antioxidants, preservatives, pyrogen-free water, etc.

[0139] The pharmaceutical composition is an aerosol, nasal drops, powder, gel, microsphere formulation, liposome formulation, or emulsion.

[0140] In these solid dosage forms, the active compound is mixed with at least one conventional inert excipient (or carrier), such as sodium citrate or dicalcium phosphate, or with the following components: (a) fillers or compatibilizers, such as starch, lactose, sucrose, glucose, mannitol, and silica; (b) binders, such as hydroxymethyl cellulose, alginate, gelatin, polyvinylpyrrolidone, sucrose, and gum arabic; (c) humectants, such as glycerin; (d) disintegrants, such as agar, calcium carbonate, potato starch or cassava starch, alginate, certain complex silicates, and sodium carbonate; (e) slowing agents, such as paraffin; (f) absorption accelerators, such as quaternary ammonium compounds; (g) wetting agents, such as cetyl alcohol and glyceryl monostearate; (h) adsorbents, such as kaolin; and (i) lubricants, such as talc, calcium stearate, magnesium stearate, solid polyethylene glycol, sodium dodecyl sulfate, or mixtures thereof.

[0141] Liquid dosage forms for nasal administration include pharmaceutically acceptable emulsions, solutions, suspensions, or tinctures. In addition to the active compound, liquid dosage forms may contain inert diluents conventionally used in the art, such as water or other solvents, solubilizers and emulsifiers, e.g., ethanol, isopropanol, ethyl carbonate, ethyl acetate, propylene glycol, 1,3-butanediol, dimethylformamide, and oils, particularly cottonseed oil, peanut oil, corn germ oil, olive oil, castor oil, and sesame oil, or mixtures of these substances.

[0142] In addition to these inert diluents, the composition may also contain auxiliaries such as wetting agents, emulsifiers and suspending agents, sweeteners, flavoring agents and fragrances.

[0143] In addition to the active compound, the suspension may contain suspending agents such as ethoxylated isooctadecyl alcohol, polyoxyethylene sorbitol and dehydrated sorbitol esters, microcrystalline cellulose, aluminum methoxide and agar, or mixtures of these substances.

[0144] The compounds of this invention can be administered alone or in combination with other pharmaceutically acceptable compounds.

[0145] The treatment method of the present invention can be used alone or in combination with other treatment methods or drugs.

[0146] When using the pharmaceutical composition, a safe and effective amount of the compound of the present invention is applied to the mammal (such as a human) requiring treatment. The dosage administered is the pharmaceutically considered effective dose. For a person weighing 60 kg, the daily dose is typically 1–2000 mg, preferably 50–1000 mg. Of course, the specific dosage should also take into account factors such as the route of administration and the patient's health condition, which are all within the scope of the skills of a skilled physician.

[0147] The medicine box of the present invention and its application

[0148] The present invention also provides a companion diagnostic kit containing specific diagnostic reagents that can more accurately identify subjects suitable for the treatment regimen of the present invention.

[0149] Based on the present invention, preferred objects suitable for the treatment scheme of the present invention have one or more features selected from the group consisting of:

[0150] (a) The O-GlcNAcylation level of RIPK1 protein was significantly reduced;

[0151] (b) The O-GlcNAcylation level of RIPK3 protein was significantly reduced;

[0152] (c) The number or level of activated RIPK1 (pRIPK1) protein is significantly increased;

[0153] (d) The number or level of activated RIPK3 (pRIPK3) protein was significantly increased;

[0154] (f) The number or level of activated MLKL (pMLKL) protein was significantly increased;

[0155] (g) Treg cells showed a significantly decreased level of O-GlcNA cylation;

[0156] (h) The proportion of programmed necrosis in Treg cells is significantly increased.

[0157] Preferably, in addition to the O-GlcNAcylation promoter of the present invention as an active ingredient, the kit of the present invention also contains a detection reagent for detecting Treg programmed necrosis characteristics.

[0158] Furthermore, the kit of the present invention can further provide evaluation information or data on the therapeutic effect. If, after administration of the O-GlcNAcylation promoter of the present invention, the O-GlcNAcylation level of RIPK1 / 3 protein in the Treg of the corresponding subject increases, the number of activated RIPK1 protein, activated RIPK3 protein, or activated MLKL protein decreases, or the O-GlcNAcylation level of Treg cells increases, or the proportion of programmed necrosis occurring in Treg cells decreases, it suggests that the treatment regimen of the present invention is effective or can be continued.

[0159] Compared with the prior art, the advantages of the present invention are as follows:

[0160] 1. This invention is the first to discover that Treg programmed necrosis is one of the pathogenic factors of autoimmune diseases.

[0161] 2. This invention is the first to discover that increasing the O-GlcNAcylation level of RIPK1 / 3 protein in Tregs can effectively slow down programmed cell death in Tregs, thereby improving autoimmune diseases.

[0162] 3. This invention provides a treatment method for Treg programmed necrosis type autoimmune diseases.

[0163] 4. The present invention also provides a detection reagent for identifying subjects suitable for the treatment regimen of the present invention, thereby enabling more accurate identification of subjects suitable for the treatment regimen of the present invention, namely subjects suffering from Treg programmed necrosis type autoimmune diseases, and achieving more precise treatment.

[0164] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. Unless otherwise stated, percentages and parts are weight percentages and parts by weight.

[0165] Unless otherwise stated, the reagents used in the examples are commercially available.

[0166] Experimental methods

[0167] 1. Flow cytometry

[0168] Single-cell suspensions were obtained from mouse peripheral blood, and erythrocytes were lysed with ACK lysis buffer for flow cytometry analysis. For surface antigen labeling, cells were stained with the specified antibody at 4°C for 30 minutes. For cytoplasmic antigen labeling, cells were fixed with 2% PFA, permeabilized with 0.1% saponin solution, and stained with the specified antibody at room temperature for 1 hour. For nuclear antigen labeling, cells were fixed and permeabilized using the Foxp3 / transcription factor flow cytometry fixation and permeabilization kit (eBioscience, Cat#00-5523-00), and stained with the specified antibody at room temperature for 1 hour. The antibodies used include: CD4 (BioLegend, Cat#100408); CD11b (BioLegend, Cat#101206); CD19 (BioLegend, Cat#115538); CD3 (BioLegend, Cat#100220); CD8 (BioLeg end, Cat#100748); NK1.1 (BioLegend, Cat#156524); Ly-6G (BioLegend, Cat#127608); CD14 (BioLegend, Cat#123316); CXCR3 (BioLegend, Cat#126531 ); CCR4 (BioLegend, Cat#131217); CCR6 (BioLegend, Cat#129819); CD25 (BioLegend, Cat#102005); Phospho-RIP1 (S166) (Biolynx, Cat#BX60008); Ph ospho-RIP3(Thr231 / Ser232)(CST, Cat#91702s); Phospho-MLKL(S345)(CST, Cat#37333S); Phospho-IKKα / β(Ser176 / 180)(CST, Cat#2697s); Cleaved Caspase-3(Asp175) (CST, Cat#9661).

[0169] 2. EAE induction

[0170] Mice were subcutaneously immunized with 300 μL of a 1:1 emulsion of 300 ng MOG35-55 (myelin antigen) (available from Hanhong, Cat#332P2372) emulsion (Sigma, Cat#F5881). Then, on days 0 and 2, each mouse was intravenously injected with 200 ng of pertussis toxin (Abixin, Cat#abs42024900). For adoptive transfer EAE models, donor mice were immunized as described above, but without pertussis toxin. Spleens and draining lymph nodes were harvested 10 days post-immunization.

[0171] Naïve CD4 T cells were isolated using a magnetic bead-based isolation kit. Cells were then cultured in vitro for 5 days with MOG35-55 (20 μg / mL) under either Th1 or Th17 cell polarization conditions. Activated MOG-specific Th1 and Th17 cells were resuspended in PBS, counted, and intravenously injected into Rag2-KO receptor mice. Each mouse received approximately 5 × 10⁶ cells. 6 A mixture of Th1 and Th17 cells was collected. Simultaneously, naïve CD4 T cells were isolated from WT or MLKL-KO mice and cultured in vitro for 5 days under Treg polarization conditions, followed by tail vein injection of approximately 5 × 10⁻⁶ cells. 6 Using individual Tregs as a treatment strategy.

[0172] The EAE clinical score of mice was assessed daily. The EAE score was assessed as follows: 0, no clinical signs; 1, partial tail paralysis; 2, complete tail paralysis; 3, hind limb paralysis and incoordination; 4, paralysis of one hind limb; 5, paralysis of both hind limbs; 6, hind limb paralysis and weakness of the forelimbs; 7, paralysis of both hind limbs and paralysis of one forelimb; 8, paralysis of both hind limbs and forelimbs; 9, dying; 10, dead.

[0173] 3. Immunofluorescence

[0174] Mice were perfused with 5 mL of cold PBS and 10 mL of 4% paraformaldehyde sequentially. The spinal cord was then removed and fixed with 4% paraformaldehyde at 4°C for 24 hours. After washing twice with PBS, the spinal cord was dehydrated sequentially with 10% and 30% sucrose solutions. Finally, the spinal cord was embedded in OCT embedding medium on dry ice and frozen sectioned. Sections were blocked with 5% goat serum at room temperature for 2 hours, then incubated with primary antibody overnight at 4°C. The next day, the sections were washed three times with 0.1% Tween-20 and incubated with secondary antibody at room temperature for 2 hours.

[0175] 4. Western blotting

[0176] Protein concentration was determined using a protein assay kit (Beyotime, Cat#P0009). 10–50 μg of the prepared protein sample was electrophoresed onto an 8% polyacrylamide gel and transferred to a nitrocellulose membrane. The membrane was blocked with 5% milk powder for 1 hour at room temperature and incubated overnight at 4°C with a suitable primary antibody. The next day, the membrane was washed three times with TBS-T for 10 min each time and incubated for 1 hour at room temperature with a specific secondary antibody (1:1000). The secondary antibody was then washed with TBS-T, and the membrane was developed using chemiluminescence.

[0177] 5. LDH Experiment

[0178] Lactate dehydrogenase (LDH) release is an important indicator of cell membrane integrity. Cell death was characterized by detecting cytotoxicity after TNF treatment using a lactate dehydrogenase cytotoxicity assay kit (Beyotime). 30 μl of cell supernatant was collected under different conditions, and the samples were processed according to the kit instructions. Absorbance was measured at 490 nm. Nec-1s is an inhibitor of RIPK1 kinase activity, and Gsk-872 is an inhibitor of RIPK3 kinase activity.

[0179] 6. Adjacency Connection Technology

[0180] After fixation and permeabilization, cell samples were incubated overnight at 4°C with two primary antibodies from different species (RIPK1 or RIPK3 for rabbits, and O-GlcNAc for mice). The next day, a pair of oligonucleotide-labeled secondary antibodies (PLA probe / ortho-probe) were added at 37°C to bind the primary antibody. Then, ligated oligonucleotides were added. When the ortho-probe pair was sufficiently close, the ligating oligonucleotide hybridized complementaryly with the ortho-probe pair, forming a closed circular DNA sequence under the action of ligase, serving as a template for rolling circle amplification. Next, DNA polymerase was added, using the PLA probe as a primer and the aforementioned circular DNA as a template, to synthesize a cascaded sequence via the RCA reaction. Finally, the ortho-ligation signal was quantitatively analyzed using fluorescence microscopy.

[0181] 7. Lentiviral Construction

[0182] A plasmid carrying OGA shRNA (SEQ ID NO1: GAGTAACTAACCAATCCAAATT) was constructed and co-transfected into 293T cells with the packaging plasmids PSPAX2 and PMD2G using the transfection reagent PEI. After 6 hours, the medium was replaced with fresh DMEM. After 48 hours, the medium containing the virus was collected and filtered through a 0.22 μm filter membrane to obtain lentivirus carrying mouse OGA shRNA. The collected viral supernatant was stored at -80℃.

[0183] Example 1. The pathology of EAE exacerbated by programmed necrosis of CD4 T cells.

[0184] In this embodiment, the correlation between autoimmune diseases and T cells was studied, taking EAE as an example.

[0185] Using wild-type mice (WT) and mutant mice with inactivated RIPK1 kinase activity (D138N) as controls, flow cytometry was used to analyze the marker of RIPK1 activation (phospho-S166 RIPK1 (pRIPK1)) in peripheral blood immune cells of EAE mice before the onset of disease, at the peak of disease, and during the recovery period. The three time points corresponded to days 7, 14, and 21 after MOG35-55 immunization. Figure 1 a).

[0186] The results showed that in the MOG35-55-induced EAE group, compared with other leukocytes, CD4 T cells showed significantly higher pRIPK1 expression levels at all stages of the EAE pathological process. Figure 1 b). In mice that were not immunized with MOG35-55, RIPK1 activation was absent in CD4T cells. Figure 1 c).

[0187] RIPK1 activation can activate the NF-κB signaling pathway to promote the transcription of inflammatory factors, and can also induce apoptosis and programmed necrosis. To investigate the downstream signaling of RIPK1 activation in CD4 T cells during EAE pathogenesis, the expression levels of phospho-IKK (S176 / S180, pIKK), cleaved-Caspase 3 (cCasp3), phospho-RIPK3 (T231, pRIPK3), and phospho-MLKL (S345, pMLKL) proteins were quantified by flow cytometry. pIKK, cCasp3, and pRIPK3 / pMLKL are biomarkers for NF-κB inflammatory pathway activation, apoptosis, and programmed necrosis pathways, respectively.

[0188] The results showed that the expression levels of pRIPK3 and pMLKL in CD4 T cells significantly increased during EAE development, while the expression levels of pIKK and cCasp3 did not show any increase. Figure 1 d). This indicates that CD4 T cells are more prone to programmed necrosis during the pathological progression of EAE.

[0189] CD4 T cells were isolated from the spleens of D138N, MLKL-KO (MLKL-KO transgenic mice), and WT mice and injected into T cell-deficient Rag2-KO mice. An EAE model was then constructed in Rag2-KO mice using the MOG35-55 peptide. Clinical phenotype scores, MBP staining, and microglial activation (IBA-1 staining) and astrocyte activation (GFAP staining) were statistically analyzed.

[0190] The results showed that when RIPK1 kinase activity was absent in CD4 T cells or MLKL was knocked out, the severity of disease in EAE mice was significantly reduced. Figure 1 e) indicates that programmed necrosis of CD4 T cells is an important factor that exacerbates the severity of EAE.

[0191] In summary, on the one hand, RIPK1 is phosphorylated during the pathogenesis of EAE, leading to an increase in pRIPK1. The expression levels of pRIPK3 and pMLKL also increase. On the other hand, inhibition of RIPK1 activity or downregulation of MLKL significantly reduces the severity of EAE. These results suggest that programmed necrosis of CD4 T cells is one of the main pathogenic factors of autoimmune diseases such as EAE.

[0192] Example 2. Treg cell programmed necrosis promotes EAE pathological development.

[0193] In this embodiment, it is further determined which CD4 T cell subsets are prone to programmed necrosis during EAE progression.

[0194] Peripheral blood lymphocytes were extracted from D138N-EAE and WT-EAE mice, and different subsets were distinguished by cell surface markers. Figure 2 a) and detect markers related to programmed necrosis.

[0195] The results showed that during EAE progression, Treg cells exhibited significantly higher expression levels of programmed necrosis-related markers (such as pRIPK1, pRIPK3, and pMLKL) compared to Th1, Th2, and Th17 subsets. Figure 2 b). This suggests that Treg cells are more prone to programmed necrosis than other types of CD4 T cells during EAE.

[0196] To further validate this, we used imaging flow cytometry to analyze the programmed necrosis markers pRIPK1 and pMLKL in EAE mouse Treg cells and conventional CD4 T cells (Tcons cells).

[0197] like Figure 2As shown in c, the results further confirm that Treg cells are more prone to programmed necrosis than other types of CD4 T cells (Tcons cells) during EAE. Figure 2 c).

[0198] These results suggest that programmed necrosis of Treg cells is a major pathogenic factor in autoimmune diseases such as EAE. This type of autoimmune disease characterized by programmed necrosis of Treg cells is defined as Treg-mediated programmed necrosis autoimmune disease. Typically, compared to the control group, Treg cells show a significant increase in pRIPK1, pRIPK3, and pMLKL.

[0199] Example 3. Inhibiting Treg cell programmed necrosis to alleviate EAE process

[0200] Given that Treg cells exhibit susceptibility to programmed necrosis in EAE, this embodiment evaluates the potential impact of inhibiting Treg cell programmed necrosis on the pathological process of EAE.

[0201] Initial CD4 T cells derived from EAE mice were differentiated into Th1 and Th17 cells in vitro, and these antigen-activated Th1 and Th17 cells were transplanted into Rag2-KO mice to construct an adoptive transfer EAE model. Simultaneously, equal amounts of WT Treg cells or MLKL-KO Treg cells (derived from MLKL-KO transgenic mice) were injected into the aforementioned Rag2-KO mice, and clinical scores, MBP staining, IBA-1 staining, and GFAP staining were recorded.

[0202] The results showed that both WT Treg cell injection and MLKL-KO Treg cell injection significantly reduced EAE clinical scores induced by Th1 and Th17 cells, and MLKL-KO Treg cells had a greater effect on improving EAE symptoms. Figure 2 d) indicates that inhibiting programmed necrosis of Treg cells helps improve the pathological development of EAE.

[0203] To rule out the possibility that other types of cell death in Treg cells (such as pyroptosis) could also have a negative impact on the pathological development of EAE, equal amounts of WT or Caspase1-KO Treg cells were injected into the Rag2-KO mice mentioned above.

[0204] The results showed that injection of WT or Caspase1-KO Treg cells reduced the severity of EAE to the same extent. Figure 2e) indicates that knocking out Caspase1 to inhibit pyroptosis in Treg cells has no further protective effect against EAE. Furthermore, the expression of the key pyroptosis pathway protein ASC was not detected in Treg cells of EAE mice. Figure 2 f) indicates that the pathological development of EAE is not related to pyroptosis of Tregs.

[0205] Example 4. The effect of inflammatory factors induces programmed necrosis of Treg cells

[0206] TNF-TNFR1 is the most widely studied pathway for activating RIPK1 and triggering programmed necrosis signaling, and TNF and other inflammatory factors are also important mediators in the pathogenesis of acute exacerbation necrosis (EAE). In this study, we investigated whether Treg cells still exhibit susceptibility to programmed necrosis under the influence of inflammatory factors.

[0207] First, TNF was intravenously injected into mice in vivo, and peripheral blood immune cells were collected from mice for flow cytometry analysis after a period of time. Figure 3 a) and simultaneously, these signals were characterized by staining using imaging flow cytometry. Figure 3 b).

[0208] The results showed that, compared with other CD4 T cell subsets, Treg cells exhibited increased expression levels of programmed necrosis markers (e.g., pRIPK1, pRIPK3, and pMLKL) after TNF injection.

[0209] Next, in vitro experiments were used to verify the sensitivity of Treg cells to programmed cell death after TNF stimulation. Lactate dehydrogenase (LDH) cytotoxicity assays showed that Treg cells cultured in vitro with polarization were more prone to cell death under TNF stimulation compared to Th1 cells. Figure 3 c), and this cell death can be protected by inhibitors of RIPK1 and RIPK3 kinases. Figure 3 c), and the expression of the programmed necrosis markers pRIPK1, pRIPK3, and pMLKL in TNF-treated Treg cells was verified by Western blotting. Figure 3 d).

[0210] The results showed that Treg cells were more prone to programmed necrosis under TNF stimulation than other subsets.

[0211] Furthermore, stimulation of Treg cells with IFNγ revealed that intravenous injection of IFNγ also induced more significant programmed necrosis in Treg cells. Figure 3 e).

[0212] All of the above indicate that Treg cells are prone to programmed cell death under the influence of inflammatory factors.

[0213] Example 5. Treg cell programmed necrosis is associated with O-GlcNA cytosis of RIPK1 and RIPK3.

[0214] Compared to other CD4 T cell subsets, Treg cells showed significantly lower expression levels of Glut1 (a key glucose transporter in T cells) in both peripherally and in vitro induced polarized Treg cells. Figure 4 a).

[0215] Next, we investigated whether glucose metabolism plays a role in the susceptibility of Treg cells to programmed necrosis. Hypothesizing that Treg cells might downregulate A20 expression, making them more susceptible to programmed necrosis, we examined the A20 expression levels in Treg cells and other CD4 T cell subsets.

[0216] The results showed that the expression level of A20 in Treg cells was actually comparable to that in other CD4 T cell subsets. Figure 4 b) indicates that programmed necrosis of Treg cells is not related to A20.

[0217] In addition to glycolysis, glucose can also be metabolized downstream via the hexosamine biosynthesis pathway (HBP). Subsequently, the expression levels of proteins related to the HBP pathway were examined.

[0218] The results showed that the products of the HBP metabolic pathway were significantly downregulated in Treg cells, including UDP-GlcNAc, a substrate for O-GlcNAcylation. Figure 4 c), consistent with the decrease in HBP metabolic activity, the level of O-GlcNAcylation in Treg cells was weakened ( Figure 4 d) indicates that O-GlcNAcylation is associated with programmed necrosis of Treg cells.

[0219] Next, we investigated the O-GlcNAcylation levels of RIPK1 and RIPK3 in Treg cells.

[0220] Experimental results showed that, compared with other CD4 T cell subsets, the O-GlcNAcylation levels of RIPK1 and RIPK3 in Treg cells were significantly reduced. Figure 4 e). TMG treatment can effectively increase O-GlcNAcylation in Treg cells (e). Figure 4 f). Furthermore, after TMG treatment, the O-GlcNAcylation levels of RIPK1 and RIPK3 in Treg cells significantly increased (f). Figure 4g). The effect of TMG does not affect the expression of Foxp3 in Treg cells, nor the inhibitory effect of Treg cells on the proliferation of Tcons cells. Figure 4 h).

[0221] The above indicates that inhibiting OGA can effectively restore the O-GlcNAcylation levels of RIPK1 and RIPK3 in Treg cells without affecting their proliferation and inhibitory abilities.

[0222] Example 6. Inhibition of OGA can alleviate Treg programmed necrosis, thereby affecting the pathological process of EAE.

[0223] 6.1 In vitro TMG treatment inhibits Treg death.

[0224] Differentiated Treg cells were treated with 10 μM TMG for 12 h, followed by stimulation with 100 ng / ml TNF. Lactate dehydrogenase (LDH) release was measured in the TMG-treated group (TNF+TMG) and the control group (TNF) at 6 h, 10 h, and 24 h after TNF treatment. The results showed that the Treg cells in the TMG-treated group experienced significantly less cell death under TNF stimulation than the control group. Figure 5 b).

[0225] 6.2 In vivo TMG administration to intervene in programmed necrosis of Treg cells and protect against the pathological process of autoimmune diseases

[0226] Mice were intraperitoneally injected with 20 mg / kg TMG daily for 3 consecutive days. Following this, mice were intravenously injected with 100 μL (4 μg) of TNF to activate the TNF-TNFR1 pathway in peripheral immune cells. The experiment showed that after TMG administration induced an increase in O-GlcNAcylation levels in Treg cells, the expression levels of programmed necrosis markers in Treg cells induced by TNF treatment were significantly reduced 0–4 hours later. Figure 5 a).

[0227] The above results indicate that upregulating O-GlcNAcylation by inhibiting OGA activity is an effective intervention method for TNF-induced programmed necrosis of Treg cells.

[0228] In the EAE disease model, treatment with TMG can reduce the severity of disease in mice. Figure 5 c) Maintain the integrity of the myelin sheath. Figure 5 d), and reduce inflammation of the central nervous system ( Figure 5 e). These effects of TMG are associated with a reduction in programmed necrosis of Treg cells and a decrease in the Th1 / Treg and Th17 / Treg ratios. Figure 5f, g). Furthermore, knocking out Treg cells in mice followed by TMG treatment did not protect against EAE disease severity. Figure 5 h).

[0229] The results showed that TMG improved the pathological progression of EAE by upregulating O-GlcNAcylation of RIPK1 and RIPK3 in Treg cells to inhibit programmed necrosis of Treg cells.

[0230] To further investigate the effect of increased O-GlcNAcylation in Treg cells under EAE background on the regulation of programmed necrosis and disease progression in Treg cells, lentiviral vectors carrying OGA shRNA were used to transfect in vitro induced Treg cells to obtain OGA knockdown (KD) Treg cells.

[0231] The results showed that O-GlcNAcylation levels of RIPK1 and RIPK3 were elevated in OGA KD Treg cells. Figure 5 i). The expression levels of IL-17A and IFN-γ in OGA KD Treg cells were similar to those in untransfected Treg cells or Treg cells transfected with CtrlshRNA. Figure 5 j) indicates that OGA KD Treg cells can maintain their repressive phenotype in vitro.

[0232] Using an established mouse model of acute exacerbation of erythrocyte-induced encephalopathy (EAE), the potential impact of OGA KD Treg cells on EAE development was investigated. Compared with shNC Treg cells, OGA KD Treg cells showed a significant protective effect against the severity of EAE induced by Th1 and Th17 cells. Figure 5 k).

[0233] The results showed that inhibiting OGA activity could prevent the loss of Treg cell number and function caused by programmed necrosis in EAE.

[0234] In summary, decreased O-GlcNAcylation levels of RIPK1 and RIPK3 in Treg cells lead to their susceptibility to programmed cell death. Inhibiting OGA can effectively restore O-GlcNAcylation levels of RIPK1 and RIPK3 in Treg cells, thereby reducing cell death of Treg cells under inflammatory stimulation.

[0235] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims.

Claims

1. Use of an O-linked beta-N-acetylglucosamine glycosylation (O-GlcNAcylation) promoting agent, characterized in that, For use in the preparation of a medicament or formulation for treating a Treg pyroptosis autoimmune disease.

2. Use according to claim 1, characterized in that, The O-GlcNAcylation-promoting agent is selected from the group consisting of a compound that downregulates OGA expression, a compound or antibody that decreases OGA protein stability, a compound or antibody that downregulates OGA activity, a gene editing tool that downregulates or knocks out OGA expression, an antibody or aptamer that inhibits OGA activity, an oligonucleotide that inhibits OGA expression, a compound that promotes OGT activity, an OGT enzyme preparation, an mRNA for expressing OGT, a gene editing tool that promotes OGT overexpression, or a combination thereof.

3. Use according to claim 1, characterized in that, The O-GlcNAcylation-promoting agent increases the O-GlcNAcylation level of RIPK1 protein and / or the O-GlcNAcylation level of RIPK3 protein, thereby inhibiting or slowing down Treg pyroptosis.

4. The use according to claim 1, characterized in that, The Treg pyroptosis autoimmune disease is mediated or caused primarily by Treg pyroptosis.

5. The use according to claim 1, characterized in that, The Treg pyroptosis autoimmune disease has one or more characteristics selected from the group consisting of: (a) a significantly decreased O-GlcNAcylation level of RIPK1 protein; (b) a significantly decreased O-GlcNAcylation level of RIPK3 protein; (c) a significantly increased number or level of activated RIPK1 (pRIPK1) protein; (d) a significantly increased number or level of activated RIPK3 (pRIPK3) protein; (f) a significantly increased number or level of activated MLKL (pMLKL) protein; (g) a significantly decreased O-GlcNAcylation level of Treg cells; (h) a significantly increased proportion of Treg cells undergoing pyroptosis.

6. A method of inhibiting necrosis of Treg cells in vitro, characterized in that, The method comprises the step of: (a) culturing Treg cells in the presence of an O-GlcNAcylation-promoting agent, thereby inhibiting Treg cell necrosis.

7. The method of claim 6, wherein, In the presence of the O-GlcNAcylation-promoting agent, the Treg cells undergo a change selected from the group consisting of: (a) an increased O-GlcNAcylation level of RIPK1 protein; (b) an increased O-GlcNAcylation level of RIPK3 protein; (c) a decreased number or level of activated RIPK1 (pRIPK1) protein; (d) a decreased number or level of activated RIPK3 (pRIPK3) protein; (f) a decreased number or level of activated MLKL (pMLKL) protein; (g) an increased O-GlcNAcylation level of Treg cells; or a combination thereof.

8. A reagent combination, characterized in that The reagent combination comprises: (Z1) a detection reagent for detecting Treg pyroptosis; and (Z2) a first medicament for treating an autoimmune disease, the first medicament comprising an O-GlcNAcylation-promoting agent.

9. The agent combination of claim 8, wherein The detection reagent for detecting Treg pyroptosis is selected from the group consisting of: (Za) a detection reagent for detecting the O-GlcNAcylation level of RIPK1 protein; (Zb) a detection reagent for detecting the O-GlcNAcylation level of RIPK3 protein; (Zc) a detection reagent for detecting the amount or level of activated RIPK1 (pRIPK1) protein; (Zd) a detection reagent for detecting the amount or level of activated RIPK3 (pRIPK3) protein; (Zf) a detection reagent for detecting the amount or level of activated MLKL (pMLKL) protein; (Zg) a detection reagent for detecting the O-GlcNAcylation level of Treg cells; (Zh) a detection reagent for detecting the proportion of Treg cells undergoing programmed necrosis; or a combination thereof.

10. A method of screening for potential compounds for treating Treg pyroptosis-type autoimmune diseases, characterized in that, comprising the steps of: (i) culturing Treg cells in the presence of a test compound in an experimental group, and culturing Treg cells in the same conditions as the experimental group but in the absence of the test compound in a control group; (ii) detecting the level of O-GlcNAcylation in the experimental group and the control group; wherein if one or more conditions selected from the following group are met in the experimental group compared to the control group, it is suggested that the test compound is a potential compound for treating Treg programmed necrosis type autoimmune diseases: (a) the O-GlcNAcylation level of RIPK1 protein is significantly increased; (b) the O-GlcNAcylation level of RIPK3 protein is significantly increased; (c) the amount or level of activated RIPK1 (pRIPK1) protein is significantly decreased; (d) the amount or level of activated RIPK3 (pRIPK3) protein is significantly decreased; (f) the amount or level of activated MLKL (pMLKL) protein is significantly decreased; (g) the O-GlcNAcylation level of Treg cells is significantly increased.

Images