Transgenic engineering bacteria for preparing natural sunscreen porphyra-334 and application thereof

By integrating the Gca.mysAB and Gca.mysCD genes of *Saccharomyces cerevisiae* into *Saccharomyces cerevisiae*, efficient preparation of MAAs was achieved, solving the problems of low natural extraction yield and high purification difficulty, and realizing the large-scale production of MAAs.

CN121759331BActive Publication Date: 2026-07-24YUNNAN AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2026-03-02
Publication Date
2026-07-24

AI Technical Summary

Technical Problem

Existing technologies have limited the low yield of natural MAAs, the difficulty of purification, and their dependence on specific UV-B environments, which restricts their large-scale production.

Method used

Using transgenic engineered bacteria, incorporating the Gca.mysAB and Gca.mysCD genes from *Urena spp.*, a natural sunscreen, porphyra-334, was prepared via fermentation with *Saccharomyces cerevisiae*. The Gca.mysAB and Gca.mysCD genes were used to catalyze the production of porphyra-334 from the yeast's endogenous substrate, sedetulose 7-phosphate (S7P).

Benefits of technology

It significantly shortens the production cycle, increases fermentation yield, overcomes the capacity bottleneck of traditional extraction methods, and lays the foundation for the large-scale, low-cost production of MAAs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121759331B_ABST
    Figure CN121759331B_ABST
Patent Text Reader

Abstract

The present application relates to a transgenic engineering bacteria for preparing natural sunscreen agent porphyra-334 and application thereof, and belongs to the technical field of biotechnology.The genome of the transgenic engineering bacteria is integrated with an exogenous stigmatella Gca.mys AB gene and stigmatella Gca.mys CD gene, or the transgenic engineering bacteria contains a recombinant plasmid; the recombinant plasmid contains a stigmatella Gca.mys AB gene and a stigmatella Gca.mys CD gene; the nucleotide sequence of the stigmatella Gca.mys AB gene is shown in SEQ ID NO.1; and the nucleotide sequence of the stigmatella Gca.mys CD gene is shown in SEQ ID NO.2.The transgenic engineering bacteria of the present application can effectively synthesize the natural sunscreen agent porphyra-334, has high synthesis efficiency, and can bring huge economic benefits to the industrialized production of porphyra-334.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a transgenic engineered bacterium used to prepare the natural sunscreen agent porphyra-334 and its application. Background Technology

[0002] Mycosporine-like amino acids (MAAs) are water-soluble ultraviolet-absorbing compounds that absorb specific UV-B radiation in the 280-320 nm range, with cyclohexeneimine or cyclohexene ketone as their basic backbone. MAAs are found in eukaryotic algae and cyanobacteria, including marine, freshwater, and terrestrial species, and nearly 70 structurally different MAAs have been observed.

[0003] Porphyra-334 is a UV-protective compound with a maximum absorption wavelength of 334 nm and a molecular weight of 346 Da. First discovered in the marine red alga *Porphyra tenera*, it is one of the most common macromolecular anhydride (MAAs) found in marine algae. Studies have shown that purified MAAs possess free radical scavenging activity in vitro, indicating its multifunctional role as a sunscreen and antioxidant. As a natural bioactive compound, it holds significant appeal for the cosmeceutical and pharmaceutical industries. While naturally extracted MAAs are commercially available, the low productivity and yield of mixtures of MAAs from natural hosts limit their potential. Therefore, it is necessary to explore alternative and sustainable methods for large-scale production of MAAs.

[0004] To date, MAAs research has primarily utilized in vitro expression by microorganisms for synthesis. Currently, two synthetic pathways for MAAs are generally accepted: the shikimic acid pathway and the pentose phosphate pathway. First, 2-demethyl-4-deoxycodone (DDG) is synthesized using sedoheptulose-7-phosphate (S7P) as a substrate, catalyzed by O-methyltransferase (OMT), to generate 4-DG. Subsequently, ATP-grasp ligase replaces the hydroxyl group at the C3 site of the cyclohexene ring of 4-DG, introducing glycine to form a monosubstituted cyclohexanone-type MAAs—sporphyra-glycine (MG). Next, under the action of a D-Ala-D-Ala ligase homolog, threonine is coupled to the C1 site of MG, ultimately generating a disubstituted cycloheximine-type MAAs—porphyra-334.

[0005] Currently, macroalgae (MAAs) are mainly obtained through extraction from cyanobacteria, eukaryotic algae (such as Gracilaria and Porphyra), and some marine organisms. For example, MAAs such as palythine and porphyra-334 have been identified in Gracilaria, and crude extracts were obtained through an optimized methanol extraction process (extraction temperature 40℃, solid-liquid ratio 1:20 g / mL). However, the content of MAAs in natural hosts is low, and they are mostly mixtures, making purification difficult and extraction costly. Furthermore, MAAs extraction depends on specific species and requires UV-B environmental conditions for synthesis, limiting large-scale production. Therefore, overcoming the shortcomings of existing technologies is a pressing issue in the field of biotechnology. Summary of the Invention

[0006] The purpose of this invention is to overcome the shortcomings of the prior art and provide a transgenic engineered bacterium for preparing the natural sunscreen agent porphyra-334 and its application.

[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0008] The first aspect of the present invention provides a transgenic engineered bacterium for preparing the natural sunscreen agent porphyra-334, wherein the genome of the transgenic engineered bacterium integrates exogenous *Ceratophyllum demersum* Gca.mysAB gene and *Ceratophyllum demersum* Gca.mysCD gene, or the transgenic engineered bacterium contains a recombinant plasmid; wherein the recombinant plasmid contains *Ceratophyllum demersum* Gca.mysAB gene and *Ceratophyllum demersum* Gca.mysCD gene.

[0009] The nucleotide sequence of the *Gca.mysAB* gene from *Gca.mys* is shown in SEQ ID NO.1; the nucleotide sequence of the *Gca.mysCD* gene from *Gca.mys* is shown in SEQ ID NO.2.

[0010] Furthermore, the genetically engineered bacteria is the Saccharomyces cerevisiae strain BY4742.

[0011] A second aspect of the present invention provides the above-described recombinant plasmid.

[0012] Furthermore, the Gca.mysAB and Gca.mysCD genes of *Urechis ceratoides* were homologously recombined with the pESC vector to obtain the pESC-Gca.mysAB-mysCD recombinant plasmid.

[0013] The third aspect of the present invention provides the above-mentioned presence of the Gca.mysAB gene or the Gca.mysCD gene of *Ceratophyllum demersum*.

[0014] The fourth aspect of the present invention provides a protein encoded by the above-mentioned *Ceratophyllum demersum* Gca.mysAB gene or *Ceratophyllum demersum* Gca.mysCD gene, characterized in that the amino acid sequence of the protein encoded by the *Ceratophyllum demersum* Gca.mysAB gene is as shown in SEQ ID NO.3; and the amino acid sequence of the protein encoded by the *Ceratophyllum demersum* Gca.mysCD gene is as shown in SEQ ID NO.4.

[0015] The fifth aspect of this invention provides the application of the above-mentioned Gca.mysAB and Gca.mysCD genes from *Ceratophyllum demersum* in the preparation of the natural sunscreen porphyra-334.

[0016] The sixth aspect of the present invention provides a method for preparing a natural sunscreen agent porphyra-334, wherein the transgenic engineered bacteria described above are fermented to obtain the natural sunscreen agent porphyra-334 from the fermentation broth.

[0017] Furthermore, the fermentation medium used was SC-Ura liquid medium, and the fermentation temperature was 30℃.

[0018] This invention provides two genes related to MAAs synthesis in *Ceratophyllum demersum*, Gca.mysAB and Gca.mysCD. Collinearity analysis was performed using JCVI software to screen homologous gene pairs and blocks, identify gene clusters, and annotate using the pfam database to discover conserved DHQS and ATP-grasp domains. The nucleotide sequences of the *Ceratophyllum demersum* Gca.mysAB gene are shown in SEQ ID NO.1, and the nucleotide sequences of the *Ceratophyllum demersum* Gca.mysCD gene are shown in SEQ ID NO.2, with full lengths of 2763 bp and 2763 bp respectively, encoding 921 and 921 amino acid residues respectively. The sequences are shown in SEQ ID NO.3 and SEQ ID NO.4.

[0019] The structure of the porphyra-334 compound is as follows:

[0020]

[0021] The Gca.mysAB and Gca.mysCD genes of *Ceratophyllum demersum* were constructed on a vector and introduced into *Saccharomyces cerevisiae* strain BY4742. The strain was fermented and grown in SC-Ura liquid medium. Under the catalysis of the proteins encoded by the Gca.mysAB and Gca.mysCD genes of *Ceratophyllum demersum*, the endogenous substrate 7-phosphate sedoheptulose (S7P) of *Saccharomyces cerevisiae* was converted into porphyra-334 in two steps.

[0022] This invention expresses the target protein in Saccharomyces cerevisiae using recombinant plasmids, and then catalyzes the production of porphyra-334 by catalyzing the high accumulation of the yeast endogenous substrate 7-phosphate sedoheptulose (S7P).

[0023] The *Gca.mysAB* and *Gca.mysCD* genes of *G. coli* described in this invention were obtained through comparative genomic collinearity analysis of the genomes of seven species in the Gracilariaceae family. The obtained *G. coli* gene sequences were then sent to GenScript for synthesis. GenScript performed codon and sequence optimization (removing repetitive and unstable structures) according to the expression host requirements, and designed the optimized sequences as overlapping short fragments (Oligos). All Oligos were then synthesized in parallel using high-throughput solid-phase synthesis (e.g., microarray technology). Next, the Oligos were assembled into complete double-stranded genes using cell-free enzymatic assembly (e.g., Gibson Assembly), with longer genes assembled stepwise. Finally, the genes were cloned into the designated vector Y33, transformed into *E. coli*, and single clones were selected after antibiotic plate screening for amplification and culture. The sequence accuracy was rigorously verified by full-length sequencing before delivery. Subsequent primer design was used for PCR amplification. The amplification primers for the *Gca.mysAB* and *Gca.mysCD* genes of *G. coli* are shown below:

[0024] Gca.mysAB-5'F: atgcacattaccttagactctacca;

[0025] Gca.mysAB-3'R:tcagatcttgtcaacctttctgacaatc;

[0026] Gca.mysCD-5'F:tcacttcatagcagtaccaccacg;

[0027] Gca.mysCD-3'R: atgactaacgaccaaatcgaccca.

[0028] Furthermore, when performing homologous recombination with the vector pESC, if the *Ceratophyllum demersum* Gca.mysAB gene or the *Ceratophyllum demersum* Gca.mysCD gene is present, primers with homologous arms are required for amplification and recovery. The primers with homologous arms are as follows:

[0029] Gca.mysAB-TY-5'F:cactatagggcccgggctaagatgcacattaccttagactctacca;

[0030] Gca.mysAB-TY-3'R:cttccttttcggttagagcggattcagatcttgtcaacctttctgacaatc;

[0031] Gca.mysCD-TY-5'F:tctggcgaagaattgttaattaatcacttcatagcagtaccaccacg;

[0032] Gca.mysCD-TY-3'R:gaattcaaccctcactaaaggatgactaacgaccaaatcgaccca.

[0033] This invention involves downloading the genomes of six species from the Gracilaria family, performing collinearity analysis and screening, and verifying the genes screened from Gracilaria caudata, which contains high levels of porphyra-334, based on literature review. Among these, the pathway-related genes >Gcaud2904.t1 and >Gcaud2905.t1 were named Gca.mysAB and Gca.mysCD, respectively. This provides a reference for elucidating the MAAs synthesis pathway in Gracilaria plants and also brings significant economic benefits to the industrial production of MAAs.

[0034] The present invention contains important marker genes for molecularly assisted culture of Gracilaria Gca.mysAB and Gca.mysCD genes, which are also important candidate genes for the production of porphyra-334 in yeast chassis cell construction.

[0035] Currently, research on the synthetic mechanisms of ultraviolet-protective amino acids (MAAs) in eukaryotic algae is still in its early stages, especially the elucidation of the synthetic pathway of *Ceratophyllum demersum* (Grassaceae). This invention fills a gap in the understanding of MAAs synthetic pathways in eukaryotic algae. Compared with cyanobacteria, the MAAs synthetic pathways in eukaryotic algae are much simpler. For example, *Ceratophyllum demersum* only requires two key enzymes (such as *Gca.mysAB* and *Gca.mysCD*) to catalyze the precursor 4-DG and generate porphyra-334, significantly improving the synthetic efficiency. This discovery not only reveals the uniqueness of the metabolic pathways in eukaryotic algae but also provides a theoretical basis for subsequent efficient heterologous synthesis.

[0036] Compared with the prior art, the beneficial effects of this invention are as follows:

[0037] (1) Highly efficient dual-enzyme catalysis, significantly shortening the production cycle: Utilizing a unique combination of Gca.mysAB and Gca.mysCD genes, only two enzymatic reactions are required to efficiently convert the substrate 4-DG into the high-value product Porphyra-334. Compared with existing technologies, the synthesis steps are greatly simplified and the production cycle is significantly shortened;

[0038] (2) Streamlined gene components, increasing fermentation yield: Existing MAAs synthesis technologies typically require more than four enzymes to construct complex synthesis modules, which are cumbersome and inefficient. This technology, however, only requires two enzyme components, Gca.mysAB and Gca.mysCD, to complete the core synthesis pathway. This extremely simplified gene circuit significantly reduces the metabolic burden on the host cell, optimizes resource allocation, and drives an increase in fermentation yield;

[0039] (3) Constructing a universal platform to overcome the bottleneck of natural extraction capacity: The efficient synthesis module constructed based on the Gca.mysAB and Gca.mysCD genes has established a robust and universal platform technology for the heterologous production of MAAs by microorganisms (such as yeast and Escherichia coli). This platform effectively overcomes the fundamental capacity bottlenecks faced by traditional MAAs extraction from natural algae, such as strong dependence on raw materials, long growth cycle, low extraction rate, and high cost, laying a solid foundation for the large-scale, low-cost, and sustainable industrial production of MAAs. Attached Figure Description

[0040] Figure 1 This is a schematic diagram of the synthetic pathway of porphyra-334.

[0041] Figure 2 This is a schematic diagram illustrating the construction of the recombinant plasmid pESC-Gca.mysAB-mysCD;

[0042] Figure 3 The images show the electrophoresis results of the recombinant pESC-Gca.mysAB-mysCD. Lane Make has 9 bands. In Figure A, lanes 1 to 4 of B represent the four positive transformants of the recombinant pESC-Gca.mysAB-mysCD, all ranging from 3000bp to 5000bp. In Figure B, lanes 1 to 4 represent the four transformants of the recombinant pESC-Gca.mysAB, with lane 3 being a positive transformant ranging from 2500bp to 3000bp. Lanes 1, 2, and 4 represent the transformants that did not successfully recombine, all ranging from 500bp.

[0043] Figure 4The images show the LC-MS detection of intermediate product 4-DG; where A is the EIC image of yeast cell extract for producing intermediate product 4-DG; B is the image of MS extraction of sample 1 (B3-1-pESC-Gca.mysAB) for producing intermediate product 4-DG; and C is the image of MS extraction of sample 2 (B3-2-pESC-Gca.mysAB) for producing intermediate product 4-DG.

[0044] Figure 5 Chromatograms of porphyra-334 products detected by HPLC and LC-MS are shown below. A is the HPLC chromatogram of the extract from yeast cells producing porphyra-334; A1-1-pESC-Gca.mysAB-mysCD, A1-2-pESC-Gca.mysAB-mysCD, and A1-3-pESC-Gca.mysAB-mysCD are three replicates; pESC-1 is the control; standard of porphyra-334 is the standard. B is the EIC chromatogram of the extract from yeast cells producing porphyra-334. C is the chromatogram of the porphyra-334 standard detected by MS. D is the chromatogram of the metabolites of the recombinant strain A1-1-pESC-Gca.mysAB-mysCD detected by MS. Detailed Implementation

[0045] The present invention will now be described in further detail with reference to the embodiments.

[0046] Those skilled in the art will understand that the following embodiments are for illustrative purposes only and should not be construed as limiting the scope of the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed according to techniques or conditions described in the literature in the field or according to product instructions. Materials or equipment whose manufacturers are not specified are all conventional products that can be purchased. In this invention, m / v is measured in g / mL.

[0047] Example 1

[0048] The genome data of *Gracilariopsis chorda* and *Gracilaria domingensis* were downloaded from https: / / www.ncbi.nlm.nih.gov / and https: / / ngdc.cncb.ac.cn / , respectively, and the genome data of *Gracilaria vermiculophylla*, *Gracilaria caudata*, *Gracilaria chilensis*, and *Gracilaria gracilis* were downloaded from https: / / rhodoexplorer.sb-roscoff.fr / home / . Collinearity analysis was performed on these six species from the Gracilariaceae family using JCVI v1.4.16. Homologous gene pairs and collinear blocks were screened through intergenomic collinearity analysis, identifying gene clusters. Gene annotation within these clusters using the pfam database revealed that they possess conserved domains of DHQS and ATP-grasp, leading to further validation of these two genes. First, two genes from *Urechis ceratoides*, Gca.mysAB and Gca.mysCD, were sent to GenScript for sequence synthesis. Subsequent procedures included gene amplification and recovery, homologous recombination, in vivo yeast expression induction, incubation, yeast metabolite extraction, and HPLC detection. Ultimately, it was identified that the Gca.mysAB gene can catalyze the production of 4-DG from the yeast endogenous substrate S7P. Figure 1 The Gca.mysCD gene can catalyze the intermediate 4-DG to generate the final product porphyra-334. Figure 1 The steps for each stage of porphyra-334 synthesis are as follows:

[0049] (1) Synthetic gene CDS sequence

[0050] The gene sequences of Gca.mysAB and Gca.mysCD from *Ceratophyllum demersum* were sent to GenScript for synthesis. The nucleotide sequence of the *Ceratophyllum demersum* Gca.mysAB gene is shown in SEQ ID NO.1; the nucleotide sequence of the *Ceratophyllum demersum* Gca.mysCD gene is shown in SEQ ID NO.2. GenScript then constructed these genes into the Y33 vector, obtaining the Y33-Gca.mysAB plasmid and the Y33-Gca.mysCD plasmid.

[0051] The specific steps are as follows: Linearization of the Y33 vector: First, the Y33 vector was linearized using FuniCut™ SalI single-enzyme digestion. The reaction system consisted of: 15 μL ddH2O, 2 μL 10×FuniCut™ Buffer, 2 μL Y33 vector, and 1 μL FuniCut™ SalI, for a total volume of 20 μL. The reaction conditions were 37℃ for 15 min. After the reaction, the target enzyme digest was recovered using a GenStar kit. The concentration was measured, and the recovered band was labeled as linearized Y33. Finally, it was stored at -20℃ for later use.

[0052] The Y33-Gca.mysAB plasmid ligation system was constructed as follows: 2 μL of linearized Y33, 3 μL of gene sequence fragment Gca.mysAB, and 5 μL of ready-to-use seamless cloning kit, for a total volume of 10 μL.

[0053] The constructed Y33-Gca.mysCD plasmid ligation system consisted of: 2 μL of linearized vector Y33, 3 μL of gene sequence fragment Gca.mysCD, and 5 μL of Ready-to-Use Seamless Cloning Kit, for a total volume of 10 μL.

[0054] The connection conditions are: incubation in a metal bath at 50°C for 1 hour. The conversion method is existing technology and can be carried out according to the conversion method in (3.3).

[0055] (2) Gene amplification and recovery

[0056] Using the plasmid synthesized in (1) as templates, primers without homologous arms for the two target genes were designed using the primer design software SnapGene:

[0057] Gca.mysAB-5'F: atgcacattaccttagactctacca; (SEQ ID NO.5)

[0058] Gca.mysAB-3'R:tcagatcttgtcaacctttctgacaatc; (SEQ ID NO.6)

[0059] Gca.mysCD-5'F:tcacttcatagcagtaccaccacg; (SEQ ID NO.7)

[0060] Gca.mysCD-3'R: atgactaacgaccaaatcgaccca. (SEQ ID NO.8)

[0061] Note: Homologous arms are on the yeast expression vector pESC.

[0062] Gene PCR amplification was then performed using DNA polymerase (phanta enzyme).

[0063] The PCR reaction system consisted of 25 μL of phanta enzyme, 1.5 μL (10 μM) of each primer, 1 μL of template, and 21 μL of ddH2O, for a total of 50 μL.

[0064] The templates were two genes synthesized by GenScript in the Y33 vector: Y33-Gca.mysAB plasmid and Y33-Gca.mysCD plasmid.

[0065] The PCR reaction program was as follows: 95℃, 3 min; 95℃, 15 s; 56℃, 15 s; 72℃, 3 min, 35 cycles; 72℃, 5 min; 12℃, ∞.

[0066] After PCR, gel electrophoresis was performed to confirm successful amplification, followed by recovery of the target band. Gene digestion and recovery were performed using a GenStar kit, and the target genes were named 1-Gca.mysAB and 1-Gca.mysCD. The recovery concentration was measured using a NanoDrop 2000, and the recovered genes were stored at -20°C for later use.

[0067] Subsequently, using 1-Gch.mysAB and 1-Gch.mysCD as templates, the two target genes were amplified with primers containing homologous arms to obtain the target gene Gca.mysAB fragment and the target gene Gca.mysCD fragment.

[0068] The primers are:

[0069] Gca.mysAB-TY-5'F:cactatagggcccgggctaagatgcacattaccttagactctacca; (SEQ ID NO.9)

[0070] Gca.mysAB-TY-3'R:cttccttttcggttagagcggattcagatcttgtcaacctttctgacaatc; (SEQ ID NO.10)

[0071] Gca.mysCD-TY-5'F:tctggcgaagaattgttaattaatcacttcatagcagtaccaccacg; (SEQ ID NO.11)

[0072] Gca.mysCD-TY-3'R:gaattcaaccctcactaaaggatgactaacgaccaaatcgaccca. (SEQ ID NO.12)

[0073] Note: The homologous arm is on the yeast expression vector pESC. Its PCR amplification system and procedure are consistent with the amplification method using primers without homologous arms described above.

[0074] (3) Construction and identification of gene recombination vectors

[0075] (3.1) Vector linearization: First, the vector pESC is linearized by designing primers to linearize the vector:

[0076] The upstream primer is pESC-GJ-5'F: ttaattaacaattcttcgccagaggt (SEQ ID NO.13);

[0077] The downstream primer is pESC-GJ-3'R: atccgctctaaccgaaaagga (SEQ ID NO.14).

[0078] Subsequently, a total of 50 μL of phanta enzyme, 1.5 μL (10 μM) primers, 1 μL of plasmid pESC, and 21 μL of ddH2O were used.

[0079] The PCR reaction program was 95℃ for 3 min; 95℃ for 15 s, 56℃ for 2.5 min, 72℃ for 5 min, 35 cycles; 72℃ for 5 min; 12℃, ∞. After the PCR program was completed, the target band was recovered using a GenStar kit. The concentration was measured after recovery and labeled as linearized pESC-GJ. Finally, it was stored at -20℃ for later use.

[0080] (3.2) Preparation of promoter fragments: The bidirectional promoter was integrated from the pESC vector using the following primers: upstream primer GAL1-5'F: tttcaaaaattcttactttttttttg (SEQ ID NO.15); downstream primer GAL10-3'F: gttttttctccttgacgttaaagtat (SEQ ID NO.16). Subsequent integration was performed using 2×Phanta Max Master Mix. The PCR reaction system consisted of: 25 μL of 2×Phanta Max Master Mix, 1.5 μL each of the upstream and downstream primers (10 μM), 1 μL of the pESC vector, and 21 μL of ddH2O, for a total of 50 μL. The PCR amplification program was: 95℃ for 3 min; 95℃ for 15 s, 56℃ for 15 s, 72℃ for 3 min, 35 cycles; 72℃ for 5 min; 12℃ for infinity. The recovered products were recovered using a GenStar kit for the target band. After recovery, the concentration was measured and labeled as bidirectional promoters GAL1-GAL10. Finally, they were stored at -20°C for later use.

[0081] (3.3) Gene recombination: Ligation reactions were performed using a Ready-to-Use Seamless Cloning Kit.

[0082] The constructed pESC-Gca.mysAB-mysCD plasmid ligation system is as follows:

[0083] The total volume of the amplified target gene fragments Gca.mysAB and Gca.mysCD, amplified with primers containing homologous arms, is 1.5 μL each; the bidirectional promoter fragment GAL1-GAL10 is 1.5 μL; the linearized backbone fragment pESC-GJ is 0.5 μL; and the ready-to-use seamless cloning kit is 5 μL, for a total volume of 10 μL.

[0084] The pESC-Gca.mysAB plasmid ligation system was constructed as follows: 2.5 μL of the target gene Gca.mysAB fragment amplified by homologous arm primers, 1.5 μL of the bidirectional promoter GAL1-GAL10 fragment, 1 μL of the linearized pESC-GJ fragment, and 5 μL of ready-to-use seamless cloning enzyme, for a total of 10 μL.

[0085] Subsequently, it was incubated in a metal bath at 50°C for 1 hour.

[0086] For connection methods and conversion techniques, please refer to [link / reference]. Figure 2After incubation, the ligation product was transformed into DH5α competent cells using a heat shock method. Specifically, 10 μL of the ligation product from two tubes was transformed into 50 μL of DH5α competent cells, incubated on ice for 30 min, heat-shocked at 42℃ for 45 s, incubated on ice for 2 min, and then 200 μL of LB liquid medium was added. The cells were then cultured on a shaker at 220 rpm / min and 37℃ for 1 h. Subsequently, the cells were centrifuged at 12000 rpm for 1 min, 150 μL of supernatant was removed, and the cells were resuspended. 100 μL of each supernatant was plated onto LB solid medium containing 100 mg / mL ampicillin. The constructed pESC-Gca.mysAB-mysCD plasmid was designated plate A, and the constructed pESC-Gca.mysAB plasmid was designated plate B. The cells were cultured overnight at 37℃. The culture media used in this experiment are listed in Table 1.

[0087] Table 1

[0088]

[0089] (3.4) Bacterial solution detection: On a clean bench, four single colonies were randomly selected from plates A and B, which were incubated overnight as described in (3.3). These colonies were then transferred to eight-tube sets containing 20 μL of sterile ddH2O and labeled A1-A4 and B1-B4, respectively. After thoroughly resuspending the colonies, 3 μL of bacterial solution was taken from each tube as the PCR template. The PCR reaction system used was the 2×Taq Master Mix enzyme reaction system from Nanjing Novizan Biotechnology Co., Ltd., specifically prepared as follows: 10 μL of 2×Taq Master Mix, 0.8 μL (10 μM) each of upstream and downstream detection primers, 3 μL of template bacterial solution, and 5.4 μL of sterile ddH2O, for a total volume of 20 μL.

[0090] Upstream detection primer pESC-JC-F: cctgacctacaggaaagagttactca (SEQ ID NO.17);

[0091] Downstream detection primer pESC-JC-R: aagcaaggttttcagtataatgttac (SEQ ID NO.18);

[0092] The PCR amplification program was set as follows: pre-denaturation at 95℃ for 3 min; followed by 35 cycles of amplification (denaturation at 95℃ for 15 s, annealing at 58℃ for 15 s, extension at 72℃ for 3 min); and a final extension at 72℃ for 5 min, followed by storage at 12℃. After the reaction, the PCR products were subjected to 1% agarose gel electrophoresis to determine the size of the amplified fragments.

[0093] Depend on Figure 3Electrophoresis results showed that the lengths of the four single colony PCR products in plate A were all between 3000bp and 5000bp, indicating that the assembly was successful and further sequencing confirmed the results. Figure 3 Image B shows the PCR product detection results of plate B. Only B3 has a length between 2000bp and 3000bp, indicating successful assembly, which was further confirmed by sequencing. The remaining PCR stock solutions numbered A1-A4 and B3 were sent for sequencing, and the corresponding positive monoclonal bacteria (remaining 17μL of bacterial culture) were inoculated into 4mL of LB liquid medium containing 100mg / mL ampicillin and cultured overnight at 37℃ and 220rpm with shaking.

[0094] (4) Extraction of recombinant plasmids

[0095] After successful sequencing of cells A1-A4 and B3, 1 mL of the overnight culture was taken and mixed with an equal volume of 50% (v / v) glycerol solution at a 1:1 volume ratio for preservation. Subsequently, plasmids were extracted according to the instructions on the plasmid DNA miniaturization kit centrifugation column (GenStar, Shenzhen, China). The recovered plasmid DNA concentration was determined using a NanoDrop 2000 and numbered A1-pESC-Gca.mysAB-mysCD, A2-pESC-Gca.mysAB-mysCD, A3-pESC-Gca.mysAB-mysCD, A4-pESC-Gca.mysAB-mysCD, and B3-pESC-Gca.mysAB. Finally, the samples were stored at -20°C for later use.

[0096] (5) Preparation of competent cells and transformation of yeast strain BY4742

[0097] (5.1) Prepare a YPD solid plate and streak the Saccharomyces cerevisiae strain BY4742 onto it. Incubate at 30°C for 24-48 hours. After colonies have grown, pick a single colony and inoculate it into 3 mL of YPD liquid medium. Incubate overnight at 30°C with a shaking incubator at 220 rpm for 24-48 hours. The cultured bacterial solution can be used for subsequent experiments.

[0098] (5.2) Take 3 mL of the overnight cultured BY4742 yeast culture and inoculate it into 30 mL of fresh YPD liquid culture medium. Place it in a constant temperature shaking incubator at 30℃ and culture at 220 rpm. During the culture, monitor the OD600 value at regular intervals. When the bacterial density reaches the logarithmic growth phase (OD600=0.8~1.0), terminate the culture to obtain the target culture medium.

[0099] (5.3) Collect the target culture medium into a 50 mL centrifuge tube, centrifuge at 6000 rpm for 5 min, remove the supernatant, and collect the bacterial cells.

[0100] (5.4) Wash the bacterial cells with 30 mL of sterile deionized water, centrifuge at 6000 rpm for 5 min, remove the supernatant and collect the bacterial cells; repeat the washing twice.

[0101] (5.5) Add 1 mL of sterile deionized water to resuspend the bacteria, then transfer to a 1 mL sterile centrifuge tube, centrifuge at 12000 rpm for 1 min, and remove the supernatant.

[0102] (5.6) Add 900 μL of sterile deionized water and 100 μL of 1 mM LiAc to the 1 mL centrifuge tube in (5.5) to resuspend the bacterial cells. Then take 300 μL and aliquot it into 3 1.5 mL centrifuge tubes, 100 μL per tube. Centrifuge for 30 seconds on your hand and remove the supernatant. The resulting yeast cells are yeast competent cells used for yeast transformation.

[0103] (5.7) Resuspend the competent yeast cells in a 1.5 mL centrifuge tube containing the mixture and gently pipette to mix. The mixture was prepared according to Table 2. Except for the DNA added, all other components were the same. The DNA used were A1-pESC-Gca.mysAB-mysCD plasmid, B3-pESC-Gca.mysAB plasmid, and pESC empty vector plasmid.

[0104] Table 2

[0105]

[0106] The mixture containing A1-pESC-Gca.mysAB-mysCD plasmid is named tube C; the mixture containing B3-pESC-Gca.mysAB plasmid is named tube D; and the mixture containing pESC empty vector plasmid without foreign gene insertion is named tube E.

[0107] (5.8) After mixing (5.7), the centrifuge tubes were placed in a constant temperature incubator at 30℃ for 20 min.

[0108] (5.9) After static incubation, heat shock at 42℃ for 40 min.

[0109] (5.10) Centrifuge at 12000 rpm for 1 min, remove the supernatant, add 200 μL of sterile deionized water to resuspend the yeast cells, and take 150 μL of yeast cells to spread on SC-Ura solid medium [the plates to be spread are named C plate, D plate and E plate respectively, corresponding to the tube number in step (5.7) above], and place in a 30℃ constant temperature incubator for inverted culture for 2-3 days.

[0110] (6) Extraction of single-colony genome of Saccharomyces cerevisiae

[0111] (6.1) After culturing for 2-3 days from plates C, D, and E as per step (5.10), pick four yeast single colonies from each plate on the inverted SC-Ura solid medium. Plate C corresponds to A1-pESC-Gca.mysAB-msyCD (the four single colonies are labeled A1-1-pESC-Gca.mysAB-msyCD, A1-2-pESC-Gca.mysAB-msyCD, A1-3-pESC-Gca.mysAB-msyCD, A1-4-pESC-Gca.mysAB-msyCD, and A1-4-pESC-Gca.mysAB-msyCD). The D-plate corresponds to B3-pESC-Gca.mysAB (4 single colonies are labeled B3-1-pESC-Gca.mysAB, B3-2-pESC-Gca.mysAB, B3-3-pESC-Gca.mysAB, and B3-4-pESC-Gca.mysAB), and the D-plate corresponds to the empty vector pESC (4 single colonies are labeled pESC-1, pESC-2, pESC-3, and pESC-4). Each colony is inoculated into 3 mL of SC-Ura liquid medium. Each colony is placed in a 30℃ constant temperature shaking incubator and cultured at 220 rpm for 24-48 hours. After the bacterial solution becomes obviously turbid, the bacterial cells are collected for subsequent (6.2) yeast genome extraction and single colony PCR verification.

[0112] (6.2) Take 200 μL of the turbid bacterial solution obtained in (6.1) into a 1.5 mL centrifuge tube, centrifuge at 12000 rpm for 1 min, remove the supernatant, and retain the bacterial cells for subsequent (6.3) yeast genome extraction.

[0113] (6.3) Add 150 μL of cell lysis buffer containing 200 mM lithium acetate and 1% (m / v) SDS to the cells, mix well, and incubate at 70 °C for 10 min.

[0114] (6.4) After incubation, add 300 μL of anhydrous ethanol and mix well. At this time, white flocculent matter will appear. Then centrifuge at 12000 rpm for 1 min and remove the supernatant.

[0115] (6.5) Add 300 μL of 70% (v / v) anhydrous ethanol and mix well. Resuspend the precipitate, centrifuge at 12000 rpm for 1 min, and aspirate the supernatant with a pipette tip.

[0116] (6.6) Place the centrifuge tube in a 65°C metal bath to dry the remaining 70% anhydrous ethanol, add 20 μL ddH2O and mix gently, then centrifuge at 12000 rpm for 1 min.

[0117] (6.7) Take 2 μL of the supernatant as a template for single-colony yeast genome PCR verification.

[0118] (7) Single colony PCR verification

[0119] To determine whether the transformed plasmid DNA was successfully transformed into yeast, the single-colony yeast genome extracted in step (6.7) was verified by PCR. The reaction system for single-colony yeast genome PCR verification is shown in Table 3, and the reaction procedure is shown in Table 4 (where the primer sequences are the upstream and downstream detection primers used in step (3.3) for bacterial water verification). After the PCR reaction was completed, the PCR products were further detected and verified by agarose gel electrophoresis to identify positive single colonies.

[0120] Table 3

[0121]

[0122] Table 4

[0123]

[0124] (8) Yeast-induced expression

[0125] Select positive yeast single colony suspensions verified by PCR products in step (7) above (3 positive single colony suspensions from each of plates C, D and E), take 1 mL of the suspension and culture it in 50 mL of SC-Ura liquid medium, shake at 30℃ and 220 rpm for 5 days; then transfer the culture medium to a 50 mL centrifuge tube, centrifuge at 3900 rpm for 10 min to collect cells, remove the supernatant, add 5 mL of deionized water, sonicate for 30 min, add 5 mL of chloroform, sonicate for another 30 min, and let stand overnight; take the supernatant for detection the next day.

[0126] The HPLC gradient elution program is shown in Table 5. During gradient elution, the gradient change was linear. An INERTSUSTAINAQ-C18 column (250 mm × 4.6 mm, 5 μm) was used. The column temperature was 25℃, the flow rate was 0.6 mL / min, the injection volume was 10 μL, the ESI was in positive ion mode, and the UV was 330 nm.

[0127] Table 5

[0128]

[0129] (9) Detection of yeast products by HPLC and LC-MS

[0130] To verify the biosynthetic pathway of the intermediate product 4-DG, the recombinant vector B3-pESC-Gca.mysAB, constructed from the Gca.mysAB gene screened from *Urechis salina*, was transformed into *Saccharomyces cerevisiae* BY4742 for heterologous expression. The results showed that after shaking culture in step (8), fermentation products were extracted from the experimental group (two transformants, B3-1-pESC-Gca.mysAB and B3-2-pESC-Gca.mysAB) and the empty vector control group (pESC-1-1), and LC-MS was used for product analysis. Figure 4 As shown in Figure A, both transformants (B3-1-pESC-Gca.mysAB and B3-2-pESC-Gca.mysAB) exhibited specific chromatographic peaks at a retention time of 8.8 min, while the control group did not show this characteristic peak. Further analysis of the relative molecular weight of the positive peaks revealed that B3-1-pESC-Gca.mysAB had [M+H]+ = 189.0765, and B3-2-pESC-Gca.mysAB had [M+H]+ = 189.0757. Figure 4 The molecular weight of 4-DG (B-4C) is highly consistent with the reported relative molecular mass of 4-DG ([M+H]+=189.0757). These results indicate that the Gca.mysAB gene successfully produces 4-DG in Saccharomyces cerevisiae.

[0131] To verify the function of Gca.mysCD, the pESC-Gca.mysAB-mysCD recombinant vector was constructed and transformed into Saccharomyces cerevisiae BY4742 for heterologous expression. The results showed that after 5 days of fermentation in step (8), fermentation products were extracted from the experimental group (three transformants: A1-1-pESC-Gca.mysAB-mysCD, A1-2-pESC-Gca.mysAB-mysCD, and A1-3-pESC-Gca.mysAB-mysCD) and the empty vector control group (Pesc-1), and the products were analyzed by HPLC. Figure 5 As shown in Figure A, all three experimental groups exhibited a chromatographic peak corresponding to the standard porphyra-334 at 9 min, while the control group pESC-1 did not show this peak. Further LC-MS analysis of the products yielded the following EIC results: Figure 5 B) The experimental group A1-1-pESC-Gca.mysAB-mysCD and the standard porphyra-334 both showed characteristic peaks at the same retention time, while the control group CK did not. Meanwhile... Figure 5The relative molecular weight analysis of C-5D showed that the [M+H]+ = 347.07 of A1-1-pESC-Gca.mysAB-mysCD was consistent with the [M+H]+ = 347.05 of the standard porphyra-334. In summary, this result confirms that the MAAs synthesis pathway in *Cyclocarya spp.* starts at S7P, is catalyzed by Gca.mysAB to generate 4-DG, and is further catalyzed by Gca.mysCD to form the final product porphyra-334. Figure 1 ).

[0132] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the present invention as claimed. The scope of protection of this invention is defined by the appended claims and their equivalents.

Claims

1. A transgenic engineered bacterium used to prepare the natural sunscreen agent porphyra-334, characterized in that, The genome of the genetically engineered bacteria integrates exogenous *Ceratophyllum demersum*. Gca.mysAB Genes and tailed algae Gca.mysCD The gene, or the genetically engineered bacteria, contains a recombinant plasmid; the recombinant plasmid contains *Tylophora*. Gca.mysAB Genes and tailed algae Gca.mysCD Gene; The aforementioned algae with tails Gca.mysAB The nucleotide sequence of the gene is shown in SEQ ID NO.1; the described *Ulva* species... Gca.mysCD The nucleotide sequence of the gene is shown in SEQ ID NO.

2.

2. The genetically engineered bacteria according to claim 1, characterized in that, The genetically engineered bacteria is Saccharomyces cerevisiae strain BY4742.

3. The recombinant plasmid as described in claim 1.

4. The recombinant plasmid according to claim 3, characterized in that, There will be tail algae Gca.mysAB Genes, tailed algae Gca.mysCD The gene was homologously recombinated with the pESC vector to obtain pESC-Gca.mysAB-mysCD Recombinant plasmid.

5. The tailed algae as described in claim 1 Gca.mysAB Genes and tailed algae Gca.mysCD Application of genes in the preparation of the natural sunscreen agent porphyra-334.

6. A method for preparing a natural sunscreen agent, porphyra-334, characterized in that, The genetically engineered bacteria as described in claim 1 or 2 are fermented to obtain the natural sunscreen agent porphyra-334 from the fermentation broth.

7. The method for preparing the natural sunscreen agent porphyra-334 according to claim 6, characterized in that, The fermentation medium used was SC-Ura liquid medium, and the fermentation temperature was 30℃.