Antibiotic resistance gene detection method and device based on 3D printing tube and TCPE hydrogel
By combining the chain displacement reaction and fluorescence signal amplification technology of 3D printed tubes with TCPE hydrogels, the stability and accuracy problems of antibiotic resistance gene detection in complex environmental samples were solved, achieving efficient and low-cost ARGs detection.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-05
- Publication Date
- 2026-03-31
AI Technical Summary
Existing technologies for detecting antibiotic resistance genes (ARGs) in complex environmental samples suffer from biased results and reduced efficiency, especially due to interference from complex matrices that inhibit enzyme activity and mask signals.
By combining 3D-printed tubes with TCPE hydrogels, a highly sensitive method for detecting antibiotic resistance genes (ARGs) is constructed through chain displacement reaction and fluorescence signal amplification. The aggregation-induced emission properties of TCPE hydrogels and the structural design of 3D-printed tubes enable efficient extraction and signal amplification of ARGs.
It achieves highly sensitive and selective detection of ARGs in samples from complex environments, improves the stability and accuracy of detection, simplifies the operation process, and reduces costs.
Smart Images

Figure CN121759575A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of gene detection, specifically involving a strategy that combines 3D printed tubes with DNA hydrogels based on aggregation-induced emission materials (TCPE), and utilizes liquid-phase single-drop microextraction technology to achieve highly sensitive detection of various types of antibiotic resistance genes (ARGs). Background Technology
[0002] Antibiotics are widely used in medicine, agriculture, and animal husbandry, which can induce the production of antibiotic resistance genes. Antibiotic-resistant genes (ARGs) can confer antibiotic resistance in bacteria and spread among bacterial populations through horizontal gene transfer-dissemination mechanisms, thereby promoting the proliferation of antibiotic-resistant bacteria. This phenomenon poses a serious threat to humans and the biological environment, causing a global public health problem. Therefore, effective detection of ARGs is particularly important.
[0003] Currently, a series of technologies have been developed for ARGs detection, such as polymerase chain reaction (PCR), metagenomics, electrochemical sensors, and fluorescence sensors. These technologies can obtain specific gene sequences and quantify gene abundance, exhibiting specificity and high sensitivity. However, due to the complexity and variability of environmental samples, their application efficiency is significantly reduced when dealing with actual environmental samples (such as wastewater, river water, and soil leachate). The complex matrix interference commonly found in these samples—including but not limited to humic acid, suspended particles, heavy metal ions, high salinity, and a large number of non-target microorganisms and nucleic acids—severely inhibits the activity of detection enzymes, masks specific signals, and produces non-specific adsorption, leading to serious deviations in the detection results.
[0004] Hydrogels, with their unique three-dimensional network structure and customizable physicochemical properties, have become one of the ideal media for extracting and enriching antibiotic resistance genes (ARGs) in the environment. Their excellent hydrophilicity ensures full compatibility with water samples and rapid mass transfer; their outstanding biocompatibility provides a mild environment for maintaining the integrity of nucleic acid molecules, effectively avoiding the risk of degradation during extraction; and their highly tunable pore size and abundant surface functional groups facilitate the efficient capture and concentration of trace amounts of ARGs through physical adsorption, electrostatic interactions, and other mechanisms. More importantly, hydrogels serve as a powerful platform for conveniently loading various functional nanomaterials or fluorescent reporter molecules. Summary of the Invention
[0005] Technical Problem Solved: By combining 3D printing technology, aggregation-induced emission materials, microextraction technology, and nucleic acid amplification strategies, a method and device for detecting antibiotic resistance genes (ARGs) based on 3D-printed tubes and TCPE hydrogels were constructed. This platform can directly extract ARGs from environmental samples through simple filtration, and features high speed, low cost, and simple operation. It effectively solves the drawback of traditional single-drop microextraction technology, where the instability of a single drop often affects experimental results, improving the hydrogel extraction efficiency and the stability and accuracy of the extraction process, enabling highly sensitive detection of the target analyte.
[0006] Technical Solution: A method for detecting antibiotic resistance genes based on a 3D-printed tube and TCPE hydrogel, comprising the following steps: S1. Preparing a DNA hydrogel loaded with aggregation-induced emission material and nucleic acid chains; S2. Placing the DNA hydrogel in a 3D-printed tube to form a liquid-phase microextraction unit; S3. Contacting the test sample containing the target antibiotic resistance gene with the liquid-phase microextraction unit, causing the target antibiotic resistance gene to generate output DNA through a chain displacement reaction; S4. The output DNA enters the 3D-printed tube and reacts with the nucleic acid chains in the DNA hydrogel, causing the hydrogel to shrink microscopically, resulting in the aggregation-induced emission material aggregating and generating a fluorescence signal; S5. Quantifying the target antibiotic resistance gene by detecting the fluorescence signal.
[0007] Preferably, the aggregation-induced emission material is 1,1,2,2-tetra(4-carboxyphenyl)ethylene (TCPE).
[0008] Preferably, the preparation of the DNA hydrogel in step S1 includes: copolymerizing N-isopropylacrylamide, acrylamide-modified cDNA strands, an initiator, and a crosslinking agent to form a DNA hydrogel, and then combining EDC / NHS-activated TCPE with the DNA hydrogel.
[0009] Preferably, the above-mentioned cDNA chain includes two cDNA chains, wherein the first cDNA chain and the second cDNA chain are both fixed in the three-dimensional network of the hydrogel by acrylamide modification, and their sequences are designed to be able to complementarily pair with the same output DNA molecule.
[0010] Preferably, in step S3, the strand substitution reaction uses the target antibiotic resistance gene as the initiating strand, and generates output DNA that can be complementary to both the first cDNA strand and the second cDNA strand through the strand substitution amplification reaction.
[0011] Preferably, the bottom of the 3D printed tube is a closed structure, and the side wall is provided with holes that allow liquid to pass through.
[0012] Preferably, the 3D printed tube is fixed in the sample container by a perforated cap, and the DNA hydrogel is introduced by a microsyringe and placed at the closed bottom of the tube.
[0013] Preferably, in step S4, the output DNA reacts with the nucleic acid chains in the hydrogel, causing the hydrogel network to shrink, reducing the intermolecular spacing of the TCPE molecules complexed therein, causing aggregation and fluorescence enhancement.
[0014] The target antibiotic resistance genes mentioned above are selected from the sul-1 gene as shown in SEQ ID NO.1 (AAGAGCGGCGCAATACGTCTGATCTCATCGGC), the bla-CTX-M-1 gene as shown in SEQ ID NO.2 (ACCAACGATATCGCGGTGATCTGGCC), or the tetM gene as shown in SEQ ID NO.3 (GTGACGAACTTTACCGAATCTGAACA).
[0015] A detection device for implementing the method includes: a container for holding a sample to be tested; a 3D-printed tube placed inside the container, the 3D-printed tube having a closed bottom, a funnel-shaped top, and at least one through-hole on its sidewall; and a DNA hydrogel loaded with aggregation-induced emission material and at least two cDNA strands, the hydrogel being contained in the closed bottom of the 3D-printed tube.
[0016] Beneficial Effects: The strategy for detecting multiple antibiotic resistance genes using hydrogel-enhanced aggregation-induced emission materials (TCPE) provided in this invention achieves significant synergistic effects by organically integrating 3D-printed tubes, TCPE, DNA hydrogels, and strand displacement nucleic acid amplification technology. This effectively overcomes the limitations of existing technologies in detecting samples in complex environments. Specifically, this invention utilizes the three-dimensional network structure and modifiability of DNA hydrogels to simultaneously composite TCPE with two specific cDNA strands, constructing a smart response material that combines extraction enrichment and signal reporting functions. The excellent hydrophilicity and biocompatibility of the hydrogel itself ensure its stability in complex aquatic environments and gentle capture of nucleic acid molecules, effectively preventing the degradation of target analytes. Its abundant pores and functional groups provide a foundation for high-throughput mass transfer and efficient adsorption. Simultaneously, this invention innovatively introduces 3D-printed tubes as microextraction containers. Their precisely designable structures (such as bottom closure and sidewall openings) fundamentally solve the problems of droplet instability, easy detachment, or volatilization in traditional single-drop microextraction, significantly improving the controllability and reproducibility of the extraction process. The tubular structure provides a confined immobilization space for the hydrogel, allowing it to maintain its mobile phase behavior (facilitating mass transfer) while remaining stationary, thus simplifying handling and observation. Crucially, the aggregation-induced emission (ACE) properties of TCPE and the stimulus-response contraction behavior of the hydrogel are cleverly linked in this design. When the output DNA (R2 strand) generated by the target antibiotic resistance gene via strand displacement amplification diffuses into the 3D-printed tube and simultaneously pairs complementaryly with the two cDNA strands in the hydrogel, it alters the cross-linking density of the hydrogel network, causing microscopic contraction. This contraction forces the TCPE molecules encapsulated within the hydrogel network to approach each other, reaching the critical distance for aggregation and emission, thereby triggering a strong fluorescence signal. This process achieves dual signal amplification: molecular amplification based on nucleic acid strand displacement and fluorescence enhancement based on physical aggregation. These two processes work synergistically to transform minute amounts of the gene target into significant and easily measurable optical signals, greatly improving detection sensitivity. Therefore, this invention solves the stability problem of microextraction operations by using 3D-printed tubes; achieves efficient and selective enrichment and protection of trace ARGs in complex sample matrices through hydrogels; and constructs a high signal-to-noise ratio fluorescence switch sensing platform through the coupling mechanism of TCPE and hydrogel shrinkage. The entire method requires no cumbersome sample pretreatment, is simple and fast to operate, and has low cost, providing a reliable tool for highly sensitive and selective on-site detection or laboratory analysis of multiple antibiotic resistance genes in the environment. Attached Figure Description
[0017] Figure 1 This is a schematic diagram of a scheme for extracting ARG based on TCPE-based DNA hydrogel combined with 3D printed tubes.
[0018] Figure 2 For different water contents (f) w TCPE solution characterization: (a) f w SEM image with = 0; (b) f w = 90% of the SEM images; (c) UV absorption and fluorescence emission curves of TCPE; (d) different f w Fluorescence spectrum of TCPE in tetrahydrofuran (THF) / aqueous solution at the specified value; (e) f w (f) F / F0 value of TCPE at 485 nm (the ratio of the fluorescence intensity (F) of TCPE at 485 nm wavelength under different water contents to the fluorescence intensity (F0) of the initial anhydrous TCPE: F / F0); (f) Changes in the fluorescence intensity of TCPE at different temperatures.
[0019] Figure 3 Characterization of DNA hydrogels: (a) SEM image of DNA hydrogel; (b) SEM image of TCPE-based DNA hydrogel; (c) Fluorescence imaging of hydrogel and DNA hydrogel - FAM-modified cDNA1 (top right 2) and cy5-modified cDNA2 (bottom right 4) (1 and 3 are control groups); (d) XPS analysis of hydrogel.
[0020] Figure 4 Schematic diagram of the 3D printed tube: (a) Actual image of the extraction device; (b) Actual 3D printed tube; (c) Side view of the tube; (d) Dimensions and shape details of the tube; (e) Experimental determination of the optimal pore size, data expressed as mean ± standard deviation (n=3).
[0021] Figure 5 This is to verify the feasibility of fluorescence spectroscopy.
[0022] Figure 6 To optimize experimental conditions: (a) TCPE concentration; (b) pH of buffer solution; (c) SDA reaction temperature; (d) SDA reaction time; (e) extractant volume; (f) extraction time.
[0023] Figure 7 For the detection of various ARGs based on TCPE-based DNA hydrogels: (a) fluorescence spectrum of sul-1; (b) calibration plot of sul-1; (c) bla -CTX-M-1 The fluorescence spectrum; (d) bla -CTX-M-1 (e) Calibration plot of tetM; (f) Fluorescence spectrum of tetM.
[0024] Figure 8For specificity analysis of TCPE-based DNA hydrogel detection: (a) selectivity of sul-1; (b) bla -CTX-M-1 (c) The selectivity of tetM. Detailed Implementation
[0025] The present invention will be further described below with reference to specific embodiments. The invention will be described in further detail, but is not limited to these embodiments.
[0026] Example 1
[0027] The preparation method of TCPE-based DNA hydrogel is as follows: First, add 3 g of N-isopropylacrylamide (NIPAM) to a 50 mL centrifuge tube, then add 30 mL of ultrapure water and vortex. Sonicate the mixture in an ultrasonic cleaner until completely dissolved.
[0028] Then, 1g of APS (initiator) was added, and the solution was sonicated to homogenize it. Subsequently, 970 μL of the above liquid was placed in a 1.5 mL centrifuge tube, and 10 μL of 100 μM acrylamide-modified cDNA1 and cDNA2, as well as 10 μL of crosslinking agent TEMED, were added respectively. The mixture was then sonicated to polymerize and obtain a DNA hydrogel.
[0029] The process of modifying cDNA1 and cDNA2 with 100 μM acrylamide: cDNA1 was added to a 100 μM acrylamide monomer solution preheated to 37°C. The mixture was vigorously vortexed, followed by vacuum pumping 1-2 times to remove oxygen. The mixture was poured between gel casting plates (glass plates). A layer of mineral oil was placed on the liquid surface, and a small amount of quartz sand was sprinkled on the oil layer for heat dissipation. Polymerization and curing were then carried out, and the gel was allowed to stand at room temperature for 40 minutes until it became transparent and elastic. Finally, the mineral oil and quartz sand were removed. The gel was equilibrated by immersing it in TBE buffer for five hours for subsequent experiments. The process of modifying cDNA2 with acrylamide was the same. The gene sequence of cDNA1, SEQ ID NO.4: Acrydite-AAAAAAGAAAGGATGTGGATGCA; the gene sequence of cDNA2, SEQ ID NO.5: GAGGTTGATTGAATGCCAAAAAA- Acrydite.
[0030] Finally, TCPE was pre-activated with EDC / NHS (1:1, 50 mg / 1 mL), added to the DNA hydrogel, and the final TCPE-based DNA hydrogel was prepared by ultrasonic mixing.
[0031] Example 2
[0032] Liquid-phase microextraction process: First, pour the sample product after the chain displacement reaction into a 2 mL screw-cap bottle. Place the 3D printed tube vertically in the bottle and tighten the perforated cap to secure it.
[0033] The prepared TCPE-based DNA hydrogel was introduced through a microsyringe in a screw-cap vial gasket, moving it to the sealed bottom of the 3D printing tube.
[0034] R2 (output DNA SEQ ID NO.6: GGCATTCAATCAACCTCTGCATCCACATCCTTTC) from the screw-cap flask entered the test tube through the well. The liquid-phase microextraction process involved a TCPE-based DNA hydrogel; "liquid-phase microextraction" is used here because the hydrogel has high fluidity and behaves like a liquid. The reaction between R2 and the two short-stranded cDNA1 and cDNA2 linked in the TCPE-based DNA hydrogel caused the latter to shrink. This also led to TCPE aggregation, thereby enhancing the fluorescence signal. R2 was extracted with the TCPE-based DNA hydrogel for 30 minutes at 25°C.
[0035] Example 3
[0036] SEM was used to observe TCPE solutions with different water contents. The results are as follows: Figure 2 As shown, when TCPE is completely dissolved in THF ( Figure 2 a) Its distribution is more uniform, its morphology is more regular, and its crystallinity is higher. However, when the proportion of water reaches 90% ( Figure 2 b) TCPE has poor crystallinity; most TCPE exists in aggregates, with almost no dispersion, and it does not form a fixed, uniform structure. The results indicate that TCPE exhibits poor crystallinity at low f... w When dispersed in liquid, the fluorescence intensity is weak, while at high f w When it accumulates in solution, the fluorescence intensity is strong. Figure 2 c represents the ultraviolet (UV) absorption analysis of TCPE. It is clear from the figure that TCPE exhibits the strongest UV absorption peak at 296 nm (red line), while showing the strongest fluorescence emission peak at 485 nm (black line), with a Stokes shift of 189 nm. Figure 2 The figure shows the fluorescence intensity of TCPE in tetrahydrofuran / water mixed solutions with different water contents. Without water, the fluorescence intensity is almost zero. The fluorescence intensity gradually increases with increasing water content, reaching a peak when the water content reaches 90%. This is because TCPE emits almost no light when completely dissolved in THF, but as the water content increases, the solubility of TCPE decreases, causing it to aggregate and significantly enhance the fluorescence intensity. Figure 2e represents the ratio F / F0 of the fluorescence intensity of TCPE at 485 nm wavelength under different water contents to the fluorescence intensity (F0) at the initial anhydrous state. The results show that when the water content is between 0% and 70%, the fluorescence intensity increases slowly. Once it exceeds 70%, the fluorescence intensity increases rapidly. When f w The fluorescence intensity is highest when the water content is 90%, with an F / F0 value of 70. However, when the water content exceeds 90%, some TCPE will precipitate, leading to a decrease in fluorescence intensity. Figure 2 The image in the upper left corner of e shows f. w Fluorescence under ultraviolet light at concentrations of 50% to 99% in TCPE solution. Figure 2 The figure shows the fluorescence intensity of TCPE at different temperatures. It was found that TCPE exhibited the highest fluorescence intensity at 25°C, and the fluorescence intensity began to decrease slowly at 50°C. When the temperature exceeded 50°C, the fluorescence intensity decreased sharply. This is likely because the hydrogen bonds between TCPE molecules break at high temperatures, causing the original aggregated state to disperse. This negatively impacts fluorescence emission.
[0037] Example 4
[0038] To investigate the microstructure of the hydrogel, morphology analysis was performed using SEM, such as... Figure 3 As shown. Figure 3 :a is a DNA hydrogel, Figure 3 Figure b shows a TCPE-based DNA hydrogel. These two figures show that the TCPE-based DNA hydrogel has a smaller pore size than the DNA hydrogel and exhibits a shrinkage trend, indicating that TCPE aggregation leads to the microscopic shrinkage of the DNA hydrogel. Subsequently, we performed fluorescence analysis on the FAM-modified cDNA1 hydrogel and the cy5-modified cDNA2 hydrogel, respectively. Figure 3 c). As can be clearly seen from the figure, the hydrogel emits green and red fluorescence, respectively, indicating that the DNA strands were successfully modified on the hydrogel. Figure 3 The image :d shows the XPS analysis of the hydrogel. The top left corner shows the fine spectrum of P, with a peak found in the DNA hydrogel but not in the native hydrogel. This indicates that the acrylamide-modified DNA strands were successfully modified on the hydrogel, further supporting the above conclusion.
[0039] Example 5
[0040] The 3D printing tube used in this invention, such as Figure 4 As shown. Figure 4 A demonstrates the experimental setup. The SDA reaction product was placed in a vial, and then the 3D-printed tube was placed vertically inside the vial. It was ensured that the product solution actually flowed through the pores. Figure 4:b describes its physical configuration. The tube is funnel-shaped and hollow inside. There are six holes on one side and three holes on the other, and the bottom is blocked to store the extractant. A side view is shown below. Figure 4 As shown in Figure c, the specific location and dimensions of the hole are as follows: Figure 4 As shown in d. The total length of the tube is 31 mm. The length of the perforated part is 10 mm, and the diameter of each hole is 1.0 mm. The outer diameter of the opening is 4.9 mm, and the inner diameter is 3.9 mm. To determine the optimal hole size, we selected tubes with diameters of 1.0 mm and 2.0 mm for testing, as shown in d. Figure 4 As shown in Figure e, the results indicate that when the diameter is 2.0 mm, the solution overflows from the hole, while when the diameter is 1.0 mm, no overflow occurs. Therefore, a 3D-printed tube with a hole diameter of 1.0 mm was ultimately used.
[0041] Example 6
[0042] The presence or absence of the target substance was analyzed in DNA hydrogels, TCPE DNA hydrogels, and TCPE DNA hydrogels. Figure 5 The black line represents the DNA hydrogel, which exhibits extremely weak fluorescence. The pink line represents the TCPE-based DNA hydrogel, with a fluorescence intensity reaching several thousand relative fluorescence units (RFU), higher than the TCPE-free DNA hydrogel. The green line represents the extraction reaction without the target substance. It can be seen that the SDA reaction did not occur, and no significant amount of R2 was extracted into the TCPE-based DNA hydrogel, resulting in a very weak fluorescence signal. The orange line represents the extraction reaction that occurred when the target substance was added, with a significantly enhanced fluorescence signal, far exceeding the fluorescence signal without the target substance.
[0043] Example 7
[0044] The evaluation included TCPE concentration, SDA reaction temperature and time, extraction solvent (TCPE-based DNA hydrogel) volume and extraction time, and buffer pH.
[0045] As TCPE concentration increases, fluorescence intensity initially increases steadily, then gradually reaches a plateau. Figure 6 a) The fluorescence intensity is strongest at a concentration of 600 μM. The pH of the buffer solution affects the structure of nucleic acids; therefore, the fluorescence intensity reaches its maximum at pH = 7.0. Figure 6(b) This is because at lower pH values, protonation in the nucleic acid chain increases, leading to unfavorable changes in the nucleic acid chain structure, making the chain unstable and thus affecting fluorescence intensity. At higher pH values, deprotonation of the nucleic acid chain causes structural instability or changes, resulting in the loss of bonds between base pairs in the nucleic acid chain, altering its folding structure, and thus reducing the fluorescence signal. Furthermore, the effects of SDA reaction temperature and time on fluorescence intensity during extraction were investigated. When the reaction temperature is too low, the nucleic acid reaction lacks sufficient energy support, therefore the reaction rate is slow and the fluorescence signal is weak. When the reaction temperature is too high, the hydrogen bonds between bases are broken, leading to hydrolysis of the nucleic acid chain. Figure 6 From c, it can be seen that the optimal temperature for the SDA reaction is 35℃. Furthermore, the fluorescence intensity gradually increases with increasing reaction time and reaches a plateau; the optimal reaction time is 90 min. Figure 6 (d) Since the extraction was performed in a 3D-printed tube, the volume of the TCPE-based DNA hydrogel and the extraction time were optimized. The results showed that as the volume of the TCPE-based DNA hydrogel increased, the fluorescence intensity initially increased and then leveled off. Similarly, with increasing extraction time, the fluorescence intensity also initially increased and then stabilized.
[0046] Example 8
[0047] The sul-1 and bla were evaluated under optimal experimental conditions. -CTX-M-1 The performance of extraction / analytical methods related to tetM. For example... Figure 7 As shown in a, c, and e, the RFU value increases continuously with the increase of sul-1, bla-CTX-M-1, and tetM concentrations. Figure 7 Figures b, d, and f show the corresponding calibration curves. From 1 fM to 100 nM, the ΔRFU values of sul-1, bla-CTX-M-1, and tetM exhibit a good linear relationship with the logarithm, as shown in the regression equations. Based on the principle that the limit of detection (LOD) is three times the standard deviation of the background signal, the calculated LODs for sul-1, bla-CTX-M-1, and tetM are approximately 0.154 fM, 0.159 fM, and 0.231 fM, respectively. Furthermore, the relative standard deviation (RSD%) is less than 5% for three repeated measurements throughout the linear range.
[0048] Example 9
[0049] At the same time, the specificity of the method was also analyzed, such as Figure 8 As shown. Figure 8 :ac represent sul-1 and bla respectively -CTX-M-1Selectivity analysis of tetM was performed. All three ARGs were compared with single-base mismatch sequences M1, double-base mismatch sequences M2, and completely non-base-paired sequences (NM), and also with AMPr, sul-1, and bla. -TEM The concentrations of tetA and tetO were compared. The concentration of each non-target chain (1 μM) was 10 times higher than the corresponding target chain concentration (100 mM). As shown in the figure, the fluorescence signal of the target chain was significantly higher than that generated after mismatch interference with the target chain, indicating that this method has significant specificity for the target ARGs.
[0050] The gene sequence of sul-1-M1 is SEQ ID NO.7: AAGAGCGGCCCAATACGTCTGATCTCATCGGC;
[0051] The gene sequence of sul-1-M2 is SEQ ID NO.8: AAGAGCGGCCCAATACGACTGATCTCATCGGC;
[0052] The gene sequence of sul-1-NM is SEQ ID NO.9: TTCAGGAATACACACTATCTCTAACTTTCACC;
[0053] The gene sequence of bla-CTX-M-1-M1 is SEQ ID NO.10: ACCAACGATTTCGCGGTGATCTGGCC;
[0054] The gene sequence of bla-CTX-M-1-M2 is SEQ ID NO.11: ACCAACGATTTCGCGGTCATCTGGCC;
[0055] The gene sequence of bla-CTX-M-1-NM is SEQ ID NO.12: GTGACGAACTTTACCGAATCTGAACA;
[0056] The gene sequence of tetM-M1 is SEQ ID NO.13: GTGACGAACATTACCGAATCTGAACA;
[0057] The gene sequence of tetM-M2 is SEQ ID NO.14: GTGACGAACATTACCGATTCTGAACA;
[0058] The gene sequence of AMPr is SEQ ID NO.15: GGGAGTCAGGCAACTATGGA;
[0059] bla -TEMThe gene sequence is SEQ ID NO.16: CACTATTCTCAGAATGACTTGGTTGA;
[0060] The gene sequence of tetA is SEQ ID NO.17: GGACAACATTGCTTGCAGCGCCGGCATTCCGA;
[0061] The gene sequence of tetO is SEQ ID NO.18: ATTATG TGGATACTACAACG CATGAG.
Claims
1. A method for detecting antibiotic resistance genes based on 3D printed tube and TCPE hydrogel, characterized in that, The method comprises the following steps: S1. preparing a DNA hydrogel loaded with an aggregation-induced emission material and nucleic acid chains; S2. placing the DNA hydrogel in a 3D-printed tube to form a liquid-phase microextraction unit; S3. contacting a sample to be tested containing a target antibiotic resistance gene with the liquid-phase microextraction unit, so that the target antibiotic resistance gene generates output DNA through a strand displacement reaction; S4. the output DNA enters the 3D-printed tube and reacts with the nucleic acid chains in the DNA hydrogel, causing microcontraction of the hydrogel, resulting in aggregation of the aggregation-induced emission material and generation of a fluorescent signal; S5. quantifying the target antibiotic resistance gene by detecting the fluorescent signal.
2. The method of claim 1, wherein, The aggregation-induced emission material is 1,1,2,2-tetrakis(4-carboxyphenyl)ethylene (TCPE).
3. The method of claim 2, wherein, The preparation step of the DNA hydrogel in step S1 comprises: copolymerizing N-isopropyl acrylamide, acrylamide-modified cDNA chains, an initiator and a crosslinking agent to form a DNA hydrogel, and then compounding EDC / NHS-activated TCPE with the DNA hydrogel.
4. The method of claim 3, wherein, The cDNA chains comprise two cDNA chains, wherein the first cDNA chain and the second cDNA chain are both fixed in the three-dimensional network of the hydrogel through acrylamide modification, and their sequences are designed to be able to complementarily pair with the same output DNA molecule.
5. The method of claim 4, wherein, In step S3, the strand displacement reaction takes the target antibiotic resistance gene as a priming strand, and generates output DNA that can complementarily pair with both the first cDNA chain and the second cDNA chain through a strand displacement amplification reaction.
6. The method of claim 1, wherein, The bottom of the 3D-printed tube is a closed structure, and the side wall is provided with a hole allowing liquid to pass through.
7. The method of claim 6, wherein, The 3D-printed tube is fixed in a container containing the sample through a bottle cap with a hole, and the DNA hydrogel is introduced into the closed bottom of the tube through a microsyringe.
8. The method of claim 1, wherein, In step S4, the output DNA reacts with the nucleic acid chains in the hydrogel, causing the network of the hydrogel to contract, reducing the intermolecular distance of the TCPE molecules compounded therein, causing aggregation and generating fluorescence enhancement.
9. The method according to any one of claims 1 to 8, characterized in that, The target antibiotic resistance gene is selected from sul-1 gene as shown in SEQ ID NO. 1, bla-CTX-M-1 gene as shown in SEQ ID NO. 2 or tetM gene as shown in SEQ ID NO.
3.
10. A detection device for carrying out the method according to any one of claims 1 to 9, characterized in that It comprises: a container for containing a sample to be tested; a 3D-printed tube placed in the container, the bottom of the 3D-printed tube being closed, the top being funnel-shaped, and the side wall being provided with at least one through hole; and a DNA hydrogel loaded with an aggregation-induced emission material and at least two cDNA chains, the hydrogel being contained in the closed bottom of the 3D-printed tube.