Glucose dehydrogenase mutant S334M and application thereof

By screening key amino acid sites through molecular docking and molecular dynamics simulations for mutation, the expression of glucose dehydrogenase in Pichia pastoris was optimized, solving the problems of insufficient stability and activity of FAD-GDH, improving the accuracy of blood glucose detection and reducing production costs.

CN121759425APending Publication Date: 2026-03-31HANGZHOU BOYUE BIOTECHNOLOGY CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-12-09
Publication Date
2026-03-31

AI Technical Summary

Technical Problem

The stability and activity of existing FAD-GDH in blood glucose detection still have room for improvement, resulting in high production costs and insufficient detection accuracy.

Method used

Key amino acid sites were screened through molecular docking and molecular dynamics simulations, and virtual saturation mutagenesis was performed to obtain multiple glucose dehydrogenase mutants with improved stability and activity, including combinations of mutation sites such as G321R, S334K, S334M, S413M, S413V, and S503P. Their expression and purification in Pichia pastoris were then optimized.

Benefits of technology

This improved the stability and activity of glucose dehydrogenase mutants, enhanced the sensitivity and accuracy of blood glucose detection, and reduced production costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121759425A_ABST
    Figure CN121759425A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of bioengineering, and discloses a glucose dehydrogenase mutant S334M and application thereof. The method comprises the following steps: firstly, carrying out molecular docking on glucose dehydrogenase and a glucose substrate to obtain a series of amino acid sites possibly influencing the enzyme structure and the combination of the enzyme and the substrate, then carrying out virtual saturated mutation on amino acids of the sites, and screening out mutation possibly enhancing the enzyme stability and activity through molecular dynamics simulation. A plurality of amino acid sites and mutation schemes capable of improving the stability and activity of the glucose dehydrogenase are obtained through screening after large-scale expression of the glucose dehydrogenase, the stability and activity of mutants obtained through single-point mutation and multi-point combined mutation of the sites are improved to different degrees, and the mutants can be used for preparing the glucose dehydrogenase mutant. The compound has high activity, can improve detection sensitivity and accuracy when used for detecting blood glucose, has high stability, is suitable for preparing kits and the like, and has wide application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] This application is a divisional application of application number 202411793988.1, filed on December 9, 2024, entitled "Glucose dehydrogenase mutant with enhanced stability and activity". Technical Field

[0002] This invention relates to the field of bioengineering technology, and in particular to a glucose dehydrogenase mutant S334M and its applications. Background Technology

[0003] With the continuous improvement of living conditions, the incidence of diabetes continues to rise, and timely monitoring of blood glucose levels is crucial for controlling the progression of diabetes. Traditional blood glucose testing often uses glucose oxidase (GOD), which is significantly dependent on dissolved oxygen and exhibits cross-reactivity with other sugars, potentially leading to inaccurate measurements. In contrast, glucose dehydrogenase (GDH), with flavin adenine dinucleotide (FAD) as a cofactor, uses FAD as an electron acceptor, is oxygen-independent, and has low cross-reactivity with other sugars, resulting in better accuracy and specificity in blood glucose testing. Therefore, glucose dehydrogenase is increasingly replacing glucose oxidase for blood glucose monitoring. Currently, FAD-GDH used for blood glucose testing is mainly derived from Aspergillus species and has achieved efficient recombinant expression in yeast. However, there is still room for improvement in stability and activity. Further modification to improve stability and activity can further reduce production costs. Summary of the Invention

[0004] To address the aforementioned problems, this invention discloses a glucose dehydrogenase mutant S334M and its applications. First, glucose dehydrogenase and a glucose substrate are molecularly docked to obtain a series of amino acid sites that may affect the enzyme structure and enzyme-substrate binding. Then, these amino acids are subjected to virtual saturation mutations. Molecular dynamics simulations are used to screen for mutations that may enhance enzyme stability and activity. After large-scale expression and screening in wet experiments, multiple amino acid sites and mutation schemes that improve the stability and activity of glucose dehydrogenase are obtained. The mutants obtained from single-point mutations and multi-point combination mutations show varying degrees of improvement in stability and activity.

[0005] On one hand, the present invention provides a glucose dehydrogenase mutant, wherein the glucose dehydrogenase mutant uses flavin adenine dinucleotide as a prosthetic group, and the glucose dehydrogenase mutant is used in Seq ID, etc. Amino acid mutations are performed based on the amino acid sequence shown in No. 1, and the amino acid mutations include any one of the following mutations or any combination of mutations at the following mutation sites: G53N, G55R, Y98R, W117E, G163R, P303C, V310H, D316L, Q317R, F318R, N320I, G321R, S334K, S334M, S334F, S334W, T335I, Q377M, S413M, S413V, E414R, E414M, A474C, K475I, S503P, P507R, V551E, V551I, V551M, V551C.

[0006] A protein sequence refers to the arrangement of amino acid residues in a protein molecule. An amino acid mutation refers to the substitution of individual amino acids in the protein sequence. Amino acid mutations typically affect the local structure of a protein. Local structure refers to both local chemical structure (where the new amino acid may form new hydrogen bonds with spatially adjacent amino acids) and local spatial structure (such as affecting the spatial conformation of the local peptide chain). Therefore, amino acid mutations at certain sites can alter the properties and functions of a protein. Because amino acid mutations are localized, it is understandable that multiple benign amino acid mutations at different sites can collectively enhance certain benign properties of the protein molecule as a whole by affecting different local structures.

[0007] The mutation site is represented by an amino acid code: the amino acid before the mutation + the mutation site + the amino acid after the mutation; for example, A24G indicates that in a certain protein sequence, the mutation site is the 24th amino acid, which mutates from alanine (A) to glycine (G); the names and abbreviations of amino acids are existing public technologies and will not be elaborated here.

[0008] Therefore, "a combination of mutations at any number of mutation sites" means a combination of mutations occurring at different mutation sites. For example, S334K, S334M, S334F, and S334W are all mutations occurring at the 334th amino acid, and obviously cannot be considered a combination. On the other hand, G321R and S334K are mutations occurring at the 321st and 334th amino acids, respectively, and can be considered a combination.

[0009] In some embodiments, the amino acid mutation includes any one of the following mutations or a combination of mutations at any of the following mutation sites: G321R, S334K, S334M, S413M, S413V, S503P.

[0010] This invention demonstrates through experiments that mutations in G321R, S334K, S334M, S413M, S413V, and S503P can effectively improve the activity of glucose dehydrogenase mutants, among which the S413M-mutated glucose dehydrogenase mutant has the highest activity.

[0011] Preferably, the amino acid mutation includes S413M.

[0012] In some embodiments, the amino acid mutation includes any one of the following mutations or a combination of mutations at any of the following mutation sites: G321R, S334K, S334M, S413V.

[0013] This invention demonstrates through experiments that mutations in G321R, S334K, S334M, and S413V can effectively improve the stability and activity of glucose dehydrogenase mutants. Among them, the glucose dehydrogenase mutant with the S413V mutation has the highest stability.

[0014] Preferably, the amino acid mutation includes S413V.

[0015] On the other hand, the present invention provides a nucleic acid that encodes the glucose dehydrogenase mutant.

[0016] On the other hand, the present invention provides a carrier comprising the aforementioned nucleic acid.

[0017] On the other hand, the present invention provides a cell, wherein the cell is a host cell carrying the aforementioned vector.

[0018] In some embodiments, the host cell is Pichia pastoris.

[0019] On the other hand, the present invention provides a method for preparing a glucose dehydrogenase mutant, comprising the steps of: S1: Synthesize the FAD-GDH sequence for codon usage frequency optimization of Pichia pastoris, wherein the FAD-GDH sequence is the amino acid sequence shown in Seq ID No.2, and insert the FAD-GDH sequence into the vector; S2: Using mutation primers, PCR amplification is performed on the vector obtained in S1 to introduce the corresponding mutation. The correctly sequenced FAD-GDH mutant expression vector is extracted and electroporated into Pichia pastoris X-33 expression strain to screen for expression bacteria. The mutation primers include any one of the following mutations or any combination of the following mutation sites, both forward and reverse primers: Primer Name: Primer Sequence G53N-F: 5'-agatccgaaagctaatccgtagttgttagcgttggtgacgtcagg-3' G53N-R:5'-cctgacgtcaccaacgctaacaactacggattagctttcggatct-3' G55R-F:5'-gcagatccgaaagctaaacggtaaccgttagcgttgg-3' G55R-R:5'-ccaacgctaacggttaccgtttagctttcggatctgc-3' Y98R-F:5'-gtacatcttcggctcgggtacgagccattccattaatcgtac-3' Y98R-R:5'-gtacgattaatggaatggctcgtacccgagccgaagatgtac-3' W117E-F:5'-ggtaacaggtccttccaagtctcaccttcgttaccaagtttttg-3' W117E-R:5'-caaaaacttggtaacgaaggtgagacttggaaggacctgttacc-3' G163R-F:5'-ccagaagctaatgagcgggaccagccaactttt-3' G163R-R:5'-aaaagttggctggtcccgctcattagcttctgg-3' P303C-F:5'-tttcgccaactgttggtaaatcaactctgcaggtaatattattttttttcaggatagtag-3' P303C-R:5'-ctactatcctgaaaaaaaataatattacctgcagagttgatttaccaacagttggcgaaa-3' V310H-F:5'-gcaagttttcgccatgtgttggtaaatcaactcttggggtaat-3' V310H-R:5'-attaccccaagagttgatttaccaacacatggcgaaaacttgc-3' D316L-F:5'-tccggccattccattattaaattgcaattgcaagttttcgccaactgttgg-3' D316L-R:5'-ccaacagttggcgaaaacttgcaattgcaatttaataatggaatggccgga-3' Q317R-F:5'-ctccggccattccattattaaaacgatcttgcaagttttcgccaac-3' Q317R-R:5'-gttggcgaaaacttgcaagatcgttttaataatggaatggccggag-3' F318R-F:5'-tctccggccattccattattacgttgatcttgcaagttttcgcc-3' F318R-R:5'-ggcgaaaacttgcaagatcaacgtaataatggaatggccggaga-3' N320I-F:5'-ctccggccattccaatattaaattgatcttgcaagttttcgc-3' N320I-R:5'-gcgaaaacttgcaagatcaatttaatattggaatggccggag-3' G321R-F:5'-gccctctccggccatacgattattaaattgatcttgcaagttttcg-3' G321R-R:5'-cgaaaacttgcaagatcaatttaataatcgtatggccggagagggc-3' S334K-F:5'-atactggggtatgtgactgtcttagctccagccaaaacaccatag-3' S334K-R:5'-ctatggtgttttggctggagctaagacagtcacataccccagtat-3' S334M-F:5'-atactggggtatgtgactgtcatagctccagccaaaacaccatag-3' S334M-R:5'-ctatggtgttttggctggagctatgacagtcacataccccagtat-3' S334F-F:5'-ctggggtatgtgactgtgaaagctccagccaaaacacca-3' S334F-R:5'-tggtgttttggctggagctttcacagtcacataccccag-3' S334W-F:5'-ctggggtatgtgactgtccaagctccagccaaaacacc-3' S334W-R:5'-ggtgttttggctggagcttggacagtcacataccccag-3' T335I-F:5'-atactggggtatgtgacgatagaagctccagccaaaacacc-3' T335I-R:5'-ggtgttttggctggagcttctatcgtcacataccccagtat-3' Q377M-F:5'-gtctttccaaatcctccattttcatgtgaccgttggaaacctta-3' Q377M-R:5'-tagtttccaacggtcacatgaaaatggaggattggaaagac-3' S413M-F:5'-tggcagtagtccccaaaattccatagatacagcatttccctcc-3' S413M-R:5'-gggaggaaatgctgtatcttggaatttggggactactgcca-3' S413V-F:5'-gtccccaaaattcaacagatacagcatttcctcctccaggat-3' S413V-R:5'-atcctggaggaggaaatgctgtatctgttgaatttttggggac-3' E414R-F:5'-gaatggcagtagtccccaaaaacgagaagatacagcatttcctcc-3' E414R-R:5'-ggaggaaatgctgtatctctcgtttttggggactactgccattc-3' E414M-F:5'-cgaatggcagtagtccccaaacatagaagatacagcatttcctcct-3' E414M-R:5'-aggaggaaatgctgtatcttctatgttttggggactactgccattcg-3' A474C-F:5'-aggcttggtctctttgcaaatcagcttattcaagggggcagatct-3' A474C-R:5'-agactctgccccctgaataagctgatttgcaaagagaccagcct-3' K475I-F:5'-agtccaggctttggtctcaattgcaatcagcttattcaagggg-3' K475I-R:5'-ccccttgaataagctgattgcaattgagaccaagcctgact-3' S503P-F:5'-cagtgccaactgggtgaaagttcggtctgtagttagccttaaccac-3' S503P-R:5'-gtggttaaaggctaactacagaccgaactttcacccagttggcactg-3' P507R-F:5'-catggcagcagtgccaacacggtgaaagttactctctgt-3' P507R-R:5'-acagaagtaactttcaccgtgttggcactgctgccatg-3' V551E-F:5'-cggcgtacaatgtggactctagatgtccacaaacc-3' V551E-R:5'-ggtttgtggacatcttaggtccacattgtacgcg-3' V551I-F:5'-cggcgtacaatgtggagattagatgtccacaaacctgaaatg-3' V551I-R:5'-catttcaggttgtggacatctaatctccacattgtacgccg-3' V551M-F:5'-gcgtacaatgtggacattagatgtccacaaacctgaa-3' V551M-R: 5'-ttcaggtttgtggacatctaatgtccacattgtacgc-3' V551C-F: 5'-cacggcgtacaatgtggagcatagatgtccacaaacctgaaatggt-3' V551C-R: 5'-accatttcaggtttgtggacatctatgctccacattgtacgccgtg-3' S3: Fermentation, collecting the fermentation supernatant, eluting and purifying.

[0020] On the other hand, the present invention provides a primer combination for preparing glucose dehydrogenase mutants, comprising forward and reverse primers for any one or more of the following mutation sites: Primer Name: Primer Sequence G53N-F: 5'-agatccgaaagctaatccgtagttgttagcgttggtgacgtcagg-3' G53N-R: 5'-cctgacgtcaccaacgctaacaactacggattagctttcggatct-3' G55R-F: 5'-gcagatccgaaagctaaacggtaaccgttagcgttgg-3' G55R-R: 5'-ccaacgctaacggttaccgtttagctttcggatctgc-3' Y98R-F: 5'-gtacatcttcggctcgggtacgagccattccattaatcgtac-3' Y98R-R: 5'-gtacgattaatggaatggctcgtacccgagccgaagatgtac-3' W117E-F: 5'-ggtaacaggtccttccaagtctcaccttcgttaccaagtttttg-3' W117E-R: 5'-caaaaacttggtaacgaaggtgagacttggaaggacctgttacc-3' G163R-F: 5'-ccagaagctaatgagcgggaccagccaactttt-3' G163R-R:5'-aaaagttggctggtcccgctcattagcttctgg-3' P303C-F:5'-tttcgccaactgttggtaaatcaactctgcaggtaatattattttttttcaggatagtag-3' P303C-R:5'-ctactatcctgaaaaaaaataatattacctgcagagttgatttaccaacagttggcgaaa-3' V310H-F:5'-gcaagttttcgccatgtgttggtaaatcaactcttggggtaat-3' V310H-R:5'-attaccccaagagttgatttaccaacacatggcgaaaacttgc-3' D316L-F:5'-tccggccattccattattaaattgcaattgcaagttttcgccaactgttgg-3' D316L-R:5'-ccaacagttggcgaaaaacttgcaattgcaatttaataatggaatggccgga-3' Q317R-F:5'-ctccggccattccattattaaaacgatcttgcaagttttcgccaac-3' Q317R-R:5'-gttggcgaaaacttgcaagatcgttttaaataatggaatggccggag-3' F318R-F:5'-tctccggccattccattattacgttgatcttgcaagttttcgcc-3' F318R-R:5'-ggcgaaaacttgcaagatcaacgtaataatggaatggccggaga-3' N320I-F:5'-ctccggccattccaatattaaattgatcttgcaagttttcgc-3' N320I-R:5'-gcgaaaacttgcaagatcaatttaatattggaatggccggag-3' G321R-F:5'-gccctctccggccatacgattattaaattgatcttgcaagttttcg-3' G321R-R:5'-cgaaaacttgcaagatcaatttaataatcgtatggccggagagggc-3' S334K-F:5'-atactggggtatgtgactgtcttagctccagccaaaacaccatag-3' S334K-R:5'-ctatggtgttttggctggagctaagacagtcacataccccagtat-3' S334M-F:5'-atactggggtatgtgactgtcatagctccagccaaaacaccatag-3' S334M-R:5'-ctatggtgttttggctggagctatgacagtcacataccccagtat-3' S334F-F:5'-ctggggtatgtgactgtgaaagctccagccaaaacacca-3' S334F-R:5'-tggtgttttggctggagctttcacagtcacataccccag-3' S334W-F:5'-ctggggtatgtgactgtccaagctccagccaaaacacc-3' S334W-R:5'-ggtgttttggctggagcttggacagtcacataccccag-3' T335I-F:5'-atactggggtatgtgacgatagaagctccagccaaaacacc-3' T335I-R:5'-ggtgttttggctggagcttctatcgtcacataccccagtat-3' Q377M-F:5'-gtctttccaaatcctccattttcatgtgaccgttggaaacctta-3' Q377M-R:5'-taaggtttccaacggtcacatgaaaatggaggatttggaaagac-3' S413M-F:5'-tggcagtagtccccaaaattccatagatacagcatttccctcc-3' S413M-R:5'-gggaggaaatgctgtatcttatggaatttggggactactgcca-3' S413V-F:5'-gtccccaaaattcaacagatacagcatttcctcctccaggat-3' S413V-R:5'-atcctggaggaggaaatgctgtatctgtgttgaatttggggac-3' E414R-F:5'-gaatggcagtagtccccaaaaacgagaagatacagcatttcctcc-3' E414R-R:5'-ggaggaaatgctgtatctctcgtttttggggactactgccattc-3' E414M-F:5'-cgaatggcagtagtccccaaacatagaagatacagcatttcctcct-3' E414M-R:5'-aggaggaaatgctgtatcttctatgttttggggactactgccattcg-3' A474C-F:5'-aggcttggtctctttgcaaatcagcttattcaagggggcagatct-3' A474C-R:5'-agactctgccccctgaataagctgatttgcaaagagaccagcct-3' K475I-F:5'-agtccaggctttggtctcaattgcaatcagcttattcaagggg-3' K475I-R:5'-ccccttgaataagctgattgcaattgagaccaagcctgact-3' S503P-F:5'-cagtgccaactgggtgaaagttcggtctgtagttagccttaaccac-3' S503P-R:5'-gtggttaaaggctaactacagaccgaactttcacccagttggcactg-3' P507R-F: 5'-catggcagcagtgccaacacggtgaaagttattctgt-3' P507R-R: 5'-acagaagtaactttcaccgtgttggcactgctgccatg-3' V551E-F:5'-cggcgtacaatgtggactctagatgtccacaaacc-3' V551E-R: 5'-ggtttgtggacatctagagtccacattgtacgccg-3' V551I-F: 5'-cggcgtacaatgtggagattagatgtccacaaacctgaaatg-3' V551I-R:5'-catttcaggtttgtggacatctaatctccacattgtacgccg-3' V551M-F:5'-gcgtacaatgtggcaattagatgtccacaaacctgaa-3' V551M-R: 5'-ttcaggtttgtggacatctaatgtccacattgtacgc-3' V551C-F: 5'-cacggcgtacaatgtggagcatagatgtccacaaacctgaaatggt-3' V551C-R: 5'-accatttcaggtttgtggacatctatgctccacattgtacgccgtg-3'

[0021] In another aspect, the present invention provides a kit comprising the glucose dehydrogenase mutant.

[0022] In summary, the present invention has at least one of the following beneficial technical effects: 1. This invention involves molecular docking of glucose dehydrogenase and glucose substrate to obtain a series of amino acid sites that may affect enzyme structure and enzyme-substrate binding. Then, virtual saturation mutations are performed on the amino acids at these sites, and molecular dynamics simulations are used to screen for mutations that may enhance enzyme stability and activity. Experiments have verified that the mutations at the above-mentioned amino acid sites have the effect of enhancing enzyme stability and activity. 2. Through experimental screening, preferred amino acid mutation sites with higher activity than wild type were obtained. The mutants obtained by single-point mutation and multi-point combination mutation of these sites have high activity and affinity, which can improve the detection sensitivity and accuracy of blood glucose. 3. Through experimental screening, preferred amino acid mutation sites with higher stability than wild type were obtained. The mutants obtained by single-point mutation and multi-point combination mutation of these sites have high thermal stability. At the same time, according to the activity experiment, they also have high activity and affinity. They can improve the detection sensitivity and accuracy of blood glucose and have higher stability, making them suitable for the preparation of reagent kits, etc. Attached Figure Description

[0023] Figure 1 Simulated molecular docking diagram of FAD-GDH and D-glucose; Figure 2 : Thermal diagram of molecular dynamics simulation of FAD-GDH binding affinity; Figure 3 : FAD-GDH stability simulation heatmap; Figure 4 : FAD-GDH stability and affinity simulation heatmap; Figure 5 Electrophoresis image of fermentation supernatant sample; Figure 6 : Purification electrophoresis detection image; Figure 7 : Graph showing the results of FAD-GDH wild-type and mutant activity assays; Figure 8 Figure: Results of activity changes in FAD-GDH wild-type and mutant after heat treatment at 50℃. Detailed Implementation

[0024] The present invention will be further described in detail below with reference to the accompanying drawings and specific embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available.

[0025] Example 1: Molecular docking, molecular dynamics simulation and virtual screening of FAD-GDH This invention uses Aspergillus flavus ( Aspergillus flavus The amino acid sequence of glucose dehydrogenase with FAD as a prosthetic group was obtained from the source, and the specific sequence is shown in Seq ID No.1. Protein sequence analysis was performed based on this sequence.

[0026] Sequence 1 was aligned to the PDB database, yielding the homologous crystal structure 4YNT with high sequence similarity. Based on this crystal structure, AlphaFold was used to obtain the complex structure of FAD prosthetic group and GDH via superposition. Further docking studies of FAD-GDH and D-glucose were conducted using AutoDock Vina. Based on the reported GDH active site, the docking box size was set to 25×25×25 cubic Å, the global search detail was 32, and the region parameters remained at default. The docking conformation with the highest score was considered the binding conformation. The binding mode of FAD-GDH and D-glucose obtained by molecular docking is shown below. Figure 1 .

[0027] Gly-95, Tyr-54, Asn-319, His-506, Arg-502, and Asn-504 are key amino acids in the active site. These amino acids interact with D-glucose through hydrogen bonds and are the main factors affecting enzyme-substrate binding. The amino acids near these amino acid sites, as well as those at key sites in the enzyme structure, also affect the binding of the enzyme to its substrate and the stability of the enzyme structure itself. The following amino acid sites were identified through analysis: Gly-53, Gly-55, Tyr-98, Trp-117, Gly-163, Pro-303, Val-310, Asp-316, Gln-317, Phe-318, Asn-320, Gly-321, Ser-334, Thr-335, Gln-377, Ser-413, Glu-414, Ala-474, Lys-475, Ser-503, Pro-507, and Val-551.

[0028] Molecular dynamics simulations of the FAD-GDH and D-glucose complex were performed using Amber. First, the charge of D-glucose was calculated, followed by force field description. Hydrogen atoms, sodium ions, and chloride ions were added to the system to balance the charge. Energy optimization was then performed, including isothermal and isobaric ensemble simulations under boundary conditions. Simulations were conducted at 298.15 K and 1 atm, with an integration step of 2 fs. Trajectories were saved every 10 ps for subsequent analysis.

[0029] The FAD-GDH and D-glucose complex was studied using the Residue Scanning Calculations module in the Schrodinger software package. The calculated affinity changes were presented in the form of a heatmap. Figure 2 Blue mutations indicate an increased affinity for FAD-GDH binding, while red mutations indicate a decreased affinity; the intensity of the color indicates the magnitude of the change. Figure 3In blue, the mutations improve the stability of FAD-GDH, while in red, they decrease it. The shade of the color indicates the magnitude of the change. Figure 4 Blue indicates that it improves the stability of FAD-GDH without decreasing substrate affinity; the shade of blue indicates the magnitude of the change.

[0030] In summary, the following mutations are identified: G53N, G55R, Y98R, W117E, G163R, P303C, V310H, D316L, Q317R, F318R, N320I, G321R, S334K, S334M, S334F, S334W, T335I, Q377M, S413M, S413V, E414R, E414M, A474C, K475I, S503P, P507R, V551E, V551I, V551M, and V551C.

[0031] Example 2: Site-directed mutagenesis and expression vector construction, transformation and expression, fermentation and purification of FAD-GDH The amino acid sequence of Seq ID No. 1 was optimized for codon usage frequency in Pichia pastoris to obtain the gene sequence Seq ID No. 2, which was then sent to a gene synthesis company for gene synthesis and inserted into the T cloning site of the pMD18-T cloning vector. The vector was named pMD18-T-GDH and used as the original vector for site-directed mutagenesis. The site-directed mutagenesis primers are shown in Table 1.

[0032] Table 1: Mutant Primers

[0033] Using mutant primers, PCR amplification was performed targeting pMD18-T-GDH to introduce the corresponding mutation. The reaction system is as follows: 35ng pMD18-T-GDH dsDNA 5 μl 10×pfu PCR buffer 4μldNTP mix 1.5 μl each of upstream and downstream primers 1 μl pfu DNA polymerase Add ddH2O to a final volume of 50 μl.

[0034] PCR program: 95℃ 1min30s → (95℃ 30s → 55℃ 1min → 72℃ 8min) × 18 cycles → incubate at 16℃.

[0035] After the PCR reaction is complete and the temperature of the reaction system drops below 37°C, add 1 μl of Dpn I enzyme and 5.73 μl of 10× buffer, and incubate at 37°C for 1 hour.

[0036] After the reaction was completed, 5 μl of the solution was used to transform DH5α competent cells, which were then plated on ampicillin-resistant LB plates and cultured overnight. Single clones were picked from the plates and sent for sequencing.

[0037] Using the correctly sequenced pMD18-T-GDH mutant vector as a template, PCR amplification was performed using the primers in Table 2 to obtain the successfully mutated GDH gene fragment. This fragment underwent homologous recombination with the pPICZαA vector, which had been double-digested with Xho I / Xba I. The fragments were plated on Zeocin-resistant low-salt LB plates and cultured overnight. Single colonies were picked from the plates and sent for sequencing. The correctly sequenced FAD-GDH mutant expression vector was extracted using a medium-volume plasmid extraction kit. After linearization with Sac I restriction enzyme, the vector was electroporated into Pichia pastoris X-33 expression strain for screening to obtain the expression strain.

[0038] Table 2: Primers for GDH gene fragment

[0039] FAD-GDH wild-type and various mutant Pichia pastoris expression strains were fermented in a 2.5L fermenter. The initial volume of BSM basal medium was 800ml, and the inoculum volume of the fermentation starter culture was 40ml. After inoculation, the culture was carried out at 30℃. The dissolved oxygen electrode was calibrated to 100%. After waiting for all parameters to stabilize, the fermentation parameters were set as follows: pH=5.0±0.1, aeration rate ≥1vvm, dissolved oxygen ≥20%, and the stirring rate was set between 250rpm and 800rpm, and kept in sync with the dissolved oxygen level.

[0040] Approximately 16-24 hours after inoculation, the glycerol in the basal culture medium was depleted, and dissolved oxygen levels surged. Continuous glycerol feeding was then initiated at a feeding rate of 16 ml / hr, and the culture was carried out for 4 hours.

[0041] After glycerol feeding was completed and the glycerol was depleted, dissolved oxygen levels surged again. The culture temperature was lowered to 28°C, and methanol induction culture was initiated with a methanol feed rate of 2.9 ml / min. After 2 hours of feeding, the methanol feed rate was increased to 5.8 ml / min, and continued for another 2 hours, then increased again to 8.6 ml / min. Feeding continued for 12 hours, increasing to 9.5 ml / min, then to 10.5 ml / min, and finally to 11.5 ml / min until fermentation ended. Electrophoresis images were collected from the fermentation supernatant after 20, 44, 68, and 92 hours of induction. Using FAD-GDH wild-type as an example, the electrophoresis images are shown below. Figure 5 .

[0042] After fermentation, the supernatant was collected by centrifugation and concentrated using a 10kD ultrafiltration membrane. The solution was then replaced with 1×PB pH 7.0 buffer and purified using BioCap Q ion chromatography packing material from Suzhou Bio-Tech Biotechnology Co., Ltd. The eluted target protein was collected and the solution was replaced with 50mM pH 6.5 potassium phosphate buffer. Taking FAD-GDH wild-type as an example, the electrophoresis results after purification are shown below. Figure 6 .

[0043] Example 3: Determination of FAD-GDH activity The present invention uses the DCIP method to determine the activity. The activity is defined as the amount of enzyme required to catalyze the reduction of 1 μmol of DCIP per minute at 37°C and pH 6.5, which is defined as 1 U.

[0044] Dilute the enzyme sample (1 mg / ml) with 50 mM pH 6.5 phosphate buffer 1500-4000 times to prepare the test sample.

[0045] Prepare reaction buffer (protect from light, prepare on ice, and use immediately): Reagent I: 50mM PIPES-NaOH buffer, pH 6.5, 1025μl Reagent II: 295 μl of 1M D-glucose solution Reagent III: 100 μl of 24 mM phenazine methyl sulfate (PMS) Reagent IV: 50 μl of 2 mM sodium 2,6-dichlorophenolindophenol (DCIP) Add 300 μl of reaction buffer to one well of a 96-well plate and incubate at 37°C for 5 min. Add 10 μl of the sample to each well, mix well, and incubate at 37°C. Measure the absorbance at 600 nm and calculate the rate of change of absorbance within 1 min. As; replace the test sample with a blank control, and follow the same steps. Measure the absorbance at 600 nm at 37°C and calculate the change in absorbance over 1 minute. Ab. The activity of the enzyme sample to be tested can be calculated using the following formula:

[0046] In the formula: S: GDH activity, expressed in GDH activity units per milliliter (U / mL). A: Changes in absorbance due to substrate consumption A= As- Ab df: Dilution factor; 16.8: The micromolar extinction coefficient (cm²) of DCIP at 600 nm under the conditions determined in this experiment. 2 / μmol); l: Optical path length, usually 1cm Different mutant activities are shown in Figure 7 (Based on wild-type activity as 100%), the results showed that the mutants of G321R, S334K, S334M, S413M, S413V and S503P had higher activity than wild-type, with the S413M mutant having the highest activity, which was 255% of that of wild-type.

[0047] It is evident that mutations in G321R, S334K, S334M, S413M, S413V, and S503P enhance activity. From a theoretical perspective, this is because the corresponding mutations alter the local structure of the protein, thereby improving the docking of the mutant enzyme with the substrate D-glucose. It can also be understood from a theoretical perspective that mutants obtained by combining the above mutations (excluding multiple mutations at the same site) also exhibit higher activity than the wild type.

[0048] Example 4: Determination of the stability of FAD-GDH Wild-type and each mutant were treated at 50°C for 15 min, 30 min, and 60 min, and then the activity was measured according to the method in Example 3 to obtain the thermal stability of wild-type and each mutant at 50°C. The results are as follows: Figure 8 As shown in the table. Although a number of mutants showed higher activity than the wild type at 15 min, only the G321R, S334K, S334M, and S413V mutants showed higher activity than the wild type throughout the entire process. Based on the wild type activity being 100%, the thermal stability (heat treatment activity) of 321R, S334K, S334M, S413V, and the wild type is shown in Table 3.

[0049] Table 3: Thermal stability of G321R, S334K, S334M, S413V and wild type

[0050] It is evident that mutations in G321R, S334K, S334M, and S413V enhance thermal stability. From a theoretical perspective, this is because the corresponding mutations alter the local structure of the protein. For example, they may introduce new hydrogen bonds into the mutated region. The interaction of these hydrogen bonds may fix the loop region, contributing to the high thermal stability of the entire protein. It is also understandable from a theoretical perspective that mutants obtained by combining the above mutations (excluding multiple mutations at the same site) also exhibit higher activity than the wild type.

[0051] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any equivalent modifications or substitutions that can be easily conceived by those skilled in the art within the scope of the technology disclosed in the present invention should be included within the scope of protection of the present invention.

[0052] sequence list Seq ID No.1 AKNTTTYDYI VVGGGTSGLV VANRLSENPD VSVLLLEAGA SVFNNPDVTN ANGYGLAFGSAIDWQYQSIN QSYAGGKQQV LRAGKALGGT STINGMAYTR AEDVQIDVWQ KLGNEGWTWK DLLPYYLKSENLTAPTSSQV AAGAAYNPAV NGKEGPLKVG WSGSLASGNL SVALNRTFQA AGVPWVEDVN GGKMRGFNIYPSTLDVDLNV REDAARAYYF PYDDRKNLHL LENTTANRLF WKNGSAEEAI ADGVEITSAD GKVTRVHAKKEVIISAGALR SPLILELSGV GNPTILKKNN ITPRVDLPTV GENLQDQFNN GMAGEGYGVL AGASTVTYPSISDVFGNETD SIVASLRSQL SDYAAATVKV SNGHMKQEDL ERLYQLQFDL IVKDKVPIAE ILFHPGGGNAVSSEFWGLLP FARGNIHISS NDPTAPAAIN PNYFMFEWDG KSQAGIAKYI RKILRSAPLN KLIAKETKPGLSEIPATAAD EKWVEWLKAN YRSNFHPVGT AAMMPRSIGG VVDNRLRVYG TSNVRVVDAS VLPFQVCGHLVSTLYAVAER ASDLIKEDAK SA Seq ID No.2 GCTAAGAATA CAACGACATA CGATTACATA GTGGTGGGAG GTGGTACGTC CGGTTTAGTGGTTGCAAATA GACTGTCTGA GAATCCTGAT GTGTCTGTTT TGCTATAGA AGCTGGAGCT TCAGTATTTAACAATCCTGA CGTCACAAC GCTAACGGTT ACGGATTAGC TTTCGGATCT GCTATTGATT GGCAGTATCAATCAATCAAC CAGTCTTACG CTGGAGGAAA GCAACAGGTT TTGAGAGCTG GTAAGGCTTT GGGTGGTACTAGTACGATTA ATGGAATGGC TTATACCCGA GCCGAAGATG TACAGATTGA TGTGTGGCAA AAACTTGGTAACGAAGGTTG GACTTGGAAG GACCTGTTAC CATATTATCT GAAGTCCGAG AACCTGACCG CCCCAACCTCTTCTCAAGTT GCTGCTGGAG CTGCTTATAA TCCTGCTGTG AATGGTAAGG AAGGTCCTCT AAAAGTTGGCTGGTCCGGCT CATTAGCTTC TGGAAATCTT TCCGTCGCTT TAAACCGAAC ATTTCAAGCA GCAGGAGTCCCCTGGTGGA GGATGTTAAC GGTGGTAAGA TGAGAGGATT TAACATTTAC CCATCCACTT TGGACGTCGACTTGAACGTC AGGGAGATG CAGCTCGTGC ATATTACTTC CCATACGATG ACAGAAAA CCTACATCTTTTGGAGAATA CTACTGCCAA CAGACTATTC TGGAAAAACG GATCAGCAGA GGAGGCTATC GCTGATGGAGTTGAGATTAC CTCCGCTGAT GGTAAGGTCA CAAGAGTCCA TGCAAAAAAAG GAAGTCATAA TTTCAGCAGGTGCACTGCGT TCTCCATTA TTCTTGAATT GTCAGGTGTT GGTAACCCTA CTATCCTGAA AAAAAATAATATTACCCCAA GAGTTGATTTACCAACAGTT GGCGAAAACT TGCAAGATCA ATTTAATAAT GGAATGGCCGGAGAGGGCTA TGGTGTTTTG GCTGGAGCTT CTACAGTCAC ATACCCCAGT ATCTCCGATG TCTTCGGTAATGAAACAGAT AGTATCGTAG CCTCTTTGCG ATCTCAATTG AGTGATTATG CTGCCGCCAC TGTTAAGGTTTCCAACGGTC ACATGAAACA GGAGGATTTG GAAAGACTTT ATCAACTGCA ATTCGACCTT ATCGTTAAGGATAAGGTACC AATCGCTGAA ATATTGTTTC ATCCTGGAGG AGGAAATGCT GTATCTTCTG AATTTTGGGGACTACTGCCA TTCGCCAGGG GTAATATTCA CATCTCATCT AATGACCCTA CTGCACCAGC TGCCATCAATCCCAACTACT TCATGTTTGA GTGGGATGGC AAATCTCAAG CTGGTATCGC CAAGTATATA AGGAAGATTCTGAGATCTGC CCCCTTGAAT AAGCTGATTG CAAAAGAGAC CAAGCCTGGA CTTTCCGAAA TTCCTGCTACCGCAGCAGAC GAAAAGTGGG TCGAGTGGTT AAAGGCTAAC TACAGAAGTA ACTTTCACCC AGTTGGCACTGCTGCCATGA TGCCAAGATC CATTGGTGGT GTCGTAGACA ATAGACTAAG AGTATATGGT ACCTCTAACGTCCGAGTTGT TGATGCCAGT GTTCTACCAT TTCAGGTTTG TGGACATCTA GTGTCCACAT TGTACGCCGTGGCTGAGAGA GCTTCCGATC TTATTAAGGA AGACGCCAAG AGTGCT

Claims

1. A glucose dehydrogenase mutant, characterized in that, The glucose dehydrogenase mutant uses flavin adenine dinucleotide as a prosthetic group. The glucose dehydrogenase mutant is based on the amino acid sequence shown in Seq ID No. 1, and the amino acid mutation is S334M.

2. A nucleic acid, characterized in that, The nucleic acid encodes the glucose dehydrogenase mutant as described in claim 1.

3. A carrier, characterized in that, The carrier includes the nucleic acid as described in claim 2.

4. A cell, characterized in that, The cell is a host cell carrying the vector as described in claim 3.

5. The cell as described in claim 4, characterized in that, The host cell is Pichia pastoris.

6. A method for preparing a glucose dehydrogenase mutant, characterized in that, Including the following steps: S1: Synthesize the FAD-GDH sequence for codon usage frequency optimization in Pichia pastoris, wherein the FAD-GDH sequence is the nucleotide sequence shown in Seq ID No.2, and insert the FAD-GDH sequence into the vector; S2: Using mutation primers, PCR amplification was performed on the vector obtained in S1 to introduce the corresponding mutation. The correctly sequenced FAD-GDH mutant expression vector was extracted and electroporated into the Pichia pastoris expression strain to obtain the expression strain. The mutation primers are the following forward and reverse primers: S334M-F: 5'-atactggggtatgtgactgtcatagctccagccaaaacaccatag-3' S334M-R: 5'-ctatggtgttttggctggagctatgacagtcacataccccagtat-3'; S3: Fermentation, collecting the fermentation supernatant, eluting and purifying.

7. A reagent kit, characterized in that, Including the glucose dehydrogenase mutant as described in claim 1.