Recombinant plasmid for preparing natural sunscreen shinorine and application thereof

By expressing the Gch.mysAB and Gch.mysCD genes of Gracilaria in recombinant plasmids of Saccharomyces cerevisiae, the synthetic pathway of shinorine was simplified, overcoming the shortcomings of natural extraction and microbial metabolic engineering, and realizing efficient and low-cost shinorine production, thus promoting its application in the fields of daily chemicals and medicine.

CN121759501BActive Publication Date: 2026-07-24YUNNAN AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2026-03-02
Publication Date
2026-07-24

Smart Images

  • Figure CN121759501B_ABST
    Figure CN121759501B_ABST
Patent Text Reader

Abstract

The present application relates to a kind of recombinant plasmid for preparing natural sunscreen shinorine and application, belong to biotechnology field.The recombinant plasmid contains Gracilaria Brevicuspis Gch.mysAB Gene and Gracilaria Brevicuspis Gch.mysCD Gene;The nucleotide sequence of the Gracilaria Brevicuspis Gch.mysAB Gene is as shown in SEQ ID NO.1;The nucleotide sequence of the Gracilaria Brevicuspis Gch.mysCD Gene is as shown in SEQ ID NO.2.The present application is more simple and efficient compared to cyanobacterial four gene path, significantly improves the synthesis efficiency of MAAs, provides stable and efficient biosynthesis scheme for the development of high value-added MAAs product.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a recombinant plasmid for preparing the natural sunscreen agent shinorine and its application. Background Technology

[0002] Mycosporine-like amino acids (MAAs) are a class of secondary metabolites from aquatic organisms. With cyclohexene imine or cyclohexene ketone as their basic framework, they possess strong ultraviolet absorption capacity (310-362nm), making them a "natural sunscreen" that is friendly to both humans and the environment. Furthermore, MAAs have been reported to have antioxidant, immunomodulatory, anti-aging, and anti-inflammatory effects. They are widely found in various aquatic organisms, with over 500 species of marine macroalgae present, and red algae having the most species (489). Cyanobacteria are likely the earliest producers of MAAs, and the MAAs synthesis gene clusters in other organisms may originate from cyanobacteria. Currently, over 30 MAAs analogues have been identified from diverse marine and terrestrial organisms, and shinorine has been used as an active ingredient in commercial skincare and cosmetic products. It is derived from *Porphyra yezoensis* (…). Porphyra umbilicalis While MAAs can be extracted from Porphyra yezoensis, the yield and cost of MAAs extraction are low, and the MAAs content is also affected by seasonal and geographical conditions due to the long growth cycle of Porphyra yezoensis. Therefore, microbial metabolic engineering strategies are needed to effectively produce MAAs identical to those found in nature.

[0003] Currently, shinorine can be efficiently produced through metabolic engineering. Recent studies have shown that introducing Bacillus punctata into Saccharomyces cerevisiae strains (…) N. punctiformeBy introducing the shinorine biosynthesis gene into a *Saccharomyces cerevisiae* strain and optimizing carbon flux to enhance the supply of S7P (a precursor for MAA biosynthesis), shinorine production was achieved in a 5-L bioreactor through fed-batch fermentation. This strategy yielded a shinorine production of 1.53 g / L, the highest reported fermentation titer to date. There are two biosynthetic pathways for MAAs: one is the intermediate 3-dehydroquinate of the shikimic acid pathway, and the other is the intermediate S7P of the pentose phosphate pathway. In the S7P biosynthesis pathway, S7P is converted to 4-deoxycodone (4-DG) through the sequential action of demethyl-4-deoxycodone synthase (DDGS) and O-methyltransferase (O-MT), a common precursor for MAAs. Subsequently, ATP-grasp ligase binds glycine to the C3 position of 4-DG to form a monosubstituted cyclohexanone-type MAAs-fungal spore-glycine (MG). Then, in the D-Ala-D-Ala ligase homolog or non-ribosomal peptide synthase (NRPS), another amino acid is coupled to the C1 position of MG to generate a disubstituted cyclohexylimine-type MAAs.

[0004] Currently, existing technologies related to MAAs mainly focus on two major directions: natural extraction and microbial metabolic engineering. Natural extraction relies on macroalgae (such as *Porphyra yezoensis*) as raw materials. Rhodophyta are the most abundant known source of MAAs, with shinorine already commercially available. However, this method faces challenges such as low yield and high cost, leading to unstable raw material supply. In terms of microbial metabolic engineering, a shinorine fermentation yield of 1.53 g / L has been achieved through genetic modification. However, this technology is still limited by the complexity of the synthetic pathway, involving multiple enzymatic reactions, and current research mainly focuses on the single product shinorine, with insufficient exploration of the synthesis of other MAAs analogs. Furthermore, although microalgae are considered ideal production hosts, domestic research mainly focuses on macroalgae, and the development of microalgal-derived MAAs remains lagging. The cross-species expression efficiency of potential gene resources such as cyanobacteria also needs optimization. At the commercial level, the antioxidant and anti-inflammatory functional activities of MAAs have not been fully elucidated, limiting their further application in daily chemicals, pharmaceuticals, and other fields. Therefore, overcoming the shortcomings of existing technologies is a pressing issue in the field of biotechnology. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of the prior art and provide a recombinant plasmid for preparing the natural sunscreen agent shinorine and its application.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows: The first aspect of this invention provides a recombinant plasmid for preparing the natural sunscreen agent shinorine, said recombinant plasmid containing Gracilaria rubra. Gch.mysAB Genes and Ropes Gch.mysCD Genes; the aforementioned *Gnaphalium affine* Gch.mysAB The nucleotide sequence of the gene is shown in SEQ ID NO.1; the described *Gracilaria* Gch.mysCD The nucleotide sequence of the gene is shown in SEQ ID NO.2.

[0007] Furthermore, the rope will be used to carry out the project. Gch.mysAB Genes, Rope Gorgon Gch.mysCD The gene was homologously recombinated with the pESC vector to obtain pESC-Gch.mysAB-mysCD Recombinant plasmid.

[0008] A second aspect of the present invention provides a transgenic engineered bacterium containing the above-mentioned recombinant plasmid, or wherein the genome of the transgenic engineered bacterium is integrated with exogenous *Gracilaria leptostroboides*. Gch.mysAB Genes and Ropes Gch.mysCD Gene.

[0009] Furthermore, the genetically engineered bacteria is the Saccharomyces cerevisiae strain BY4742.

[0010] The third aspect of the present invention provides the above-mentioned *Ligustrum lucidum*. Gch.mysAB Genes or ropes Gch.mysCD Gene.

[0011] The fourth aspect of the present invention provides the above-mentioned *Ligustrum lucidum*. Gch.mysAB Genes or ropes Gch.mysCD Genes encode proteins, including *Gnaphalium affine*. Gch.mysAB The amino acid sequence encoding the protein is shown in SEQ ID NO.3; *Gnaphalium affine* Gch.mysCD The amino acid sequence of the gene-encoded protein is shown in SEQ ID NO.4.

[0012] The fifth aspect of the present invention provides the above-mentioned *Gnaphalium affine*. Gch.mysAB Genes and Ropes Gch.mysCD Application of gene in the preparation of shinorine, a natural sunscreen.

[0013] The sixth aspect of the present invention provides a method for preparing the above-mentioned natural sunscreen agent shinorine, wherein the above-mentioned genetically engineered bacteria are fermented to obtain the natural sunscreen agent shinorine from the fermentation broth.

[0014] Furthermore, the fermentation medium used was SC-Ura liquid medium, and the fermentation temperature was 30℃.

[0015] This invention provides a gene related to MAAs synthesis in Gracilaria rubra. Gch.mysAB and Gch.mysCDCollinearity analysis was performed using JCVI software to screen homologous gene pairs and blocks, identify gene clusters, and the conserved DHQS and ATP-grasp domains were discovered through annotation in the pfam database. The *Gracilaria rubra* species described in the text... Gch.mysAB The nucleic acid sequences of the DHQS gene and the ATP-grasp gene encoded by Gch.mysCD are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively, with full lengths of 2739 bp and 2763 bp, respectively, encoding 913 and 921 amino acid residues, respectively. The sequences are shown in SEQ ID NO.3 and SEQ ID NO.4.

[0016]

[0017] In the area of ​​Shengjiangli Gch.mysAB Genes and ropes Gch.mysCD The gene was constructed on a vector and introduced into the Saccharomyces cerevisiae strain BY4742. It was fermented and grown in a medium with SC-U as the carbon source. Under the catalysis of the DHQS and ATP-grasp genes encoded by the gene, the endogenous substrate 7-phosphate sedoheptulose (S7P) of Saccharomyces cerevisiae was converted into shinorine in two steps.

[0018] This invention expresses the target protein in Saccharomyces cerevisiae using recombinant plasmids, and then directly generates shinorine by catalyzing the high accumulation of the yeast endogenous substrate 7-phosphate sedoheptulose (S7P).

[0019] The rope-like grass described in this invention Gch.mysAB Genes and Ropes Gch.mysCD The gene was obtained through comparative genomic collinearity analysis of seven species in the Gracilariaceae family, and the Gracilaria rubra gene sequence was sent to GenScript for synthesis. GenScript optimized the codons and sequence (removing repetitive and unstable structures) according to the expression host requirements, and designed the optimized sequence as overlapping short fragments (Oligos). All Oligos were synthesized in parallel using high-throughput solid-phase synthesis (e.g., microarray technology), and then assembled into a complete double-stranded gene (long gene assembly in steps) using cell-free enzymatic assembly (e.g., Gibson Assembly). The gene was cloned into the Y33 vector, transformed into E. coli, positive clones were screened and amplified, and the sequence was rigorously verified by full-length sequencing before delivery.

[0020] These two genes were synthesized using GenScript, and subsequent primers were designed for PCR amplification. The *Gracilaria* species mentioned above... Gch.mysAB Genes and Ropes Gch.mysCD The primers for gene amplification are shown below: Gch.mysAB-5'F:tcaggattgaacgttgttgacctt; (SEQ ID NO.5) Gch.mysAB-3'R: atgcacatttcactctcttctacca; (SEQ ID NO.6) Gch.mysCD-5'F: atgtactcctccgccgcta; (SEQ ID NO.7) Gch.mysCD-3'R:tcaatgtctgactctcatacctacaga. (SEQ ID NO.8) Furthermore, during homologous recombination with the vector PESC, *Gnaphalium affine*... Gch.mysAB Genes and Ropes Gch.mysCD Genes need to be amplified and recovered using primers with homologous arms. The primers with homologous arms are as follows: Gch.mysAB-TY-5'F: tcactatagggcccgggctaagatgcacatttcactctcttctaccac; (SEQ ID NO.9) Gch.mysAB-TY-3'R:cttccttttcggttagagcggattcaggattgaacgttgttgacct; (SEQ ID NO.10) Gch.mysCD-TY-5'F:ctggcgaagaattgttaattaatcaatgtctgactctcatacctacagac; (SEQ ID NO.11) Gch.mysCD-TY-3'R:tcgaattcaaccctcactaaaggatgtactcctccgccgctaga; (SEQ IDNO.12) This invention, by downloading the genomes of six species in the Gracilariaceae family and performing collinearity analysis, screened for gene clusters containing conserved DHQS and ATP-grasp domains. Furthermore, literature review revealed that *Ceratophyllum demersum* contains high levels of shinorine; therefore, *Gracilaria fasciata* (…) was selected as a candidate gene for further analysis. Gracilariopsis chorda The two genes in the sample were validated, and the pathway-related genes >rna-gnl|WGS:NBIV|mrna.BWQ96_03472 and >rna-gnl|WGS:NBIV|mrna.BWQ96_03471 were named respectively. Gch.mysAB and Gch.mysCD This provides a reference for understanding the synthesis pathway of MAAs in Gracilariaceae plants, and also brings huge economic benefits to the industrial production of MAAs.

[0021] The rope of the present invention Gch.mysAB Genes and Ropes Gch.mysCD This gene can serve as an important marker gene for molecularly assisted culture of Gracilaria plants, and also as an important candidate gene for shinorine production in yeast chassis cell construction.

[0022] This invention clarifies for the first time that only [the following is required] in *Gnaphalium affine*. Gch.mysAB and Gch.mysCD The synthesis of shinorine can be completed with just two key enzymes, which is simpler and more efficient than the four-gene pathway in cyanobacteria, indicating that single enzymes may possess bifunctional catalytic properties, significantly improving the synthesis efficiency of MAAs. This discovery fills a research gap in the synthesis mechanism of MAAs in Gracilariaceae. In terms of industrial applications, this simplified enzyme system overcomes the shortcomings of low yield and high cost of natural extraction and the complexity of microbial metabolic engineering pathways, significantly reducing production costs and enhancing the feasibility of large-scale production. Simultaneously, this technology provides a stable and efficient biosynthetic scheme for developing high-value-added MAAs products (such as sunscreens and pharmaceutical raw materials), laying an important foundation for expanding the application of MAAs in the daily chemical and pharmaceutical fields.

[0023] Compared with the prior art, the beneficial effects of this invention are as follows: (1) Locking in the core gene to overcome production bottlenecks: Existing technologies rely on complex and not fully defined gene combinations (such as the requirement of four enzymes in cyanobacteria), which limits the large-scale production of shinorine, a high-value product from Gracilaria. This invention precisely locks in and utilizes the core gene. Gch.mysAB and Gch.mysCD The dual-gene combination directly constructs the simplest and most efficient core pathway for shinorine synthesis, clearing away key obstacles for industrial production; (2) Highly efficient dual-enzyme catalysis significantly improves synthesis efficiency: Compared with the existing four-gene synthesis pathways of MAAs in cyanobacteria, Gracilaria only requires Gch.mysAB and Gch.mysCD The final product can be generated with just two enzymes. This minimalist dual-enzyme design greatly simplifies the production process and significantly shortens the synthesis cycle. (3) This invention achieves precise screening Gch.mysAB and Gch.mysCD The gene not only provides a key target for elucidating the synthesis mechanism of MAAs in Gracilariaceae, but also achieves breakthroughs in molecular breeding efficiency and the economics of industrial production, paving the way for the commercialization of high-value-added MAAs products such as sunscreens and pharmaceuticals. Attached Figure Description

[0024] Figure 1 This is a schematic diagram of the synthetic pathway of shinorine.

[0025] Figure 2 Recombinant plasmid pESC Construction diagram of Gch.mysAB-mysCD Figure 3 for pESC-Gch.mysAB-mysCD and pESC-Gch.mysAB Electrophoresis results of the recombined samples; lane marker 250 bp shows 9 bands, from top to bottom: 5000 bp, 3000 bp, 2000 bp, 1500 bp, etc. Lanes 1 to 4 in Figure A are selected recombined samples. pESC-Gch.mysAB-mysCD The four positive transformants were all 3000bp-5000bp; Figure B shows the selected recombinants, 1 to 4. pESC-Gch.mysAB Of the four transformants, lanes 1 and 4 were positive transformants, both 2500bp-3000bp, while lanes 2 and 3 were unsuccessful transformants, both 500bp.

[0026] Figure 4 The LC-MS chromatograms show the detection of intermediate product 4-DG; where A is the EIC chromatogram of the yeast cell extract used to produce intermediate product 4-DG; and B is the MS extraction chromatogram of sample H1 from sample 1. -pESC-Gch.mysAB Graph of production intermediate 4-DG; C represents H2 extracted from sample 2 by MS. -pESC-Gch.mysAB Graph showing the production of intermediate product 4-DG; Figure 5 The chromatograms show the shinorine products detected by HPLC and LCMS; where A is the HPLC chromatogram of the extract from the yeast chassis cells that produced shinorine, and G1- pESC - Gch.mysAB-mysCD To G3- pESC - Gch.mysAB-mysCD Repeat for three samples; I1- pESC B is the control; the standard of shinorine is the reference standard; B is the EIC chromatogram of the extract from yeast cells that produce shinorine; C is the shinorine standard detected by MS; D is the G1- standard detected by MS. pESC - Gch.mysAB-mysCD Chromatogram of recombinant strain metabolites. Detailed Implementation

[0027] The present invention will now be described in further detail with reference to the embodiments.

[0028] Those skilled in the art will understand that the following embodiments are for illustrative purposes only and should not be construed as limiting the scope of the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed according to techniques or conditions described in the literature in the field or according to product instructions. Materials or equipment whose manufacturers are not specified are all conventional products that can be purchased. In this invention, m / v is measured in g / mL.

[0029] Example 1

[0030] Download from https: / / www.ncbi.nlm.nih.gov / and https: / / ngdc.cncb.ac.cn / Gracilariopsis chorda, Gracilaria domingensis Genome data can be downloaded from https: / / rhodoexplorer.sb-roscoff.fr / home / Gracilaria vermiculophylla, Gracilaria caudata, Gracilaria chilensis, Gracilaria gracilis Genomic data. Collinearity analysis was performed on six downloaded Gracilaria species using JCVI v1.4.16. Homologous gene pairs and collinear blocks were screened through intergenomic collinearity analysis, identifying gene clusters. Genes within these clusters were annotated using the pfam database, revealing conserved DHQS and ATP-grasp domains. Further validation of these two genes was then conducted. First, two genes from *Gracilaria rubra* were... Gch.mysAB and Gch.mysCD The sequence was sent to GenScript for synthesis, followed by gene amplification and recovery, homologous recombination, in vivo yeast expression induction, incubation, yeast metabolite extraction, and HPLC detection. Finally, the sequence was identified. Gch.mysAB The gene can catalyze the production of 4-DG from the yeast endogenous substrate S7P. Figure 1 ),and Gch.mysCD The gene can catalyze the intermediate 4-DG to the final product shinorine. Figure 1 The steps involved in the synthesis of shinorine are as follows: (1) Synthetic gene CDS sequence Jiang Jiangli Gch.mysAB and Gch.mysCD The gene sequence was sent to GenScript for synthesis. (The text then abruptly shifts to a seemingly unrelated topic: *Ligustrum lucidum*.) Gch.mysAB The nucleotide sequence of the gene is shown in SEQ ID NO.1; Gracilaria spp. Gch.mysCD The nucleotide sequence of the gene is shown in SEQ ID NO.2. GenScript then constructed the above gene into the Y33 vector, obtaining... Y33-Gch.mysAB plasmids and Y33-Gch.mysCD plasmids; The steps of GenScript gene synthesis are as follows: Y33 vector linearization: First, the Y33 vector was linearized using FuniCut™ SalI single-enzyme digestion. The reaction system consisted of: 15 μL ddH2O, 2 μL 10×FuniCut™ Buffer, 2 μL Y33 vector, and 1 μL FuniCut™ SalI, for a total volume of 20 μL. The reaction was carried out at 37℃ for 15 min. After the reaction, the target enzyme digest was recovered using a GenStar kit. The concentration was measured, and the recovered band was labeled as linearized Y33. Finally, it was stored at -20℃ for later use.

[0031] The Y33-Gch.mysCD plasmid ligation system was constructed as follows: linearized vector Y33 1 μL, gene sequence fragment Gca.mysCD 4 μL, and Ready-to-Use Seamless Cloning Kit 5 μL, for a total volume of 10 μL. The constructed Y33-Gca.mysCD plasmid ligation system consisted of: 2 μL of linearized vector Y33, 3 μL of gene sequence fragment Gch.mysCD, and 5 μL of ready-to-use seamless cloning kit, for a total volume of 10 μL.

[0032] The connection conditions are: incubation in a metal bath at 50°C for 1 hour. The conversion method is existing technology and can be carried out according to the conversion method in (3.3).

[0033] (2) Gene amplification and recovery Using the plasmid synthesized in (1) as templates, primers without homologous arms for the two target genes were designed using the primer design software SnapGene, as follows: Gch.mysAB-5'F:tcaggattgaacgttgttgacctt; (SEQ ID NO.5) Gch.mysAB-3'R: atgcacatttcactctcttctacca; (SEQ ID NO.6) Gch.mysCD-5'F: atgtactcctccgccgcta; (SEQ ID NO.7) Gch.mysCD-3'R:tcaatgtctgactctcatacctacaga. (SEQ ID NO.8) Gene PCR amplification was then performed using DNA polymerase (phanta enzyme). The PCR reaction system consisted of: 25 μL phanta enzyme, 2 μL each of forward and reverse primers (10 μM), and templates as follows:Y33-Gch.mysAB plasmids and Y33-Gch.mysCD The plasmid was 1 μL, and ddH2O was 20 μL, for a total system of 50 μL. The PCR reaction program was 98℃ for 3 min; 98℃ for 15 s, 57℃ for 15 s, 72℃ for 3 min, for 35 cycles; 72℃ for 5 min, 12℃ for infinity. After PCR, gel electrophoresis was performed to confirm successful amplification, and the target band was then recovered. Gene digestion and recovery were performed using a GenStar kit. The recovery concentration was measured using NanoDrop 2000, and the recovered gene fragments were named 1-Gch.mysAB and 1-Gch.mysCD.

[0034] Subsequently, using 1-Gch.mysAB and 1-Gch.mysCD as templates, the two target genes were amplified with primers containing homologous arms to obtain the target gene Gch.mysAB fragment and the target gene Gch.mysCD fragment. The primers are: Upstream primer Gch.mysAB-TY-5'F: tcactatagggcccgggctaagatgcacatttcactctcttctaccac; (SEQ ID NO.9) Downstream primer Gch.mysAB-TY-3'R: cttccttttcggttagagcggattcaggattgaacgttgttgacct; (SEQ ID NO.10) Upstream primer Gch.mysCD-TY-5'F: ctggcgaagaattgttaattaatcaatgtctgactctcatacctacagac; (SEQ ID NO.11) Downstream primer Gch.mysCD-TY-3'R: tcgaattcaaccctcactaaaggatgtactcctccgccgctaga; (SEQ ID NO.12) (Note: The homologous arm is on the yeast expression vector pESC). The PCR amplification system and procedure are the same as those described above for amplification using primers without homologous arms.

[0035] (3) Construction and identification of gene recombination vectors (3.1) Vector linearization: First, the vector pESC is linearized. The specific method is as follows: Primers were designed to linearize the vector. The upstream primer was pESC-GJ-5'F: ttaattaacaattcttcgccagaggt (SEQ ID NO.13); the downstream primer was pESC-GJ-3'R: atccgctctaaccgaaaagga (SEQ ID NO.14). A total of 50 μL of phanta enzyme (25 μL), upstream and downstream primers (2 μL each, 10 μM), plasmid pESC (1 μL), and ddH2O (20 μL) were used. The PCR reaction program was 98℃ for 3 min; 98℃ for 15 s, 57℃ for 5 min, 72℃ for 3 min, 35 cycles; 72℃ for 5 min; 12℃ for infinity. After the PCR program, the target band was recovered using a GenStar kit. The concentration was determined, and the sample was named linearized pESC-GJ. Finally, it was stored at -20℃ for later use.

[0036] (3.2) Preparation of promoter fragments: The bidirectional promoter was integrated from the pESC vector using the following primers: upstream primer GAL1-5'F: tttcaaaaattcttactttttttttg (SEQ ID NO.15); downstream primer GAL10-3'F: gttttttctccttgacgttaaagtat (SEQ ID NO.16). Subsequent integration was performed using 2×Phanta Max Master Mix. The PCR reaction system consisted of: 25 μL of 2×Phanta Max Master Mix, 1.5 μL each of the upstream and downstream primers (10 μM), 1 μL of the pESC vector, and 21 μL of ddH2O, for a total of 50 μL. The PCR amplification program was: 98℃ for 3 min; 98℃ for 15 s, 57℃ for 15 s, 72℃ for 2 min, 30 cycles; 72℃ for 5 min; 12℃ for infinity. The recovered products were recovered using a GenStar kit for the target band. After recovery, the concentration was measured and labeled as bidirectional promoters GAL1-GAL10. Finally, they were stored at -20°C for later use.

[0037] (3.3) Gene recombination: The following ligation reaction was performed using the Ready-to-Use Seamless Cloning Kit: The pESC-Gch.mysAB-mysCD plasmid ligation system includes: 1 μL of linearized pESC-GJ, 1 μL of bidirectional promoter GAL1-GAL10 promoter, 1.5 μL of Gch.mysAB fragment and Gch.mysCD fragment (1.5 μL) amplified from the primers with homologous arms obtained in (2), and 5 μL of Ready-to-Use Seamless Cloning Kit, for a total volume of 10 μL; pESC-Gch.mysAB The plasmid ligation system includes: 1 μL of linearized pESC-GJ, 2 μL of the bidirectional promoter GAL1-GAL10 fragment, and the target gene amplified by the primers with homologous arms obtained in (2). Gch.mysAB Fragment (2 μL) and ready-to-use seamless cloning kit (5 μL), total volume 10 μL.

[0038] Both systems underwent homologous recombination at 50℃ for 1 hour.

[0039] For specific connection methods and conversion techniques, please refer to... Figure 2 After incubation, the ligation product was transformed into DH5α competent cells using a heat shock method. Specifically, 10 μL of the ligation product from two tubes was transformed into 50 μL of DH5α competent cells, incubated on ice for 30 min, heat-shocked at 42℃ for 45 s, incubated on ice for 2 min, and then 200 μL of LB liquid medium was added. The cells were then cultured at 37℃ and 220 rpm for 1 h on a shaker. Subsequently, the cells were centrifuged (12000 rpm, 1 min) to remove 150 μL of supernatant, and the cells were resuspended. 100 μL of each supernatant was plated onto LB solid medium containing 100 mg / mL ampicillin. pESC-Gch.mysAB-mysCD The plasmid was numbered F and the plate was constructed. pESC- Gch.mysAB The plasmid was numbered E and cultured overnight at 37°C. The composition of the culture medium used in this experiment is detailed in Table 1.

[0040] Table 1

[0041] (3.3) Bacterial water detection: On a clean bench, four single colonies were randomly selected from plates F and E, which were incubated overnight as described in (3.3). These colonies were then transferred to eight-tube sets containing 20 μL of sterile ddH2O and numbered F1-F5 and E1-E4, respectively. After resuspending the colonies, 3 μL of each set was used as the PCR template. The PCR reaction system used was the 2×Taq Master Mix enzyme reaction system from Nanjing Novizan Biotechnology Co., Ltd., specifically prepared as follows: 12.5 μL of 2×Taq MasterMix, 1 μL (10 μM) each of upstream and downstream detection primers, 2 μL of template bacterial solution, and 8.5 μL of sterile ddH2O, for a total volume of 20 μL. The sequences of the upstream and downstream detection primers used are as follows: Upstream detection primer pESC-JC-F: cctgacctacaggaaagagttactca; (SEQ ID NO.17) Downstream detection primer pESC-JC-R: aagcaaggttttcagtataatgttac. (SEQ ID NO.18) The PCR amplification program was set to 98℃ pre-denaturation for 3 min, followed by 35 cycles of amplification (98℃ denaturation for 15 s, 57℃ annealing for 15 s, 72℃ extension for 3 min), and a final extension at 72℃ for 5 min, and then stored at 12℃. After the reaction program was completed, the length of the PCR products was determined using 1% agarose gel.

[0042] Depend on Figure 3 The electrophoresis results show that Figure 3 In Figure A, the PCR products of the five single colonies F1-F5 were all between 3000bp and 5000bp in length, indicating successful recombination and sequencing readiness. In Figure B, the PCR products of E1 and E4 (E1-E4) were between 2000bp and 3000bp in length, indicating successful recombination and sequencing readiness. The remaining PCR stock solutions of E1-E4, F1, and F4 were sent for sequencing, and the corresponding positive single clones (the remaining 17μL of bacterial culture) were inoculated into 6mL of LB broth containing 100mg / mL ampicillin and cultured overnight at 37℃ and 220rpm with shaking.

[0043] (4) Extraction of recombinant plasmids After successful sequencing of cells E1-E4 and F1-F4, 1 mL of the overnight culture was taken and mixed with an equal volume of 50% (v / v) glycerol solution at a 1:1 volume ratio for preservation. Subsequently, plasmids were extracted according to the instructions of the plasmid DNA miniaturization kit (GenStar, Shenzhen, China). The recovered plasmid DNA concentration was determined using a NanoDrop 2000 and the cells were numbered F1-E4. pESC-Gch.mysAB-mysCD F2-pESC-Gch.mysAB-mysCD F3- pESC-Gch.mysAB-mysCD F4- pESC-Gch.mysAB-mysCD E1- pESC-Gch.mysA B, E4- pESC-Gch.mysAB Finally, store it in a -20℃ refrigerator for later use.

[0044] (5) Preparation of competent cells and transformation of yeast strain BY4742 (5.1) Prepare a YPD solid plate and streak the Saccharomyces cerevisiae strain BY4742 onto the plate. Incubate at 30℃ for 24-48 hours. After colonies have grown, pick a single colony and inoculate it into 3 mL of YPD liquid medium. Incubate overnight at 220 rpm in a 30℃ constant temperature shaking incubator for 24-48 hours to obtain the BY4742 yeast culture. The cultured culture can be used for subsequent experiments.

[0045] (5.2) Take 3 mL of the overnight cultured BY4742 yeast culture and inoculate it into 30 mL of YPD liquid culture medium. Place it in a 30℃ constant temperature shaking incubator and culture at 220 rpm until OD600 = 0.8~1 to obtain the culture medium.

[0046] (5.3) Collect the culture medium into a 50 mL centrifuge tube, centrifuge at 6000 rpm for 5 min, remove the supernatant, and collect the bacterial cells.

[0047] (5.4) Wash the bacterial cells with 30 mL of sterile deionized water, centrifuge at 6000 rpm for 5 min, remove the supernatant and collect the bacterial cells; repeat the washing twice.

[0048] (5.5) Add 1 mL of sterile deionized water to resuspend the bacteria, then transfer to a 1 mL sterile centrifuge tube, centrifuge at 12000 rpm for 1 min, and remove the supernatant.

[0049] (5.6) Add 900 μL of sterile deionized water and 100 μL of 1 mM LiAc to the 1 mL centrifuge tube in (5.5) to resuspend the bacteria. Aliquot the bacteria into 1.5 mL centrifuge tubes, 100 μL per tube, and divide into 3 tubes. Centrifuge for 30 seconds on your hand and remove the supernatant. The obtained yeast cells are yeast competent cells and used for yeast transformation. (5.7) Resuspend the competent yeast cells in a 1.5 mL centrifuge tube containing the mixture and gently pipette to mix. The mixture was prepared according to Table 1, and all components were the same except for the added DNA. The DNA was prepared using F1- pESC-Gch.mysAB-mysCD plasmid, E1- pESC-Gch.mysAB Plasmids, pESC empty vector plasmids; Table 2

[0050] Based on the difference in the DNA added: Adding F1- pESC-Gch.mysAB-mysCD The plasmid mixture was named G tube; E1- was added. ​ The mixture of plasmids was named tube H; the mixture containing pESC (without foreign gene insertion) empty vector plasmid was named tube I.

[0051] (5.8) After mixing (5.7), the centrifuge tubes were placed in a constant temperature incubator at 30℃ for 20 min.

[0052] (5.9) After static incubation, heat shock at 42℃ for 40 min.

[0053] (5.10) Centrifuge at 12000 rpm for 1 min, remove the supernatant, add 200 μL of sterile deionized water to resuspend the yeast cells, and take 150 μL of yeast cells to spread on SC-Ura solid medium [the plates are named G plate, H plate and I plate respectively, corresponding to the tube number in step (5.7) above], and place them in a 30℃ constant temperature incubator for inverted culture for 2-3 days.

[0054] (6) Extraction of single-colony genome of Saccharomyces cerevisiae (6.1) Pick 4 single yeast colonies from each of the G, H, and I plates, with the G plate corresponding to F1- ​ ​ Plasmid (4 single colonies labeled G1-) ​ G2- ​ ​ G3- ​ G4- ​ ), the numbered H board corresponds to E1- ​ ​ Plasmid (4 single colonies labeled H1-) ​ H2- ​ H3- ​ ​ H4- ​ The empty vector pESC was corresponding to plate I (four single colonies were labeled I1-pESC, I2-pESC, I3-pESC, and I4-pESC). These colonies were inoculated into 3 mL of SC-Ura liquid medium and then incubated in a 30°C constant temperature shaking incubator at 220 rpm for 24-48 h. The colonies were then used for subsequent (6.2) extraction of yeast genome and single colony PCR verification.

[0055] (6.2) Take 200 μL of the turbid bacterial solution obtained in (6.1) into a 1.5 mL centrifuge tube, centrifuge at 12000 rpm for 1 min, remove the supernatant, and retain the bacterial cells for subsequent (6.3) yeast genome extraction.

[0056] (6.3) Add 150 μL of cell lysis buffer containing 200 mM lithium acetate and 1% (m / v) SDS to the cells, mix well, and incubate at 70 °C for 10 min.

[0057] (6.4) After incubation, add 300 μL of anhydrous ethanol and mix well. At this time, white flocculent matter will appear. Then centrifuge at 12000 rpm for 1 min and remove the supernatant.

[0058] (6.5) Add 300 μL of 70% (v / v) anhydrous ethanol and mix well. Resuspend the precipitate, centrifuge at 12000 rpm for 1 min, and aspirate the supernatant with a pipette tip.

[0059] (6.6) Place the centrifuge tube in a 65°C metal bath to dry the remaining 70% anhydrous ethanol, add 20 μL ddH2O and mix gently, then centrifuge at 12000 rpm for 1 min.

[0060] (6.7) Take 2 μL of the supernatant as a template for single-colony yeast genome PCR verification.

[0061] (7) Single colony PCR verification To determine whether the transformed DNA plasmid was successfully transformed into yeast, the single-colony yeast genome extracted in step (6.7) was used for PCR verification. The reaction system for single-colony yeast genome PCR verification is shown in Table 3 (where the primer sequences are the upstream and downstream detection primers used in step (3.3) for bacterial water verification). The reaction procedure is shown in Table 4. After the PCR reaction was completed, the PCR product was further detected and verified by agarose gel electrophoresis to identify positive single colonies.

[0062] Table 3

[0063] Table 4

[0064] (8) Yeast-induced expression Select the yeast single colony suspensions that were positive for PCR verification in step (7) above (3 positive single colony suspensions were picked from each of E plate, F plate and G plate), take 1 mL of the suspension and inoculate it into 50 mL of SC-Ura liquid medium and culture it at 30℃ and 220 rpm for 5 days; then transfer the culture medium to a 50 mL centrifuge tube, centrifuge at 3900 rpm for 10 min to collect the cells, remove the supernatant, add 5 mL of deionized water, sonicate for 30 min, add 5 mL of chloroform, sonicate for another 30 min, and let stand overnight; take the supernatant for testing the next day.

[0065] The HPLC gradient elution program is shown in Table 5, using an INERTSUSTAIN AQ-C18 column (250 mm × 4.6 mm, 5 μm). The gradient elution was linear. The column temperature was 25 °C, the flow rate was 0.6 mL / min, the injection volume was 10 μL, ESI was in positive ion mode, and UV was 330 nm.

[0066] Table 5

[0067] (9) Detection of yeast products by HPLC and LC-MS To verify the origin of *Gnaphalium affine* ​ The gene was cloned into an expression vector and transformed into Saccharomyces cerevisiae BY4742 for heterologous expression. After 5 days of shaking culture following the above steps (8), two independent transformants (H1) were expressed separately. - ​ and H2- ​ - ​ ) and empty vector control (I1- ​ The fermentation products were extracted and analyzed by LC-MS. The results showed that a distinct characteristic peak was detected in both transformants at a retention time of 8.8 min, while no such peak was observed in the control group. ​ A). Mass spectrometry analysis showed that H1 ​ and H2- ​ - ​ The substances produced by the transformant have [M+H]+ ions of 189.0763 and 189.0755, respectively. ​ B- ​ C), which is basically consistent with the theoretical molecular weight of 4-DG ([M+H]+=189.0757). The above data confirms that ​ The gene can effectively catalyze the generation of 4-DG in the Saccharomyces cerevisiae system.

[0068] To explore ​ This study constructed a pathway to investigate the function of MAAs in the synthetic route. ​ ​ The recombinant vector was transformed into *Saccharomyces cerevisiae* BY4742 for co-expression. After culturing for 5 days following step (8), three independent transformants (G1-...) were... ​ - ​ G2- ​ - ​ and G3- ​ - ​ ) and empty vector control (I1- ​ The fermentation products of shinorine were analyzed by HPLC. The results showed that all transformants exhibited a chromatographic peak at a retention time of 7.35 min, consistent with the shinorine standard, while the control group did not show this characteristic peak.​ A). Further LC-MS analysis revealed that G1- ​ - ​ The extract of the transformant and the shinorine standard both showed obvious characteristic peaks at the same retention time. ​ B). Mass spectrometry data indicate that G1- ​ - ​ The [M+H]+ concentration of the transformant product was 333.06, which is basically consistent with the [M+H]+ concentration (333.08) of the shinorine standard. ​ C- ​ D). These results confirm that in the synthesis pathway of Gracilaria MAAs, S7P is first involved via... ​ Catalytically generated 4-DG, which is then... ​ Further catalytic conversion to the final product shinorine ( ​ ) The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the present invention as claimed. The scope of protection of this invention is defined by the appended claims and their equivalents.

Claims

1. A recombinant plasmid for preparing the natural sunscreen agent shinorine, characterized in that, The recombinant plasmid contains Gracilaria. Gch.mysAB Genes and Ropes Gch.mysCD Genes; the aforementioned *Gnaphalium affine* Gch.mysAB The nucleotide sequence of the gene is shown in SEQ ID NO.1; the described *Gracilaria* Gch.mysCD The nucleotide sequence of the gene is shown in SEQ ID NO.

2.

2. The recombinant plasmid for preparing the natural sunscreen agent shinorine according to claim 1, characterized in that, Jiang Jiangli Gch.mysAB Genes, Rope Gorgon Gch.mysCD The gene was homologously recombinated with the pESC vector to obtain pESC-Gch.mysAB- mysCD Recombinant plasmid.

3. A transgenic engineered bacterium containing the recombinant plasmid of claim 2, or wherein the genome of the transgenic engineered bacterium is integrated with exogenous Gracilaria as described in claim 1. Gch.mysAB Genes and Ropes Gch.mysCD Gene.

4. The genetically engineered bacteria according to claim 3, characterized in that, The genetically engineered bacteria is Saccharomyces cerevisiae strain BY4742.

5. The *Ligustrum lucidum* as described in claim 1 Gch.mysAB Genes and Ropes Gch.mysCD Application of genes in the preparation of the natural sunscreen shinorine.

6. A method for preparing shinorine, a natural sunscreen agent, characterized in that, The genetically engineered bacteria as described in any one of claims 3 to 4 are fermented to obtain the natural sunscreen agent shinorine from the fermentation broth.

7. The method for preparing the natural sunscreen agent shinorine according to claim 6, characterized in that, The fermentation medium used was SC-Ura liquid medium, and the fermentation temperature was 30℃.