Polynucleotide molecule composition, chimeric polynucleotide molecule and mRNA vaccine for preventing feline infectious peritonitis

By using a combination of polynucleotide molecules or chimeric molecules encoding N protein and screening epitopes and a lipid nanoparticle delivery system, the problem of ADE in feline infectious peritonitis vaccines has been solved, achieving highly efficient cellular immune stimulation and protective effects, and showing good application prospects.

CN121759482APending Publication Date: 2026-03-31LUOYANG HUIZHONG BIOTECH +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-04
Publication Date
2026-03-31

AI Technical Summary

Technical Problem

Current feline infectious peritonitis vaccines use the full-length S protein antigen, which leads to antibody-dependent enhancement (ADE), failing to effectively stimulate cellular immunity and resulting in weak protective efficacy.

Method used

By combining polynucleotide molecules encoding FIPV N protein with carefully selected S protein T cell and B cell epitope peptides, and through polynucleotide molecular compositions or chimeric polynucleotide molecules, combined with a cationic lipid nanoparticle delivery system, mRNA vaccines can be prepared, avoiding the risk of ADE and stimulating potent cellular immunity.

Benefits of technology

It significantly improves the protective efficacy against feline infectious peritonitis, reaching 80% or even 100%, provides a flexible vaccine construction strategy, and can stimulate a sufficient immune response at low doses, showing good prospects for industrial application.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

The invention relates to the technical field of veterinary drugs, and particularly provides a polynucleotide molecule composition for preventing cat infectious peritonitis, a chimeric polynucleotide molecule and an mRNA vaccine. In order to overcome the ADE effect caused by S protein full-length antigen in the prior art, FIPV N protein without ADE risk is adopted and is combined with screened S protein specific T cell and B cell epitopes. Core schemes include two classes: one is a separate polynucleotide composition comprising epitope peptides encoding N and S proteins; and 2, a single chimeric polynucleotide encoding N protein and S protein epitope peptides. The polynucleotides are optimized by codons and encapsulated in lipid nanoparticles (LNP) to prepare vaccines. Experiments prove that the vaccine can synergistically stimulate powerful immune response, the survival rate of immune cats is remarkably increased to 80%-100% from standard 40% on the premise that ADE is not caused, and FIP is effectively prevented.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the field of veterinary drug technology, specifically providing a polynucleotide molecular composition, a chimeric polynucleotide molecule, and an mRNA vaccine for the prevention of feline infectious peritonitis. Background Technology

[0002] Feline coronavirus (FCoV) belongs to the family Coronaviridae in the order Nidovirales. It is an enveloped, positive-sense RNA virus with a genome of approximately 29 kb. It has methylated caps and poly(A) tails at both ends, and its overall structure is consistent with classic coronaviruses: it is surrounded by a lipid bilayer envelope interspersed with trimeric spike S proteins. The apical receptor-binding domain of the S protein recognizes feline aminopeptidase N (fAPN) and mediates membrane fusion, subsequently releasing the nucleocapsid into the cytoplasm. The nucleocapsid is composed of helically arranged N protein entangled with genomic RNA, approximately 15 nm in diameter and up to 1 μm in length. The N protein has a molecular weight of approximately 46 kDa and consists of an N-terminal RNA-binding domain and a C-terminal dimerization domain. It is synthesized in large quantities during the early stages of viral replication and persists in high abundance with progeny viral particles. In addition to S and N, the virus also encodes small membrane proteins E and M: the E protein is a transmembrane ion channel involved in budding; the M protein is a three-transmembrane structure that works with the E protein to maintain the envelope morphology and mediates viral assembly in the Golgi apparatus. FCoV circulates in cat populations via the fecal-oral route, with a positive rate of environmental antibodies in up to 90% of cats. Most strains are limited to the intestinal epithelium, causing transient or latent infections.

[0003] However, under continuous replication pressure, some strains accumulate point mutations, small fragment deletions, or insertions in enteroassociated lymphoid tissue macrophages, gradually acquiring stronger tropism for monocyte-macrophage cell lines, upregulating S protein fusion peptide activity, and altering N protein phosphorylation sites, ultimately evolving into pathogenic biotype feline infectious peritonitis virus (FIPV). Once FIPV forms, it can spread throughout the body via the bloodstream, inducing vasculitis, fibrinous serositis, and granulomatous lesions, clinically manifesting as ascites, uveitis, or neurological symptoms, with a mortality rate approaching 100%. Early vaccines attempted to induce high-titer neutralizing antibodies using the intact S protein, but antibody-dependent enhancement (ADE) occurred upon wild-type virus challenge: virus-antibody immune complexes entered macrophages via FcγR endocytosis, leading to increased replication levels and faster death in immunized cats compared to unimmunized cats. Therefore, inactivated vaccines, live attenuated vaccines, or subunit vaccines prepared from the intact S protein cannot avoid ADE and, due to the lack of endogenous antigen processing and MHC-I presentation, are unable to elicit sufficient cytotoxic T cell responses, resulting in weak protective efficacy. Thus, how to introduce conserved antigens that can fully activate cellular immunity while avoiding the high-risk domains of the full-length S protein has become a key bottleneck that FIP ​​vaccine development must overcome. Summary of the Invention

[0004] One of the objectives of this application is to provide a polynucleotide molecular composition, chimeric polynucleotide molecule and mRNA vaccine for the prevention of feline infectious peritonitis, overcoming the major technical obstacle of antibody-dependent enhancement (ADE) effect faced by the prior art based on the full-length antigen of FIPV S protein.

[0005] To achieve the above objectives, this application adopts the following technical solution;

[0006] A polynucleotide molecular composition for the prevention of feline infectious peritonitis, said polynucleotide molecular composition comprising at least two separate polynucleotide molecules:

[0007] (a) The first polynucleotide molecule encoding the complete amino acid sequence of the FIPV N protein;

[0008] (b) A second polynucleotide molecule encoding a combination peptide composed of FIPV S protein T cellular epitopes;

[0009] The T-cell epitope comprises the T-cell epitope with the amino acid sequence shown in SEQ ID NO.3-14.

[0010] Furthermore, the second polynucleotide molecule also contains a polynucleotide molecule encoding a combinatorial peptide composed of FIPV S protein B cellular epitopes;

[0011] The B-cell epitope comprises the B-cell epitope with the amino acid sequence shown in SEQ ID NO.15-19.

[0012] Furthermore, adjacent epitopes of the combined peptides are linked by linking peptides, directly linked, or not linked.

[0013] Optionally, the linker peptide sequence is (GGGGS)n, (EAAAK)n, (GPGPG)n or KK, where n is 1, 2, 3, or 4.

[0014] Optionally, the amino acid sequence encoded by the second polynucleotide molecule is as shown in SEQ ID NO. 20 or 21;

[0015] Optionally, the amino acid sequence encoded by the first polynucleotide molecule is shown in SEQ ID NO.2;

[0016] Optionally, the polynucleotide molecular composition is DNA, the DNA sequence of the second polynucleotide molecule is as shown in SEQ ID NO. 25 or 26, and the DNA sequence of the first polynucleotide molecule is as shown in SEQ ID NO. 24;

[0017] Optionally, the polynucleotide molecular composition is RNA, the RNA sequence of the second polynucleotide molecule is as shown in SEQ ID NO. 30 or 31, and the RNA sequence of the first polynucleotide molecule is as shown in SEQ ID NO. 29;

[0018] Optionally, both the first polynucleotide molecule and the second polynucleotide molecule independently include a 5'UTR, a 3'UTR, and Poly(A);

[0019] Optionally, the 5'UTR sequence is a Xenopus β-globin sequence or a 5'UTR sequence that highly expresses a feline gene, preferably a Xenopus β-globin sequence;

[0020] Optionally, the 3'UTR sequence is the 3'UTR sequence of β-globin or the 3'UTR sequence of hemoglobin HBA1, preferably the 3'UTR sequence of HBA1;

[0021] Optionally, the Poly(A) sequence consists of 60-150 adenosine nucleotides, preferably 120 adenosine nucleotides.

[0022] Furthermore, the polynucleotide molecular composition also includes a third polynucleotide molecule that encodes a combinatorial peptide composed of FIPV S protein B cellular epitopes;

[0023] Optionally, the polynucleotide molecular composition comprises: a fourth polynucleotide molecule composed of the first polynucleotide molecule and the second polynucleotide molecule, and the third polynucleotide molecule;

[0024] Optionally, the polynucleotide molecular composition comprises: a fifth polynucleotide molecule composed of the first polynucleotide molecule and the third polynucleotide molecule, and the second polynucleotide molecule;

[0025] The B-cell epitope comprises the B-cell epitope with the amino acid sequence shown in SEQ ID NO.15-19.

[0026] A chimeric polynucleotide molecule for the prevention of feline infectious peritonitis, said chimeric polynucleotide molecule containing:

[0027] (a) The first polynucleotide molecule encoding the complete amino acid sequence of the FIPV N protein;

[0028] (b) A second polynucleotide molecule encoding a combination peptide composed of FIPV S protein T cellular epitopes;

[0029] The T-cell epitope comprises the T-cell epitope with the amino acid sequence shown in SEQ ID NO.3-14;

[0030] The chimeric polynucleotide molecule is a single polynucleotide molecule that encodes a fusion protein.

[0031] Furthermore, the chimeric polynucleotide molecule also includes a polynucleotide molecule encoding a combinatorial peptide composed of FIPV S protein B cellular epitopes;

[0032] The B-cell epitope comprises the B-cell epitope with the amino acid sequence shown in SEQ ID NO.15-19.

[0033] Furthermore, adjacent epitopes of the chimeric polynucleotide molecule are linked by linking peptides, directly linked, or not linked.

[0034] Optionally, the linker peptide sequence is (GGGGS)n, (EAAAK)n, (GPGPG)n or KK, where n is 1, 2, 3, or 4.

[0035] Optionally, the amino acid sequence encoded by the chimeric polynucleotide molecule is shown in SEQ ID NO. 22 or 23;

[0036] Optionally, the chimeric polynucleotide molecule is DNA, and its sequence is shown in SEQ ID NO. 27 or 28;

[0037] Optionally, the chimeric polynucleotide molecule is RNA, and its sequence is shown in SEQ ID NO. 32 or 33;

[0038] Optionally, the chimeric polynucleotide molecule further includes a 5'UTR, a 3'UTR, and Poly(A);

[0039] Optionally, the 5'UTR sequence is a Xenopus β-globin sequence or a 5'UTR sequence that highly expresses a feline gene, preferably a Xenopus β-globin sequence;

[0040] Optionally, the 3'UTR sequence is the 3'UTR sequence of β-globin or the 3'UTR sequence of hemoglobin HBA1, preferably the 3'UTR sequence of HBA1;

[0041] Optionally, the Poly(A) sequence consists of 60-150 adenosine nucleotides, preferably 120 adenosine nucleotides.

[0042] The application of the above-mentioned polynucleotide molecular composition or chimeric polynucleotide molecule in the preparation of products for the prevention of feline infectious peritonitis.

[0043] An mRNA vaccine for the prevention of feline infectious peritonitis, said mRNA vaccine comprising the polynucleotide molecular composition or chimeric polynucleotide molecule of the present application, and cationic lipid nanoparticles;

[0044] The polynucleotide molecular composition and the chimeric polynucleotide molecule are RNA, and the RNA is encapsulated in the cationic lipid nanoparticles.

[0045] Furthermore, the components in the polynucleotide molecular composition are present in the same amount;

[0046] Optionally, each component of the polynucleotide molecular composition may be encapsulated, either individually or collectively, in the same cationic lipid nanoparticle;

[0047] Optionally, the cationic lipid nanoparticles comprise:

[0048] (a) 30%-50% ionizable cationic lipids;

[0049] (b) 20%-50% cholesterol;

[0050] (c) 10%-20% phospholipids;

[0051] (d) 1%-2% PEG-lipids;

[0052] Optionally, the ionizable cationic lipid is SM-102, DLin-MC3-DMA, or ALC-0315; the phospholipid is DSPC, DOPE, or DGTS; and the PEG-lipid is DMG-PEG2000.

[0053] Optionally, the molar ratio of each component in the cationic lipid nanoparticles is: SM-102:cholesterol:DSPC:DMG-PEG2000 = 50:38.5:10:1.5;

[0054] Optionally, the mRNA vaccine is a freeze-dried formulation or a liquid formulation;

[0055] Optionally, the single dose of the mRNA vaccine is 5-50 µg, more preferably 10 µg;

[0056] Optionally, the mRNA vaccine is administered to the cat via intramuscular or subcutaneous injection.

[0057] The application of the above-mentioned mRNA vaccine in the preparation of products for the prevention of feline infectious peritonitis.

[0058] The technical effects of this application are as follows:

[0059] 1. Fundamentally avoids ADE risk: This application creatively abandons the strategy of using the full-length S protein, which is prone to antibody-dependent enhancement (ADE), as an antigen. Instead, it uses the N protein, which does not cause ADE, and combines it with carefully selected S protein-specific T-cell and B-cell epitopes. This antigen design avoids the risk of disease aggravation due to vaccine-induced antibodies from the source, providing a safe and reliable technical path to solve the biggest challenge in FIP vaccine development.

[0060] 2. Inducing Synergistic and Highly Effective Immune Protection: Cellular immunity is crucial in the prevention and treatment of FIPV. mRNA vaccines are more effective at stimulating cellular immunity than other types of vaccines. The mRNA vaccine of this application can simultaneously express multiple antigenic epitopes of both the N and S proteins in vivo, thereby synergistically activating the body's strong cellular and humoral immunity. In particular, by tandemly expressing multiple T cell epitopes, it greatly enhances the CD8+ T cell response, which is key to controlling FIPV infection. As fully demonstrated by the animal experimental data in Example 5 and Tables 4 and 5, compared with vaccines containing only the N protein (survival rate 40%), the combined vaccine of this application can significantly improve the protective efficacy to 80% or even 100%, exhibiting excellent immune protection.

[0061] 3. Ingenious antigen design and enhanced immunogenicity: This application constructs a combination peptide containing multiple highly antigenic, non-toxic, and non-allergenic T-cell and B-cell epitopes through precise prediction and screening of S protein epitopes. These epitopes are linked together by optimized linker peptides, ensuring the effective presentation of their respective immunogenicity. Experimental results demonstrate that these screened S protein epitope peptides can significantly enhance the immunogenicity of N protein-based mRNA vaccines, producing a synergistic effect of "1+1>2".

[0062] 4. Offers flexible and diverse vaccine construction strategies: This application not only provides a single mRNA vaccine form that fuses different antigenic epitopes with the N protein for expression, but also innovatively proposes a composite form that co-delivers multiple mRNA molecules encoding different functional proteins (such as N protein and S protein epitope peptides). This flexible construction strategy provides more possibilities for vaccine optimization and personalized design, and multiple forms have been proven to have excellent protective effects.

[0063] 5. Low immunization dose and promising application prospects: The mRNA vaccine of this application adopts an advanced lipid nanoparticle (LNP) delivery system to protect the mRNA and promote its efficient delivery into cells. Experiments show that even a very low single-dose immunization dose (e.g., 10 μg) can induce sufficient protective immunity, indicating that the vaccine is highly efficient and economical, and has good prospects for industrial application and clinical promotion. Detailed Implementation

[0064] To enable those skilled in the art to better understand the technical solutions of this application, the technical solutions described in this application will be further described in detail below with reference to specific embodiments.

[0065] In this application, terms such as "further," "even further," and "particularly" are used to describe purposes and indicate differences in content, but should not be construed as limiting the scope of protection of this application.

[0066] In this application, "optionally," "optionally," and "optional" mean that something is optional, that is, it means that it is selected from either "with" or "without." If there are multiple "optional" entries in a technical solution, unless otherwise specified, and there are no contradictions or mutual constraints, each "optional" entry shall be independent.

[0067] In this application, the terms "multiple", "various", "multiple times", "multi-dimensional", etc., unless otherwise specified, refer to a quantity greater than or equal to 2. For example, "one or more" means one or more than or equal to two.

[0068] For ease of description, in this specification, "polynucleotide" and "polynucleotide molecule" have the same meaning and are used interchangeably; "nucleic acid" and "nucleic acid molecule" have the same meaning and are used interchangeably. Similarly, for specific terms derived from "polynucleotide molecule" (such as "first polynucleotide molecule"), the abbreviated form omitting the "molecule" suffix (such as "first polynucleotide") has exactly the same meaning as the full term detailed in this definition section.

[0069] "Polynucleotide molecule" refers to a polymeric form of nucleotides of any length, including ribonucleotides and / or deoxyribonucleotides. Examples of nucleic acid molecules include, but are not limited to, single-stranded, double-stranded, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers containing purine and pyrimidine bases or other naturally occurring, chemically or biochemically modified, non-natural, or derived nucleotide bases. When a nucleic acid molecule encodes a protein or polypeptide, its coding sequence can encode either the sense or antisense strand. Nucleic acid molecules can be naturally occurring, synthetic, recombinant, or any combination thereof. The terms "nucleic acid molecule," "nucleic acid," and "polynucleotide molecule" are used interchangeably.

[0070] A "polynucleotide composition" refers to a composition comprising two or more physically separate, independent polynucleotide molecules. Each polynucleotide molecule contains its own open reading frame and regulatory elements, enabling it to be independently transcribed and translated into different polypeptides or proteins. For example, a mixture comprising a first polynucleotide molecule encoding an N protein and a second polynucleotide molecule encoding an S protein epitope peptide constitutes a polynucleotide composition.

[0071] "Separate polynucleotide molecules" are the basic units that make up the aforementioned "polynucleotide molecular composition," referring to spatially separated independent polynucleotide molecules. They can be encapsulated in the same or different nanoparticles and can be co-expressed in vivo to produce a variety of discontinuous proteins.

[0072] A "chimeric polynucleotide molecule" refers to a single, continuous polynucleotide molecule obtained by linking originally independent coding sequences through genetic engineering. The open reading frame of this molecule encodes a single polypeptide chain, i.e., a fusion protein. For example, a polynucleotide molecule obtained by linking a sequence encoding an N protein with a sequence encoding an S protein epitope peptide is a chimeric polynucleotide molecule.

[0073] The terms “single polynucleotide molecule” and “chimeric polynucleotide molecule” are used interchangeably in this application, both emphasizing that the molecule is a continuous molecular entity, in contrast to “separate polynucleotide molecules”.

[0074] The term "first polynucleotide molecule" specifically refers to a polynucleotide molecule encoding the complete amino acid sequence of the nucleocapsid protein (N protein) of feline infectious peritonitis virus (FIPV). An exemplary amino acid sequence is shown in SEQ ID NO.2, and exemplary DNA and RNA sequences are shown in SEQ ID NO.24 and SEQ ID NO.29, respectively.

[0075] "Second polynucleotide molecule" specifically refers to a polynucleotide molecule encoding a combination peptide composed of T-cell and / or B-cell epitopes of the FIPV spike protein (S protein). The T-cell epitopes comprise the amino acid sequences shown in SEQ ID NO. 3-14; the B-cell epitopes comprise the amino acid sequences shown in SEQ ID NO. 15-19. Exemplary amino acid sequences of the combination peptides are shown in SEQ ID NO. 20 (T-cell epitopes only) or SEQ ID NO. 21 (T-cell and B-cell epitopes), with corresponding exemplary DNA and RNA sequences shown in SEQ ID NO. 25 / 26 and SEQ ID NO. 30 / 31, respectively.

[0076] "Third polynucleotide molecule" specifically refers to a polynucleotide molecule encoding a combinatorial peptide composed of B-cell epitopes of the FIPV S protein. The B-cell epitope contains the amino acid sequence shown in SEQ ID NO. 15-19.

[0077] The "fourth polynucleotide molecule" is a single polynucleotide molecule formed by linking the first and second polynucleotide molecules, encoding a fusion protein composed of a combination peptide of FIPV N protein and S protein T cell epitope. Its exemplary amino acid sequence is shown in SEQ ID NO. 22, and its exemplary DNA and RNA sequences are shown in SEQ ID NO. 27 and SEQ ID NO. 32, respectively.

[0078] The "fifth polynucleotide molecule" is a single polynucleotide molecule formed by linking the first and third polynucleotide molecules, which encodes a fusion protein composed of a combination peptide of FIPV N protein and S protein B cell epitope.

[0079] "Combinatorial peptide" refers to a polypeptide consisting of multiple antigenic epitopes linked together, either directly or via one or more linking peptides. For example, the S protein T cell epitope combinatorial peptide in this application is composed of epitopes shown in SEQ ID NO.3-14 linked together via linking peptides such as GGPPG.

[0080] A "linking peptide" is a short amino acid sequence used to link two adjacent protein domains or antigenic epitopes in a fusion protein or combinatorial peptide. Its function is to maintain the spatial independence and immunogenicity of each domain or epitope. Non-limiting examples of linking peptides include: (GGGGS)n (where n is 1, 2, 3, or 4), (EAAAK)n (where n is 1, 2, 3, or 4), (GPGPG)n (where n is 1, 2, 3, or 4), or KK. These linking peptides were used to construct the combinatorial peptides and fusion proteins of this application.

[0081] This application provides a polynucleotide molecular composition. The essential feature of this composition is that it comprises two or more physically separate, independent polynucleotide molecules, each possessing complete genetic information and capable of being independently transcribed and translated within the cell, thereby co-expressing multiple antigens and triggering a synergistic immune response.

[0082] In some embodiments, the polynucleotide molecular composition comprises two separate polynucleotide molecules: a first polynucleotide molecule and a second polynucleotide molecule. The first polynucleotide molecule encodes the complete nucleocapsid protein (N protein) of feline infectious peritonitis virus (FIPV), whose typical amino acid sequence is shown in SEQ ID NO. 2. For efficient expression, the first polynucleotide molecule can be optimized with feline-preferred codons, whose exemplary DNA sequence is shown in SEQ ID NO. 24, and the corresponding in vitro transcribed RNA sequence is shown in SEQ ID NO. 29. The second polynucleotide molecule encodes a combinatorial peptide composed of multiple T-cell epitopes of the FIPV spike protein (S protein). These carefully selected T-cell epitopes cover the amino acid sequences represented by SEQ ID NO. 3 to SEQ ID NO. 14. In a preferred embodiment, these epitopes are linked together by a linker peptide such as GGPPG to form a single polypeptide chain, whose exemplary amino acid sequence is shown in SEQ ID NO. 20. The exemplary DNA and RNA sequences of the second polynucleotide molecule encoding this combinatorial peptide are shown in SEQ ID NO. 25 and SEQ ID NO. 30, respectively. Once this composition is delivered into the body, the two molecules express N protein and T cell epitope combination peptide, respectively. The former provides a broad-spectrum immune basis, while the latter strongly activates cellular immune responses. The two work synergistically to build an immune defense.

[0083] Experiments showed that low levels of antibodies are beneficial for protection; the vaccine with added B-cell epitopes provided better protection than the vaccine without the S protein B-cell epitopes described in this application (which induced low levels of antibodies). Therefore, based on the aforementioned basic composition, the second polynucleotide molecule was functionally enhanced. In this embodiment, the second polynucleotide molecule not only encodes the aforementioned T-cell epitope combination peptide but also integrates a sequence encoding a combination peptide composed of B-cell epitopes of the FIPV S protein. These B-cell epitopes contain the amino acid sequences shown in SEQ ID NO. 15 to SEQ ID NO. 19. Thus, the second polynucleotide molecule encodes a more complex combination peptide that simultaneously contains both T-cell and B-cell epitopes, an exemplary amino acid sequence of which is shown in SEQ ID NO. 21. This sequence also sequentially tandemly links the epitopes using optimized linker peptides (such as GGPPG for linking T-cell epitopes and KK for linking B-cell epitopes). Exemplary DNA and RNA sequences are shown in SEQ ID NO. 26 and SEQ ID NO. 31, respectively. This design enables the second polynucleotide molecule to simultaneously guide cellular and humoral immunity, and in particular, to induce the production of appropriate concentrations of neutralizing antibodies against specific regions of the S protein, thereby providing more comprehensive and robust immune protection.

[0084] In some embodiments, this application also considers a flexible approach that configures B-cell epitopes as independent units. In this embodiment, the polynucleotide molecular composition, in addition to comprising a first polynucleotide molecule encoding an N protein and a second polynucleotide molecule encoding a T-cell epitope combination peptide, also introduces a third polynucleotide molecule. This third polynucleotide molecule specifically refers to an independent molecule encoding a combination peptide composed of FIPV S protein B-cell epitopes (SEQ ID NO. 15-19). This "three-part" architecture (coexistence of the first, second, and third polynucleotide molecules) provides extremely high modular flexibility, allowing for independent control of the dosage of different immune elements.

[0085] In some embodiments, this application also conceives of hybrid compositions that are "partially fused and partially independent." A first hybrid scheme comprises a fourth polynucleotide molecule and a third polynucleotide molecule. The fourth polynucleotide molecule is a single molecular entity formed by linking a first polynucleotide molecule (encoding the N protein) and a second polynucleotide molecule (encoding a T-cell epitope combination peptide) using genetic engineering methods, encoding an "N protein-T-cell epitope" fusion protein, with exemplary sequences shown in SEQ ID NO.22 (amino acids) and SEQ ID NO.27 / 32 (DNA / RNA). The third polynucleotide molecule independently encodes a B-cell epitope combination peptide. A second hybrid scheme comprises a fifth polynucleotide molecule and a second polynucleotide molecule. The fifth polynucleotide molecule is a single molecule formed by linking the first and third polynucleotide molecules, encoding an "N protein-B-cell epitope" fusion protein; while the second polynucleotide molecule independently encodes a T-cell epitope combination peptide. These hybrid schemes provide diverse technical pathways for the refined design of vaccines.

[0086] This application also provides a chimeric polynucleotide molecule (also known as a fusion polynucleotide molecule). Unlike the compositions described above, the core of this approach lies in integrating the coding sequences of multiple antigens into a single polynucleotide molecule, expressing a single polypeptide chain, i.e., a fusion protein, through a continuous open reading frame.

[0087] In some embodiments, a basic chimeric polynucleotide molecule fuses the sequence encoding the complete FIPV N protein (SEQ ID NO. 2) with the sequence encoding the S protein T cell epitope combination peptide (SEQ ID NO. 20) at the gene level via a suitable linker (such as (GGGGS)n) to form a single coding unit. An exemplary amino acid sequence of the resulting fusion protein is shown in SEQ ID NO. 22. Exemplary DNA and RNA forms of this sequence are shown in SEQ ID NO. 27 and SEQ ID NO. 32, respectively. This single-molecule design simplifies vaccine production and quality control and ensures the co-expression of the two antigens within the same cell.

[0088] In some embodiments, the coding sequence for B-cell epitopes is further incorporated into the basic chimeric form, constructing a chimeric polynucleotide molecule with the most comprehensive function. This molecule encodes a trifunctional fusion protein comprising a combination peptide of N protein, an S protein T-cell epitope, and an S protein B-cell epitope, the exemplary amino acid sequence of which is shown in SEQ ID NO. 23. Exemplary DNA and RNA forms of this sequence are shown in SEQ ID NO. 28 and SEQ ID NO. 33, respectively. This is one of the most antigen-integrated schemes in this application, aiming to elicit the most comprehensive immune response with a single molecule.

[0089] Each of the aforementioned polynucleotide molecular compositions or chimeric polynucleotide molecules, whether in DNA or RNA form, may contain a series of structural elements that optimize its function. This is especially true when it is in the form of an mRNA vaccine.

[0090] In some embodiments, each polynucleotide molecule preferably contains effective regulatory elements to enhance its expression. These include a 5' untranslated region (5'UTR) upstream of the coding region, such as the 5'UTR from the Xenopus β-globin gene (sequence shown in SEQ ID NO. 34), which effectively promotes translation initiation; a 3' untranslated region (3'UTR) downstream of the coding region, such as the 3'UTR from the hemoglobin HBA1 gene (sequence shown in SEQ ID NO. 35), which enhances mRNA stability; and a 3'-terminal poly(A) tail, preferably 60 to 150 adenosine nucleotides in length, more preferably about 120 adenosine nucleotides, which is crucial for mRNA nucleation, stability, and translation.

[0091] In some embodiments, antigenic epitopes can be arranged in various ways within a combination peptide encoded by second and third polynucleotide molecules or a fusion protein encoded by chimeric polynucleotide molecules. They can be directly linked end-to-end or linked by one or more linker peptides. The linker peptide is a short amino acid sequence that provides spatial flexibility, ensuring that adjacent epitopes can fold independently and be effectively recognized by the immune system. Preferred linker peptide sequences include, but are not limited to, (GGGGS)n, (EAAAK)n, (GPGPG)n, or KK, where n is 1, 2, 3, or 4. The specific choice can be based on the epitope characteristics; for example, GGPPG has been shown to be particularly suitable for linking T-cell epitopes.

[0092] In some implementations, when the polynucleotide is in RNA form, the nucleotide can be chemically modified to reduce its innate immunogenicity and improve its stability and translation efficiency. Preferred modifications include replacing uridine with pseudouridine (Ψ) or N1-methyl-pseudouridine (m1Ψ), and replacing cytidine with 5-methyl-cytidine (m5C). These modifications can significantly improve the safety and efficacy of mRNA vaccines.

[0093] In some embodiments, when the polynucleotide molecule is in RNA form, its 5' end preferably includes a cap structure to ensure efficient recognition and translation initiation by host cell ribosomes. The cap structure is a 7-methylguanosine cap structure (m7GpppN, referred to as the Cap 0 structure) or an analogue thereof. This cap structure can be introduced through co-transcription or post-transcriptional capping and is a key element for achieving high-level protein expression of mRNA molecules.

[0094] In some embodiments, to further enhance the strength and breadth of the vaccine-induced T-cell immune response, the combination peptide or fusion protein encoded by the polynucleotide molecule (particularly a second polynucleotide molecule or a chimeric polynucleotide molecule) may optionally contain a universal tag for enhancing T-cell immunity. In a preferred embodiment, this tag is a PADRE (Pan DR-Epitope) epitope. This epitope is typically located at the N-terminus of the combination peptide and linked to a subsequent antigenic epitope via a linker peptide (e.g., EAAAK), as shown in the sequences SEQ ID NO. 20 to SEQ ID NO. 23. The PADRE epitope can be effectively presented by MHC class II molecules in the vast majority of individuals, thereby potently assisting in the activation of CD4+ T cells, ultimately promoting stronger cellular and humoral immunity.

[0095] In some embodiments, the open reading frame of the polynucleotide molecule includes a termination signal at its end to terminate protein translation. Preferably, the termination signal includes not only a standard stop codon (such as UGA, UAA, or UAG) but also its downstream nucleotide sequence to ensure termination efficiency and prevent ribosome readthrough. In a preferred embodiment, the nucleotide sequence of the termination signal is UGAUGA (i.e., two consecutive UGA codons) or UGAUAAUAG. This design maximizes the accuracy and efficiency of translation termination at the predetermined position.

[0096] This application further provides an mRNA vaccine product comprising any of the above-described polynucleotide schemes.

[0097] In some embodiments, polynucleotide molecules (present in RNA form) are encapsulated in cationic lipid nanoparticles (LNPs). This LNP system not only protects mRNA from degradation by in vivo ribonucleases but also facilitates efficient mRNA entry into the cytoplasm through its unique physicochemical properties. A preferred LNP formulation comprises the following components in a molar ratio of ionizable cationic lipid:cholesterol:phospholipid:PEG-lipid = 50:38.5:10:1.5. The ionizable cationic lipid is preferably SM-102, DLin-MC3-DMA, or ALC-0315; the phospholipid is preferably 1,2-distearate-sn-glycerol-3-phosphocholine (DSPC); and the PEG-lipid is preferably DMG-PEG2000. For the polynucleotide molecular composition, the individual RNA molecules (e.g., first, second, and third RNA molecules) can be mixed in equimolar ratios and encapsulated together in the same batch of LNPs, or they can be encapsulated separately and then physically mixed.

[0098] In some embodiments, the mRNA vaccine can be formulated as a liquid preparation and stored at 2-8°C; it can also be prepared as a lyophilized preparation using various lyophilization techniques to achieve a longer shelf life at room temperature. The vaccine is administered to cats via an enteric route, preferably intramuscular or subcutaneous injection. Animal studies have shown that even at lower immunization doses, such as a single dose of 5-50 µg, more preferably 10 µg, the vaccine of this application can elicit a strong immune response and provide effective protection.

[0099] The polynucleotide molecular compositions, chimeric polynucleotide molecules, and mRNA vaccines prepared therefrom provided in this application can all be used to prepare pharmaceuticals or veterinary biological products for the prevention of feline infectious peritonitis (FIP). Immunizing cats can effectively reduce or completely prevent infection with feline infectious peritonitis virus and the fatal disease it causes.

[0100] This application also provides a method for preparing the mRNA vaccine, which mainly includes the following two core steps: in vitro transcription of mRNA and encapsulation of lipid nanoparticles (LNPs).

[0101] In vitro transcription preparation of mRNA

[0102] First, a DNA template containing the target coding sequence (e.g., a DNA sequence encoding the N protein, S-pep1, S-pep2, S-pep1-N, or S-pep2-N protein, corresponding to SEQ ID NO. 24-28, respectively) is obtained. The DNA template should contain a strong promoter upstream of the 5' end, such as the T7 promoter (SEQ ID NO. 37), and downstream of the 3' end should contain the desired 3' UTR sequence, a poly(A) sequence, and a restriction enzyme site (e.g., MluI, SEQ ID NO. 36, ACGCGT) for linearization. Subsequently, the plasmid is digested with a restriction endonuclease (e.g., Quick Cut MluI) to obtain the linearized DNA template, and restriction impurities are removed using a purification kit.

[0103] Next, an in vitro transcription kit (e.g., mMESSAGE mMACHINE) was used. TM The T7 Transcription Kit is used to transcribe purified linearized DNA templates. This reaction system provides the nucleotides needed for mRNA synthesis while simultaneously adding a capped analogue, achieving co-transcriptional capping to generate capped mRNA with a Cap 0 structure. After transcription, the template DNA is degraded using DNase I.

[0104] Finally, a purification kit (e.g., MEGAclear) was used. TM The Transcription Clean-Up Kit purifies the transcript to remove impurities such as proteins, salt ions, and residual nucleotides, obtaining high-purity target mRNA that can be encapsulated (e.g., SEQ ID NO.29-33).

[0105] Encapsulation of lipid nanoparticles (LNPs)

[0106] Microfluidic mixing technology was used for LNP encapsulation of mRNA. First, a lipid-ethanol solution was prepared: ionizable cationic lipids (such as SM-102), cholesterol, phospholipids (such as DSPC), and PEG-lipids (such as DMG-PEG2000) were dissolved in anhydrous ethanol at a molar ratio of 50:38.5:10:1.5 to make the total lipid concentration approximately 12 mM.

[0107] Next, prepare the mRNA-aqueous solution: dissolve the prepared and purified mRNA in an acidic aqueous buffer (e.g., 66 mM citrate monohydrate and 34 mM trisodium citrate dihydrate, pH approximately 3.5-4.0) to a concentration of approximately 110 ng / μL. This acidic environment facilitates the protonation of ionizable lipids, which then bind to the negatively charged mRNA.

[0108] Finally, microfluidic self-assembly was performed: one part lipid-ethanol solution and three parts mRNA-aqueous solution were injected into a microfluidic mixing device (e.g., Nanoassemblr) at a combined flow rate of 12 mL / min. The two phases of fluid mixed instantaneously within the microchannel, and the lipid spontaneously encapsulated the mRNA, forming mRNA-loaded LNPs. The resulting mixture was dialyzed with PBS buffer for 16 h to remove ethanol, yielding the prepared mRNA-encapsulated lipid nanoparticle vaccine. This formulation can be further prepared into a liquid formulation through aseptic filtration and aliquoting, or into a lyophilized formulation using freeze-drying technology.

[0109] The present application is further described below with reference to specific embodiments. The advantages and features of the present application will become clear from the description. The embodiments described are merely exemplary and do not constitute any limitation on the scope of the present application. Those skilled in the art should understand that modifications or substitutions can be made to the details and form of the technical solutions of the present application without departing from the spirit and scope of the present application, but such modifications and substitutions all fall within the protection scope of the present application.

[0110] Example 1: S protein antigen epitope prediction and screening

[0111] T-cell epitope prediction

[0112] The NetMHCpan 4.1 web server (https: / / services.healthtech.dtu.dk / services / NetMHCpan-4.1 / ) was used to predict T-cell epitopes of the FIPV-S protein. Epitopes of 9 amino acids (9-mers) in length were predicted using the default parameters. Since the FIPV S protein (SEQ ID NO.1) is highly homologous to the canine coronavirus S protein, the DLA alleles (DLA-8803401, DLA-8850101, DLA-8850801) were selected for epitope prediction when predicting the FIPV-S protein T-cell epitopes. A total of 86 T-cell epitopes with strong binding affinity were screened and further analyzed.

[0113] B-cell epitope prediction

[0114] The linear B-cell epitopes of the FIPV-S protein were predicted using the BepiPred-3.0 server (https: / / services.healthtech.dtu.dk / services / BepiPred-3.0 / ). Using the default parameters, epitopes with higher confidence (top 20%) were selected for further analysis.

[0115] Epitope toxicity, allergenicity, and antigenicity prediction

[0116] The antigenicity, allergenic potential, and toxicity of the selected epitopes were predicted using Vaxijen 2.0, AllergenFP, and ToxinPred servers, respectively. Epitopes with predicted antigenicity >0.5, non-allergenicity, and non-toxicity were selected as part of the final vaccine design. The final epitopes selected are shown in Table 1.

[0117] Table 1 Epitope Screening Results

[0118] Example 2: Identification and Confirmation of S Protein Antigen Epitope

[0119] Peripheral blood mononuclear cells (PBMCs) were extracted from the serum of test animals, added to activated IFN-γ coated plates, and incubated with PBS (negative stimulus), PMA (positive stimulus), and T cell epitope peptides listed in Table 1 for 16-24 hours. The cells were counted and statistically analyzed using an ELISPOT assay kit (Dakio). The results showed that all screened T cell epitopes could stimulate PBMCs to secrete IFN-γ in vitro.

[0120] Example 3 RNA Sequence Design

[0121] The selected T-cell epitopes were linked using GGPPG linkers (SEQ ID NO.38) to obtain pep-T. The PADRE epitope was added to the N-terminus of pep-T using EAAK linkers (SEQ ID NO.39) to obtain the S-pep1 protein. Each B-cell epitope was linked using KK linkers to obtain pep-B. pep-B was then linked to the C-terminus of the S-pep1 protein using GGPPG linkers to obtain the S-pep2 protein. The C-termini of both S-pep1 and S-pep2 sequences were linked to the N protein using (GGGGGS)4 linkers to obtain the S-pep1-N and S-pep2-N proteins, respectively. The sequence design is shown in Table 2, and all sequences are antigenic and non-allergenic. The amino acid sequences of the N protein are shown in SEQ ID NO.2, the S-pep1 protein in SEQ ID NO.20, the S-pep2 protein in SEQ ID NO.21, the S-pep1-N protein in SEQ ID NO.22, and the S-pep2-N protein in SEQ ID NO.23. Codon optimization was performed using cat-preferred codons while also considering increasing GC content; the DNA sequences are shown in SEQ ID NO.24-28, respectively.

[0122] Table 2 RNA coding region sequences

[0123] Obtaining and linearizing recombinant plasmids

[0124] The T7 promoter sequence and 5' UTR were sequentially added to the 5' end of the sequence SEQ. ID NO.24-28, and a 3' UTR, poly(A), and MluI restriction site were added to the 3' end of the sequence SEQ. ID NO.24-28. The full sequences were synthesized by Nanjing GenScript Biotech Co., Ltd., yielding plasmids PUC57-FIPV-N, pUC57-FIPV-S-pep1, pUC57-S-pep2, pUC57-FIPV-S-pep1-N, and pUC57-FIPV-S-pep2-N containing optimized codon sequences of the FIPV-N, FIPV-S-pep1, FIPV-S-pep2, FIPV-S-pep1-N, and FIPV-S-pep2-N genes. The recombinant plasmids were digested with Quick Cut MluI, and the linearized plasmids were purified using the OMEGA Cycle-pure purification kit.

[0125] In vitro transcription and purification

[0126] The linearized plasmids were co-transcribed and capped using an in vitro transcription kit (mMESSAGE mMACHINE™ T7 Transcription Kit AM1344). The transcription products were then purified using a purification kit (MEGAclear™ Transcription Clean-Up Kit) to obtain RNA1-RNA5.

[0127] Preparation of nanoparticles

[0128] Dissolve SM-102, cholesterol, DSPC, and PEG-lipid (DMG-PEG2000) in ethanol at a ratio of 50:38.5:10:1.5 to make a total concentration of 12mM and prepare a lipid-ethanol solution.

[0129] The obtained RNA1, RNA4, RNA5, RNAmix1 (RNA1 and RNA2 mixed in a 1:1 molar ratio) and RNAmix2 (RNA1 and RNA3 mixed in a 1:1 molar ratio) were dissolved in citrate buffer (66 mM citric acid monohydrate and 34 mM sodium citrate dihydrate) to prepare mRNA-citrate buffer at a concentration of 110.16 ng / μl.

[0130] One part lipid-ethanol solution and three parts mRNA-citrate buffer were injected into a Nanoassemblr microfluidic mixer at a combined flow rate of 12 mL / min. The resulting mixture was dialyzed into PBS for 16 h to remove ethanol, yielding the prepared mRNA-encapsulated liposomes.

[0131] Table 3 mRNA nanoparticles

[0132] Example 4: In vitro expression validation of LNP-RNA1, LNP-RNAmix1, LNP-RNAmix2, LNP-RNA4, and LNP-RNA5

[0133] Take 1.5 μg of each of the LNP-RNA1, LNP-RNAmix1, LNP-RNAmix2, LNP-RNA4, and LNP-RNA5 obtained in Example 3, and dilute them to 25 μl with Opti-MEM. Separately, take 3 μl of lipo2000 and dilute it to 50 μl with Opti-MEM. Then, add 25 μl of the diluted lipo2000 to each of the diluted mRNA lipid nanoparticles, mix well, and incubate at room temperature for 5 min. After incubation, add 50 μl / well of the mixture to the corresponding cell culture plate and incubate at 37°C in a 5% CO2 incubator for 24 h.

[0134] After culture, the cell plates were removed, washed once with PBS, and fixed with 80% cold acetone at 4°C for 30 min. After removing the acetone, the plates were washed three times with PBS, then blocked with QuickBlock™ immunostaining blocking solution (Beyotime) at room temperature for 15 min. Following this, 1:200 diluted positive serum was added and incubated for 1 h, followed by three washes with PBS. Then, 1:500 diluted goat anti-cat IgG FITC secondary antibody was added and incubated for 1 h, followed by three washes with PBS. The cells were then observed under a fluorescence microscope. Results showed that after 24 h of culture, both transfected 293T cells and pathogen-sensitive cells (CRFK cells) exhibited specific fluorescence under a fluorescence microscope after IFA staining, indicating that the mRNA obtained from the transcription reaction could express exogenous proteins in vitro.

[0135] Example 5: Evaluation of mRNA vaccine efficacy

[0136] cats immunized with mRNA vaccine

[0137] Six-month-old kittens were divided into six groups (n=5 per group). Venous blood samples were drawn to measure lymphocyte count and total bilirubin levels, which were within the normal range. Intramuscular immunoassay RNA nanoparticles and a PBS blank control group were also included. Primary immunization was performed on day 1 of the experiment, and booster immunization was performed on day 28. All immunization groups received the same dose of 10 μg each time. The PBS blank control group received an equal volume of PBS (pH 7.2, 0.01 M).

[0138] Preparation and challenge experiment of FIPV serum type I tissue toxin

[0139] Ascites fluid was collected from cats suspected of having FIP, centrifuged, and the supernatant was filtered through a 0.22 μM filter. The feline coronavirus N protein gene was amplified using primers F1: 5'ATGGCCACACAGGGAC3' (SEQ ID NO.40) and F2: 5'GTTCGTAACCTCATCAATCATC3' (SEQ ID NO.41). For ascites fluid containing the N protein gene, the S protein gene was amplified using primers F3: 5'ATGATAGTGTTAATATTTGCACTCCTTAG3' (SEQ ID NO.42) and F4: 5'TTAGTGAATGTGAACCTTTTCAATAG3' (SEQ ID NO.43). NCBI BLAST analysis confirmed FIPV serotype I. Lesion tissue was removed, homogenized with sterile PBS, and subjected to three freeze-thaw cycles at -80℃. After centrifugation, the supernatant was filtered and sterilized to obtain the tissue virus. Quantitative real-time PCR showed a viral load of 5.341 copies per μL of viral fluid. Dilute the tissue toxin to 10. -2Administer 1 ml of the above-mentioned immunized cat via intraperitoneal challenge. Observe the cats daily for clinical symptoms such as decreased appetite, fever (above 39.5℃), and significant weight loss. Collect jugular venous blood every 5 days for complete blood count testing. Count the lymphocytes over 30 days; the reference range is 0.8-7.0 × 10⁻⁶. 9 The reference range for total bilirubin was 2-15 μmol / L. The number of cats with lymphocytes below the reference range and the number of cats with total bilirubin above the reference range were counted. The results are shown in Tables 4 and 5.

[0140] Table 4. Protective effects of various nanoparticles on cats

[0141]

[0142] The immunization effects of each vaccine were statistically analyzed based on the results in Table 4, and the statistical results of the immunization effects are shown in Table 5.

[0143] Table 5. Statistical analysis of the protective effects of various nanoparticles on cats.

[0144] The results showed that the PBS-injected control group exhibited typical FIPV symptoms and all of them died. Other immunization groups provided varying degrees of protection. Furthermore, no more severe clinical symptoms or accelerated death were observed in any of the immunization groups compared to the PBS control group. This indirectly indicates that the vaccine did not induce a typical antibody-dependent enhancement (ADE) effect under the experimental conditions. Compared to vaccine 1, vaccines 2, 3, 4, and 5 significantly improved the survival rate of cats, reaching over 80% (4 / 5), with vaccine 3 achieving a 100% survival rate. These results demonstrate that the protective effects of mRNA vaccines encoding both S protein T-cell epitope protein and N protein, mRNA vaccines encoding both S protein T-cell and B-cell epitope fusion proteins and N protein, mRNA vaccines encoding the fusion protein of S protein T-cell epitope and N protein, and mRNA vaccines encoding the fusion protein of S protein T-cell and B-cell epitope and N protein are all superior to those of mRNA vaccines encoding N protein. The S protein epitope peptide provided in this application enhances the immunogenicity of N protein-based mRNA vaccines. The feline infectious peritonitis virus mRNA vaccine prepared in this application can protect cats from feline infectious peritonitis to a certain extent with a relatively low immunization dose.

[0145] Unless otherwise defined, all technical and scientific terms used throughout this application have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains. In case of any inconsistency, the meaning as stated in this application or derived from the content described herein shall prevail. Furthermore, the terminology used in this description is for the purpose of describing embodiments of this application only and is not intended to limit this application.

[0146] Note that the above are merely preferred embodiments and the technical principles employed in this application. Those skilled in the art will understand that this application is not limited to the specific embodiments described herein, and various obvious changes, readjustments, and substitutions can be made without departing from the scope of protection of this application. Therefore, although this application has been described in detail through the above embodiments, this application is not limited to the above embodiments. Many other equivalent embodiments may be included without departing from the technical concept of this application, all of which fall within the scope of protection of this application.

Claims

1. A polynucleotide molecule composition for preventing feline infectious peritonitis, characterized by, The polynucleotide molecule composition comprises at least two separate polynucleotide molecules as follows: (a) a first polynucleotide molecule encoding the entire amino acid sequence of FIPV N protein; (b) a second polynucleotide molecule encoding a combined peptide consisting of T cell epitopes of FIPV S protein; Wherein the T cell epitopes comprise T cell epitopes of the amino acid sequences shown in SEQ ID NO. 3-14.

2. The polynucleotide molecule composition of claim 1, wherein, The second polynucleotide molecule further comprises a polynucleotide molecule encoding a combined peptide consisting of B cell epitopes of FIPV S protein; Wherein the B cell epitopes comprise B cell epitopes of the amino acid sequences shown in SEQ ID NO. 15-19.

3. The composition of polynucleotide molecules according to claim 1 or 2, characterized in that, The adjacent epitopes of the combined peptide are connected by a connecting peptide, directly connected or not connected; Optionally, the connecting peptide sequence is (GGGGS)n, (EAAAK)n, (GPGPG)n or KK, wherein n is 1, 2, 3, 4; Optionally, the amino acid sequence encoded by the second polynucleotide molecule is shown in SEQ ID NO. 20 or 21; Optionally, the amino acid sequence encoded by the first polynucleotide molecule is shown in SEQ ID NO. 2; Optionally, the polynucleotide molecule composition is DNA, the DNA sequence of the second polynucleotide molecule is shown in SEQ ID NO. 25 or 26, and the DNA sequence of the first polynucleotide molecule is shown in SEQ ID NO. 24; Optionally, the polynucleotide molecule composition is RNA, the RNA sequence of the second polynucleotide molecule is shown in SEQ ID NO. 30 or 31, and the RNA sequence of the first polynucleotide molecule is shown in SEQ ID NO. 29; Optionally, the first polynucleotide molecule and the second polynucleotide molecule each further independently comprise 5'UTR, 3'UTR and Poly(A); Optionally, the 5'UTR sequence is a Xenopus β-globin sequence or a 5'UTR sequence of a highly expressed feline gene, preferably a Xenopus β-globin sequence; Optionally, the 3'UTR sequence is a 3'UTR sequence of β-globin or a 3'UTR sequence of hemoglobin HBA1, preferably a 3'UTR sequence of HBA1; Optionally, the Poly(A) sequence is 60-150 adenosine, preferably 120 adenosine.

4. The composition of polynucleotide molecules according to claim 1, wherein, The polynucleotide molecule composition further comprises a third polynucleotide molecule encoding a combined peptide consisting of B cell epitopes of FIPV S protein; Optionally, the polynucleotide molecule composition comprises a fourth polynucleotide molecule consisting of the first polynucleotide molecule and the second polynucleotide molecule, and the third polynucleotide molecule; Optionally, the polynucleotide molecule composition comprises a fifth polynucleotide molecule consisting of the first polynucleotide molecule and the third polynucleotide molecule, and the second polynucleotide molecule; Wherein the B cell epitopes comprise B cell epitopes of the amino acid sequences shown in SEQ ID NO. 15-19.

5. A chimeric polynucleotide molecule for preventing feline infectious peritonitis, characterized in that, The chimeric polynucleotide molecule comprises: (a) a first polynucleotide molecule encoding the entire amino acid sequence of FIPV N protein; (b) a second polynucleotide molecule encoding a combined peptide consisting of T cell epitopes of FIPV S protein; wherein the T cell epitopes comprise T cell epitopes of the amino acid sequences shown in SEQ ID NO. 3-14; The chimeric polynucleotide molecule is a single polynucleotide molecule encoding a fusion protein.

6. The chimeric polynucleotide molecule of claim 5, wherein, The chimeric polynucleotide molecule further comprises a polynucleotide molecule encoding a combined peptide consisting of B cell epitopes of FIPV S protein; wherein the B cell epitopes comprise B cell epitopes of the amino acid sequences shown in SEQ ID NO. 15-19.

7. The chimeric polynucleotide molecule of claim 5 or 6, wherein, The adjacent epitopes of the chimeric polynucleotide molecule are connected by a linker peptide, directly connected, or not connected; Optionally, the linker peptide sequence is (GGGGS)n, (EAAAK)n, (GPGPG)n or KK, wherein n is 1, 2, 3, 4; Optionally, the amino acid sequence encoded by the chimeric polynucleotide molecule is shown in SEQ ID NO. 22 or 23; Optionally, the chimeric polynucleotide molecule is DNA, and its sequence is shown in SEQ ID NO. 27 or 28; Optionally, the chimeric polynucleotide molecule is RNA, and its sequence is shown in SEQ ID NO. 32 or 33; Optionally, the chimeric polynucleotide molecule further comprises 5'UTR, 3'UTR and Poly(A); Optionally, the 5'UTR sequence is the 5'UTR sequence of the Xenopus β-globin sequence or the highly expressed cat gene, preferably the Xenopus β-globin sequence; Optionally, the 3'UTR sequence is the 3'UTR sequence of β-globin or the 3'UTR sequence of hemoglobin HBA1, preferably the 3'UTR sequence of HBA1; Optionally, the Poly(A) sequence is 60-150 adenosine, preferably 120 adenosine.

8. An mRNA vaccine for the prevention of feline infectious peritonitis, characterized in that, The mRNA vaccine comprises the polynucleotide molecule composition of any one of claims 1-4 or the chimeric polynucleotide molecule of any one of claims 5-7, and a cationic lipid nanoparticle; The polynucleotide molecule composition and the chimeric polynucleotide molecule are RNA, and the RNA is encapsulated in the cationic lipid nanoparticle.

9. The mRNA vaccine of claim 8, characterized in that, The contents of each component in the polynucleotide molecule composition are the same; Optionally, each component in the polynucleotide molecule composition is encapsulated in the same cationic lipid nanoparticle, respectively or collectively; Optionally, the cationic lipid nanoparticle comprises: (a) 30%-50% of ionizable cationic lipids; (b) 20%-50% of cholesterol; (c) 10%-20% of phospholipids; (d) 1%-2% of PEG-lipids; Optionally, the ionizable cationic lipids are SM-102, DLin-MC3-DMA or ALC-0315; the phospholipids are DSPC, DOPE or DGTS; and the PEG-lipids are DMG-PEG2000. Optionally, the molar ratio of each component in the cationic lipid nanoparticle is: SM-102: Cholesterol: DSPC: DMG-PEG2000 = 50: 38.5: 10: 1.5; Optionally, the mRNA vaccine is a lyophilized formulation or a liquid formulation; Optionally, the single dose of the mRNA vaccine is 5-50 µg, more preferably 10 µg; Optionally, the mRNA vaccine is administered to the cat by intramuscular injection or subcutaneous injection.

10. Use of the polynucleotide molecule composition of any one of claims 1 to 4 or the chimeric polynucleotide molecule of any one of claims 5 to 7 or the mRNA vaccine of claim 8 or 9 in the manufacture of a product for preventing feline infectious peritonitis.