Preparation method of isofenphos-methyl specific aptamer and prepared aptamer

Abstract

The invention discloses a preparation method of an isofenphos-methyl specific aptamer and the prepared aptamer, and belongs to the technical field of biological recognition molecules and biological sensing. The preparation method comprises the following steps: firstly, constructing an ssDNA initial library aiming at isofenphos-methyl, carrying out multiple rounds of screening on the ssDNA initial library by utilizing a GO-SELEX technology, introducing a structural analogue of isofenphos-methyl in a key round of screening, and carrying out reverse screening, so as to obtain a screened product; performing high-throughput sequencing on the obtained screening products, and screening candidate sequences through clustering analysis and free energy calculation; determining the affinity of the obtained candidate sequences, and performing molecular docking simulation on the candidate sequences with high affinity; and optimizing the candidate sequence according to a molecular docking result to determine a minimum binding unit, and finally obtaining an aptamer sequence. Meanwhile, the invention also provides the aptamer obtained according to the preparation method. According to the invention, the aptamer aiming at isofenphos-methyl is obtained for the first time, and a foundation is laid for developing a rapid detection product.

Description

Technical Field

[0001] This invention belongs to the field of biorecognition molecules and biosensing technology, and relates to a method for preparing a methyl isofenphos-specific aptamer and the prepared aptamer. Specifically, it relates to a method for screening, sequencing analysis and structural optimization of high-affinity and high-specificity nucleic acid aptamers for the highly toxic organophosphorus pesticide methyl isofenphos. Background Technology

[0002] Methyl isofenphos, a highly toxic and persistent organophosphorus pesticide, poses a serious threat to food safety and human health due to its residues in crops. Currently, its detection mainly relies on instrumental methods such as chromatography-mass spectrometry (GC-MS), which are cumbersome, require expensive equipment, and are difficult to implement for rapid on-site screening. Aptamers, single-chain oligonucleotides obtained through in vitro screening, offer advantages such as easy synthesis, good stability, and chemical modification, making them a promising candidate for building rapid detection platforms. However, to date, there are no publicly available reports on methyl isofenphos-specific aptamers, and efficient screening and performance optimization methods remain lacking. Summary of the Invention

[0003] To address the current technical problem of lacking highly specific aptamers for methyl isofenphos and effective methods for their preparation, this invention provides a method for preparing a methyl isofenphos-specific aptamer, and the aptamer obtained using this method. The specific technical solution adopted is as follows: A method for preparing a methyl isofenphos-specific aptamer involves first constructing an initial ssDNA library targeting methyl isofenphos, then performing multiple rounds of screening using GO-SELEX, and introducing structural analogs of methyl isofenphos for reverse screening in key rounds to obtain screening products; performing high-throughput sequencing on the obtained screening products, and screening candidate sequences using cluster analysis and free energy calculation; determining the affinity of the obtained candidate sequences, and performing molecular docking simulations on candidate sequences with high affinity; optimizing the candidate sequences based on the molecular docking results to determine the minimum binding unit, and finally obtaining the aptamer sequence.

[0004] Preferably, the specific steps of the method are as follows: (1) Construct an initial library targeting ssDNA; (2) The initial ssDNA library obtained in step (1) was subjected to multiple rounds of positive and negative screening using GO-SELEX technology. After each round, the ssDNA recovery rate was calculated to monitor the enrichment process until the recovery rate was continuously stable. In the 5th, 8th and 10th rounds of screening, a structural analog of methyl isofenphos was introduced for negative screening. After screening, the screening products were obtained. Each round of screening included library denaturation, target molecule incubation, GO adsorption, centrifugation, PCR amplification and secondary library preparation. (3) Perform high-throughput sequencing on the screening products obtained in step (2), and perform cluster analysis on the sequenced sequences to obtain candidate sequence families; perform secondary structure prediction and Gibbs free energy calculation on the representative sequences of the obtained candidate sequence families to finally obtain candidate sequences; (4) Verify the affinity of the candidate sequences obtained in step (3), and perform molecular docking simulation on the candidate sequences with high affinity; (5) Based on the secondary structure prediction of the candidate sequence in step (3) and the molecular docking simulation results in step (4), the candidate sequence is rationally truncated to remove the non-binding region, and the affinity and specificity of the truncated sequence as the minimum recognition unit are evaluated by the fluorescence quenching method of graphene oxide; the aptamer is determined according to the final evaluation results.

[0005] Preferably, the initial ssDNA library in step (1) has fixed primer sequences at both ends and 35 random nucleotide sequences in the middle; wherein, the 3' fixed primer sequence is: TAGGGAATTCGTCGACGGAT; and the 5' fixed primer sequence is: CGGCGCATGCGTCGACCTG.

[0006] Preferably, the structural analogues of methyl isofenphos obtained in step (2) are methyl parathion, triazophos, phorate and methamidophos.

[0007] Preferably, the positive screening process in step (2) is as follows: (1) Denature the ssDNA library at 95°C for 10 minutes, in an ice bath for 10 minutes, and equilibrate at room temperature for 10 minutes; (2) Incubate the denatured ssDNA library obtained in step (1) with methyl isofenphos solution in binding buffer for 1 hour; (3) Add graphene oxide suspension to the solution obtained in step (2), incubate at room temperature for 2 hours, and collect the supernatant after centrifugation; (4) Perform PCR amplification on the ssDNA-methyl isofenphos complex in the supernatant obtained in step (3) to obtain a secondary library; (5) Calculate the ssDNA recovery rate for each round to monitor the enrichment process until the recovery rate is continuously stable.

[0008] Preferably, the reverse screening process in step (2) is as follows: the secondary library obtained in the previous screening process is mixed with the structural analogue, incubated for 1 hour, GO is added for incubation, centrifuged and the supernatant is discarded, the GO precipitate is washed, and then methyl isofenphos dissociates the specific binding sequence for positive screening.

[0009] More preferably, the binding buffer in step (2) comprises 0.02% Tween 20, 1 mM CaCl2, 2 mM MgCl2, 5 mM KCl, 100 mM NaCl and 20 mM Tris-HCl, pH 7.6.

[0010] Preferably, the clustering analysis in step (3) is performed with 85% sequence homology as the threshold to divide the sequences into different sequence families.

[0011] Another object of the present invention is to provide an aptamer obtained by the above preparation method.

[0012] Preferably, the sequence of the aptamer is as shown in SEQ ID NO.1.

[0013] Specifically, SEQ ID NO.1 – the methyl isofenphos-specific aptamer Seq-6, has the following sequence: TAGGGAATTCGTCGACGGATCCATGGCACATGGATACTAGCGAACGCATGAGTTGGCCGCAGGTCGACGCATGCGCCG.

[0014] More preferably, the aptamer with the sequence shown in SEQ ID NO.1 has a sequence length of 78 nt, a dissociation constant of 21.70±2.53 nM, and the aptamer forms hydrogen bonds with methyl isofenphos through bases DG73 and DG75, and forms hydrophobic interactions through bases DA6, DT49, DT72 and DA48.

[0015] The specific meanings of the technical terms involved in this invention are as follows: ssDNA: Single-stranded DNA; dsDNA: Double-stranded DNA; GO: Graphene oxide; GO-SELEX technology: an evolutionary technology for exponentially enriched ligand systems in graphene oxide; PM: Methyl parathion; TZP: Triazophos; PHO: Phoxim; ICP: Ammonium methamidophos; IFP: Methyl isofenphos; Compared with the prior art, the beneficial effects obtained by the present invention are as follows: This invention marks the first successful screening and acquisition of a high-affinity aptamer for methyl isofenphos, filling a technological gap in this field. Utilizing graphene oxide-assisted phylogenetic ligand index enrichment technology, a carefully designed alternating forward and reverse screening strategy successfully enriched a population of highly specific aptamers. Combining high-throughput sequencing, bioinformatics analysis, molecular docking simulation, affinity verification, and rational truncation, a high-performance aptamer, Seq-6, was ultimately obtained, with a dissociation constant of 21.70 ± 2.53 nM, exhibiting high selectivity for methyl isofenphos. Furthermore, this aptamer demonstrates a well-defined binding mechanism and high affinity, providing a core recognition element for constructing various high-sensitivity biosensors. Attached Figure Description

[0016] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an undue limitation of the invention. In the drawings: Figure 1 Schematic diagram of aptamer screening principle, where GO represents graphene oxide.

[0017] Figure 2 Recovery rate of aptamers after 13 rounds of screening.

[0018] Figure 3 Sequence diagrams of the four candidate aptamers obtained through screening.

[0019] Figure 4 Affinity analysis diagram of the four candidate aptamers after screening.

[0020] Figure 5 The specificity analysis diagram of the optimal aptamer Seq-6, where PM is methyl parathion, TZP is triazophos, PHO is phorate, ICP is methamidophos, and IFP is methyl isofenphos. Detailed Implementation

[0021] The embodiments of the present invention will be described in detail below with reference to the accompanying drawings. However, the present invention can be implemented by various different embodiments as defined and covered by the claims.

[0022] Unless otherwise stated, the materials, reagents, instruments, and methods used in the following examples are all conventional materials, reagents, instruments, and methods in the art, and can be obtained by those skilled in the art through commercial channels.

[0023] The initial ssDNA library for methyl isofenphos used in the following examples was customized by Sangon Biotech (Shanghai) Co., Ltd., and the 3' to 5' sequence is: TAGGGAATTCGTCGACGGATCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGCAGGTCGACGCATGCGCCG, where N is a random nucleotide sequence.

[0024] The screening principle of specific aptamers for methyl isofenphos in this invention is as follows: Figure 1 As shown. From Figure 1 As can be seen, screening is divided into positive screening and reverse screening. The purpose of positive screening is to obtain sequences that can stably bind to methyl isofenphos from a large sequence library through binding, separation, elution, amplification and purification. The reverse screening, which is carried out interspersed, is to specifically screen the products obtained in the previous round, remove sequences that do not specifically bind to methyl isofenphos, and retain sequences that can only specifically bind to methyl isofenphos.

[0025] Example 1: Aptamer Screening The initial ssDNA library sequence used fixed primer sequences at both ends and a 35-nucleotide random sequence in the middle. The fixed primer sequence at the 3' end was: TAGGGAATTCGTCGACGGAT; the fixed primer sequence at the 5' end was: CGGCGCATGCGTCGACCTG. The selection buffer was a solution containing 0.02% Tween 20, 1 mM CaCl2, 2 mM MgCl2, 5 mM KCl, 100 mM NaCl, and 20 mM Tris-HCl (pH 7.6). Before each round of selection, the library was denatured at 95°C for 10 min, placed on ice for 10 min, and equilibrated at room temperature for 10 min. For the first round of positive selection: the denatured library was incubated with 1 μL of 1000 μM methyl isofenphos methanol solution in 200 μL of buffer for 1 h, then 500 μL of 2 mg / mL GO suspension was added, and the mixture was gently incubated at room temperature for 2 h. After centrifugation at 12000 rpm for 15 min, the supernatant was collected. The purified supernatant was used as a template for PCR amplification (conditions: 95°C for 5 min; 30 cycles: 95°C for 30 s, 55°C for 30 s, 72°C for 15 s; 72°C for 10 min). The PCR products were verified by 3% agarose gel electrophoresis. Biotin-labeled products were captured using streptavidin magnetic beads and eluted with NaOH to obtain a secondary ssDNA library. Reverse selection was introduced in rounds 5, 8, and 10: the secondary library was incubated with 0.25 μL of a mixture of four structural analogs (methyl parathion, triazophos, phorate, and methamidophos) at 1000 μM (total 1 μL) for 1 h. After incubation with GO, the mixture was centrifuged, the supernatant was discarded, the GO precipitate was washed, and methyl isofenphos was added to dissociate the specific binding sequence. Subsequent steps were the same as for forward selection. A total of 13 rounds of selection were performed, and the enrichment process was monitored by calculating the ssDNA recovery rate in each round. The recovery rates for the 13 rounds of selection are shown below. Figure 2 As shown, with increasing screening rounds, sequences that can bind to methyl isofenphos are gradually enriched, and the product recovery rate gradually increases. When the recovery rate no longer increases significantly, it indicates that the desired sequence enrichment is complete, and specific screening (re-screening) is required to obtain sequences that specifically bind to methyl isofenphos. When the recovery rate after re-screening also no longer changes significantly, it indicates that the screening effect tends to stabilize, and the target product is finally obtained.

[0026] Example 2 Sequencing and Candidate Sequence Analysis High-throughput sequencing was performed on the 13th round of screening products obtained in Example 1, yielding a large number of sequences. Clustering was performed using 85% homology as a threshold, resulting in 5 sequence families. Representative sequences from each family were selected for secondary structure prediction and Gibbs free energy calculation. Four sequences with lower free energies (as shown in the attached image) were selected. Figure 3 Affinity was determined (as shown in the figure).

[0027] Table 1. Four candidate sequences obtained after high-throughput sequencing, secondary structure prediction, and Gibbs free energy calculation. Serial Number specific sequence Gibbs free energy SEQ-5 TAGGGAATTCGTCGACGGATGCAGTCCGTTGGCGTGTGACCTATCGGGCGTG-AGGAGCCGCAGGTCGACGCATGCGCCG -16.58 SEQ-6 TAGGGAATTCGTCGACGGATCCATGGCACATGGATACTAGCGAACGCATGAG-TTGGCCGCAGGTCGACGCATGCGCCG -15.94 SEQ-7 TAGGGAATTCGTCGACGGATGCGGCTTGCCGAAGAGAGTCGCGAACGCGGGC-GGTGACTGCAGGTCGACGCATGCGCCG -18.19 SEQ-11 TAGGGAATTCGTCGACGGATCCATGGCACATGGGTACTAGCGAACGCATGAGC-CGGCCGCAGGTCGACGCATGCGCCG -17.62 Example 3 Affinity determination and molecular docking The affinity of the four candidate sequences shown in Table 1 was determined using a GO-based fluorescence quenching method. FAM-labeled aptamers were incubated with different concentrations of methyl isofenphos for 2 h, followed by incubation with GO for 1 h. The fluorescence intensity of the supernatant was measured after centrifugation. The dissociation constant K was calculated using nonlinear fitting. d The measurement results are as follows: Figure 4 As shown, the results indicate that Seq-6 (SEQ ID NO:1) has the highest affinity, and K d It is 21.70±2.53 nM.

[0028] Further molecular docking simulations of Seq-6 and methyl isofenphos were performed using AutoDock Vina 1.1.2 software. The simulation results showed that Seq-6 stably binds to methyl isofenphos through its specific three-dimensional structure. Bases DG73 (distance 3.07 Å) and DG75 (distance 3.12 Å) form double hydrogen bonds with the target molecule, while bases DA6, DT49, DT72, and DA48 participate in the binding through hydrophobic interactions. This binding mode explains the high affinity and specificity of Seq-6.

[0029] Example 4: Aptamer truncation and performance verification Based on docking results and secondary structure prediction, Seq-6 was rationally truncated to explore its smallest recognition unit. The affinity of the truncated form was measured using the same method, revealing a significant decrease in affinity, indicating that the intact secondary and tertiary structures of the full-length sequence are crucial for maintaining high binding capacity. Therefore, Seq-6 was determined to be the optimal aptamer. Specificity experiments were performed on Seq-6 using the same amounts and concentrations of methyl isofenphos and its structural analogs (methyl parathion, triazophos, phoxim, and methamidophos). The results are as follows: Figure 5 As shown, the Seq-6 aptamer exhibits good specificity for methyl isofenphos and its structural analogs.

[0030] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A method for preparing a methyl isofenphos specific aptamer, characterized in that, Firstly, an ssDNA initial library against methyl isophenyl phosphorothioate is constructed, and the ssDNA initial library is subjected to multiple rounds of screening by GO-SELEX technology, and a structural analog of methyl isophenyl phosphorothioate is introduced for counter-screening in key rounds of screening, and screening products are obtained; The obtained screening products are subjected to high-throughput sequencing, and candidate sequences are screened through cluster analysis and free energy calculation; the affinities of the obtained candidate sequences are determined, and molecular docking simulation is performed on the candidate sequences with high affinity; the candidate sequences are optimized according to the molecular docking results to determine the minimum binding unit, and finally the aptamer sequence is obtained.

2. The production method according to claim 1, characterized by, The specific steps are as follows: (1) Constructing an ssDNA initial library against methyl isophenyl phosphorothioate; (2) The ssDNA initial library obtained in step (1) is subjected to multiple rounds of positive screening and counter-screening by GO-SELEX technology, and the ssDNA recovery rate is calculated after each round to monitor the enrichment process until the recovery rate is stable continuously; a structural analog of methyl isophenyl phosphorothioate is introduced for counter-screening in the 5th, 8th and 10th rounds of screening, and screening products are obtained after screening; wherein, each round of screening includes library denaturation, target molecule incubation, GO adsorption, centrifugal separation, polymerase chain reaction (PCR amplification) and secondary library preparation; (3) The screening products obtained in step (2) are subjected to high-throughput sequencing, and the sequences obtained by sequencing are subjected to cluster analysis to obtain candidate sequence families; the representative sequences of the obtained candidate sequence families are subjected to secondary structure prediction and Gibbs free energy calculation, and finally the candidate sequences are obtained; (4) The candidate sequences obtained in step (3) are subjected to affinity verification, and molecular docking simulation is performed on the candidate sequences with high affinity; (5) Based on the secondary structure prediction of the candidate sequences in step (3) and the molecular docking simulation results in step (4), the candidate sequences are rationally truncated to remove non-binding regions, and the affinities and specificities of the truncated sequences as the minimum recognition unit are evaluated by the fluorescence quenching method of graphene oxide; the aptamer is determined according to the final evaluation results.

3. The preparation method according to claim 2, characterized in that, The ssDNA initial library in step (1) has fixed primer sequences at both ends and 35 random nucleotide sequences in the middle; wherein, the 3' end fixed primer sequence is: TAGGGAATTCGTCGACGGAT; and the 5' end fixed primer sequence is: CGGCGCATGCGTCGACCTG.

4. The preparation method according to claim 2, characterized in that, The structural analog of methyl isophenyl phosphorothioate obtained in step (2) is methyl parathion, triazophos, phoxim and phosmet.

5. The preparation method according to claim 2, characterized in that, The process of positive screening in step (2) is as follows: (1) Denature the ssDNA library at 95°C for 10 minutes, ice bath for 10 minutes, and room temperature equilibration for 10 minutes; (2) Incubate the denatured ssDNA library obtained in step (1) with methyl isophenyl phosphorothioate solution in the binding buffer for 1 hour; (3) Add graphene oxide suspension to the solution obtained in step (2), incubate at room temperature for 2 hours, and collect the supernatant after centrifugation; (4) Perform PCR amplification on the ssDNA-methyl isophenyl phosphorothioate complex in the supernatant obtained in step (3) to obtain a secondary library; (5) Calculate the ssDNA recovery rate of each round to monitor the enrichment process until the recovery rate is stable continuously.

6. The preparation method according to claim 2, characterized in that, The process of the counter-selection in step (2) is as follows: the secondary library obtained in the last selection process is mixed with structural analogs, incubated for 1 h, centrifuged after GO incubation to discard the supernatant, and then the GO precipitate is washed and methyl isofenphos is added to dissociate the specific binding sequence for positive selection.

7. The preparation method according to claim 5, characterized in that, The binding buffer in step (2) comprises 0.02% Tween 20, 1 mM CaCl2, 2 mM MgCl2, 5 mM KCl, 100 mM NaCl and 20 mM Tris-HCl, pH 7.

6.

8. The preparation method according to claim 2, characterized in that, The cluster analysis in step (3) is cluster analysis with 85% sequence homology as the threshold to divide the sequences into different sequence families.

9. The aptamer obtained by any of the preparation methods in claims 1-8.

10. The aptamer of claim 9, wherein, The sequence is shown as SEQ ID NO. 1.

Images