LAMP (loop-mediated isothermal amplification)-based rapid detection primer composition and kit for non-muscular invasive bladder cancer and application of LAMP-based rapid detection primer composition and kit

By using LAMP-based primer combinations and enzymatic methylation conversion technology, a highly sensitive, low-cost urine detection method for non-muscle-invasive bladder cancer without the need for complex instruments has been achieved. This solves the invasiveness and cost problems of existing bladder cancer detection methods and is suitable for bladder cancer monitoring in primary healthcare institutions.

CN121759601APending Publication Date: 2026-03-31SUZHOU HAIMIAO BIOTECH CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-03
Publication Date
2026-03-31

AI Technical Summary

Technical Problem

Existing bladder cancer detection methods are highly invasive, expensive, and have low sensitivity, making it difficult to meet the monitoring needs of high recurrence rates and progression risks in non-muscle-invasive bladder cancer. Traditional ctDNA testing is also costly, limiting its widespread adoption in primary healthcare institutions.

Method used

A rapid detection primer composition for non-muscle-invasive bladder cancer based on LAMP was developed, including primers that target and amplify the VIM and TMEFF2 genes. Combining enzymatic methylation conversion and LAMP reaction, the detection was performed using urine samples without the need for complex instruments. The methylation status was determined by observing the fluorescence signal with a handheld UV lamp.

Benefits of technology

It achieves highly sensitive detection of non-muscle-invasive bladder cancer with a detection limit of 3.125 copies/μL. It is easy to operate, low in cost, and suitable for home self-testing, reducing the burden on patients and promoting the portable and personalized development of gene testing.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121759601A_ABST
    Figure CN121759601A_ABST
Patent Text Reader

Abstract

The invention discloses an LAMP (loop-mediated isothermal amplification)-based rapid detection primer composition and kit for non-muscle invasive bladder cancer and application of the LAMP-based rapid detection primer composition and kit. The primer composition comprises a primer group for targeted amplification of a VIM gene and a TMEFF2 gene. According to the method, rapid nucleic acid extraction is achieved through a one-step method reagent, enzymatic methylation conversion is combined to replace a traditional bisulfite method, and nucleic acid damage and detection complexity can be remarkably reduced. A double-target detection system is constructed on the basis of VIM and TMEFF2 genes, and visual rapid detection of the non-muscle invasive bladder cancer is realized in combination with an LAMP detection technology. The whole detection process does not need a centrifugal machine or a PCR instrument, extraction, conversion and detection can be completed only through a metal bath or a water bath kettle, operation is easy and convenient, and cost is low. The kit provided by the invention is suitable for household self-test, reduces the detection burden of patients, and has wide clinical and household application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of gene detection technology, and in particular to a primer composition, kit, and application of a rapid detection method for non-muscle-invasive bladder cancer based on LAMP. Background Technology

[0002] Bladder cancer is the ninth most common malignant tumor worldwide, with approximately 550,000 new cases and 165,000 deaths annually. The incidence rate is significantly higher in men than in women (age-standardized rate: 9 vs. 2.2 per 100,000). The disease is mainly divided into non-muscle-invasive bladder cancer (NMIBC) and muscle-invasive bladder cancer (MIBC). Current clinical diagnosis and follow-up primarily rely on cystoscopy and urine cytology. Urine cytology has high specificity but overall low sensitivity. Cystoscopy has high sensitivity but is highly invasive, expensive, and subject to inter-observer variability in tumor staging and grading.

[0003] Non-muscle-invasive bladder cancer (NMIBC) is known for its high recurrence rate (50%–70%) and progression risk (10%–15%). Patients need to undergo cystoscopy and urine cytology every 3–6 months after diagnosis to monitor disease progression. This long-term, high-frequency follow-up makes bladder cancer one of the most expensive cancers to treat from diagnosis to death. The high recurrence rate and uncertainty of disease progression highlight the urgent need to develop reliable, non-invasive biomarkers and detection technologies to supplement or even replace existing detection methods, thereby reducing the burden on patients and optimizing disease management.

[0004] Liquid biopsy is a technique that involves collecting bodily fluid samples such as blood, plasma, or urine to detect multiple molecular markers associated with tumors, including circulating tumor cells (CTCs), circulating tumor DNA (ctDNA), messenger RNA, microRNAs, long non-coding RNAs, proteins, metabolites, and extracellular vesicles (exosomes). This non-invasive method enables real-time, dynamic assessment of tumor burden, molecular heterogeneity, residual lesions, and new drug resistance mechanisms. In bladder cancer research, multiple studies have shown that ctDNA testing can not only be used for prognostic assessment but also to monitor treatment response and detect recurrence before the onset of clinical symptoms or imaging changes, providing a revolutionary tool for developing personalized treatment strategies.

[0005] ctDNA testing has significant advantages in bladder cancer detection, but traditional methods are costly and rely on highly sensitive equipment (next-generation sequencing), limiting its widespread adoption in primary healthcare institutions or resource-constrained environments. To overcome these limitations, loop-mediated isothermal amplification (LAMP) technology offers a simpler, faster, and more cost-effective alternative. LAMP is an isothermal nucleic acid amplification technique that efficiently amplifies target DNA at a constant temperature, eliminating the need for expensive thermal cycling equipment and making it suitable for point-of-care testing. Combining the liquid biopsy advantages of ctDNA, LAMP can target bladder cancer-specific biomarkers (such as TERT mutations or specific methylation sites) to achieve highly sensitive and specific detection. This method not only retains the non-invasiveness and molecular diagnostic advantages of ctDNA but also further promotes the popularization and application of precision medicine for bladder cancer through the simplicity and low cost of LAMP. Summary of the Invention

[0006] The technical problem to be solved by the present invention is to provide a primer composition, kit and application of LAMP-based rapid detection of non-muscle-invasive bladder cancer, addressing the shortcomings of the prior art.

[0007] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows: In its first aspect, the present invention provides a primer composition for rapid detection of non-muscle-invasive bladder cancer based on LAMP, characterized in that it includes a primer set for targeted amplification of the VIM gene and the TMEFF2 gene, wherein the primer set for targeted amplification of the VIM gene includes primers with the following sequences: FIP: 5'-TGTTGCTTAAAAAACCCCAATTTGATTATTGCTGCCAAAGATTCTGT-3'; BIP: 5'-ATACCTTTAATGACTTCCACCAGGCCATAGTTTCAAAATAGAACTCAGT-3'; F3: 5'-TGCTGTCCTAAAATTAACACAT-3'; B3: 5'-GTGAAAGAGGAAACTCAACAT-3'; The primer set for targeted amplification of the TMEFF2 gene includes primers with the following sequences: FIP: 5'-ATCCGAACTAACGCCCCTCTTTATTTAGTCGCGGTTCGTA-3'; BIP: 5'-GTTTTGGAGCGGAGAGTGAGCTCGAACTTCAAAATAAACTACC-3'; F3: 5'-TTATTTTTAGTTCGGAGAGACG-3'; B3: 5'-AACCCGAATAAAACTAAACGA-3'.

[0008] Preferably, the primer composition is designed for the CpG island regions of the VIM and TMEFF2 genes, enabling specific amplification of methylated DNA fragments.

[0009] A second aspect of the present invention provides a rapid detection kit for non-muscle-invasive bladder cancer based on LAMP, characterized in that it comprises the primer composition as described in claim 1 or 2, and the following components: a) Nucleic acid extraction reagents, used to extract DNA from samples; b) Enzymatic methylation conversion reagents, used to convert unmethylated cytosine into uracil while retaining methylated cytosine; c) The LAMP reaction system, including LAMP amplification enzyme, fluorescent dye, and buffer.

[0010] Preferably, the sample is a urine, plasma, or cancer tissue sample.

[0011] Preferably, the LAMP reaction system uses the primer composition described in claim 1 or 2 to amplify the VIM gene and the TMEFF2 gene via the LAMP reaction.

[0012] Preferably, the LAMP reaction temperature is 60-65℃.

[0013] Preferably, when this kit is used to detect non-muscle-invasive bladder cancer, a handheld ultraviolet lamp is used to irradiate the LAMP reaction product and observe whether there is fluorescence, thereby determining the methylation status of the VIM and TMEFF2 genes, and ultimately realizing the detection of non-muscle-invasive bladder cancer.

[0014] Preferably, when using this kit to detect non-muscle-invasive bladder cancer, a handheld ultraviolet lamp is used to irradiate the LAMP reaction product and observe whether fluorescence is present.

[0015] A third aspect of the present invention provides the application of the primer composition and kit described above in the detection of non-muscle-invasive bladder cancer.

[0016] A fourth aspect of the present invention provides the application of the primer composition and kit described above in DNA methylation detection.

[0017] The beneficial effects of this invention are: This invention provides a primer composition, kit, and application for rapid detection of non-muscle-invasive bladder cancer based on LAMP. The technical effects achieved by this invention are significantly superior to existing technologies, mainly reflected in the significant reduction of nucleic acid damage by enzymatic methylation conversion (loss rate <50%, far lower than the more than 90% of the bisulfite method). Combined with the VIM and TMEFF2 dual-target LAMP isothermal amplification system, a detection sensitivity of up to 3.125 copies / μL is achieved, suitable for early bladder cancer screening in non-invasive samples such as urine. The entire process requires no complex instruments, only a water bath, and can be visualized with the help of a UV lamp. It is simple to operate, cost-effective, and convenient for home self-testing, greatly reducing the burden on patients. It has broad clinical expansion potential and can promote the development of gene testing towards portability and personalization. Attached Figure Description

[0018] Figure 1 The result is the urine sample after being exposed to ultraviolet light after testing; Figure 2 The results are after the plasmid samples have been tested and then exposed to ultraviolet light. Figure 3 The images show the amplification curves of qPCR samples before and after enzymatic methylation transformation. Detailed Implementation

[0019] The present invention will be further described in detail below with reference to embodiments, so that those skilled in the art can implement it based on the description.

[0020] It should be understood that terms such as “having,” “comprising,” and “including” as used herein do not exclude the presence or addition of one or more other elements or combinations thereof.

[0021] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are commercially available. For examples where specific conditions are not specified, conventional conditions or conditions recommended by the manufacturer are followed. For reagents or instruments whose manufacturers are not specified, they are all commercially available products.

[0022] This invention provides a primer composition and kit for the rapid detection of non-muscle-invasive bladder cancer (NMIBC) based on rapid nucleic acid extraction, enzymatic methylation conversion, and loop-mediated isothermal detection technology. Utilizing HaiMiao Biotechnology's one-step nucleic acid extraction and enzymatic methylation conversion reagents, combined with LAMP detection of dual-gene targets VIM and TMEFF2, this invention enables rapid, accurate, and instrument-free detection of NMIBC. This section will describe the specific implementation details of this invention through several examples, providing operable implementation details for those skilled in the art.

[0023] Example 1: Primer design and synthesis for the detection of non-muscle-invasive bladder cancer This embodiment details the design principles and specific sequences of the primer set used in this invention. 1.1 Target Selection Based on extensive bioinformatics analysis and clinical data validation, this invention selected the VIM and TMEFF2 genes as the main methylation markers. These two genes showed highly specific upregulation of methylation levels in non-muscle-invasive bladder cancer tissues and urine samples from patients.

[0024] 1.2 Primer Design and Sequence This invention constructs a recombinant plasmid by combining the VIM and TMEFF2 genes with the pUC57 plasmid, which was synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0025] The sequence at which the VIM gene was selected is: CTCCCTCCATGTCTTGGACATGAAGTTTTTTGCTGTGTAGACAGTTTTATCCCCCTCACCCCAAGGTCAATTGCATGAATTCTTTTGGAAAACAGGACCTATGGCATTTCCCAGACAAATCACTGTGAACCCTGTACTGTGCATTGCTGTCCTAAAATTAACACATAAATCTATTGCTGCCAAAGATTCTGTCATTTGTGTTACATAATTGCCTTTCATTTGAACTCATTAATCAAATTGGGGTTTTTAAGC AACACCTAATTAATTCTTTAACTGGCTCATATTATACCTTTAATGACTTCCACCAGGGTAAAAACCACTGATCACTGAGTTCTATTTTGAAACTATGGATGTTGAGTTTCCTCTTTCACCCAGAAT TTTCAGATCTGTTTAAAAAGTTGGGTGTGGTTTCATGGGGGGAGGGGGAAGAGTGAGAGGAGACCAGAGGGATGGGGGTGGGGACTCTGCAAGAAAAACCTTCCTGGTGCAATTGTGATCT (SEQ ID NO.1) The sequence at the selected location of the TMEFF2 gene is: ACCTCTGCCCCCACCATCTCCAGCTTGGAGAGATGCCACCCAGCTGTGGCCTGCACTTGTGGCCTGGGGTCATGTGTGGAAGAGGGGTGCTAGTCTGGACCCTGCCTTTGGTAGGGGGTGTCCTGGAGTGGAGAGTGAGGTGAATGGTATATGAGTGTGTGGGTAGCCCACCCTGAAGCCTGAGCTTCTCATTTGAGCCATC CCTGCCTAGCCCCACTTGGGCCAGTGCCTGGTGAGTGAGCCCATCTGTGGCTTCTGGTGGCTGCCTCCTCCTTGCATCCTTGCACCTCCTTGTTGACCCCTCCCTCCTGGGACCTGCATCCTGCTCCACCAATCAGAGCCTGACTGCCTCTTCCCATGTGACCCTGGGTGGGCTGAGGACCTGCTGCTTCCCAAATGCC (SEQ ID NO.2) The primer sets used in this invention are LAMP primers designed for methylated DNA sequences. Each LAMP primer set contains four primers: FIP (Forward Inner Primer), BIP (Backward Inner Primer), F3 (Forward Outer Primer), and B3 (Backward Outer Primer). These primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0026] The LAMP primer sequence for the VIM gene methylation site is as follows: FIP: 5'-TGTTGCTTAAAAACCCCAATTTGATTATTGCTGCCAAAGATTCTGT-3' (SEQ ID NO.3) BIP: 5'-ATACCTTTAATGACTTCCACCAGGCCATAGTTTCAAAATAGAACTCAGT-3' (SEQ IDNO.4) F3: 5'-TGCTGTCCTAAAATTAACACAT-3' (SEQ ID NO.5) B3: 5'-GTGAAAGAGGAAACTCAACAT-3' (SEQ ID NO.6) The LAMP primer sequence for the TMEFF2 gene methylation site is as follows: FIP: 5'-ATCCGAACTAACGCCCCTCTTTATTTAGTCGCGGTTCGTA-3' (SEQ ID NO.7) BIP: 5'-GTTTTGGAGCGGAGAGTGAGCTCGAACTTCAAAATAAACTACC-3' (SEQ ID NO.8) F3: 5'-TTATTTTTAGTTCGGAGAGACG-3' (SEQ ID NO.9) B3: 5'-AACCCGAATAAAACTAAACGA-3' (SEQ ID NO.10) Example 2: Components and preparation of the kit 2.1 One-step nucleic acid extraction reagent One-step nucleic acid extraction reagent, used for rapid extraction of DNA from samples; The test sample for this invention is a urine sample, collected using a urine collection tube. After collection, the first step is nucleic acid extraction using a nucleic acid extraction reagent. The extraction reaction system is prepared according to the following reaction ratio: The proteinase K and buffer solution were derived from HaiMiao Biotechnology's self-developed one-step nucleic acid extraction reagent (Proteinase K, P8107S). The reaction conditions were: 58℃ for 2 min; 95℃ for 2 min.

[0027] 2.2 Enzymatic methylation conversion reagent Enzymatic methylation conversion reagents are used to convert unmethylated cytosine into uracil while retaining methylated cytosine.

[0028] Enzyme oxidation treatment: TET enzyme reaction solution (reference) Liu Y, Siejka-Zielińska P, et al. Nature Biotechnology, 2019 Prepare a buffer containing 500 mM de MOPS (pH 6.9), 1 mM ferrous ammonium sulfate, 10 mM α-ketoglutarate, 20 mM ascorbic acid, 10 mM dithiothreitol and 500 mM sodium chloride.

[0029] The reaction conditions were 37℃ for 1 hour and 95℃ for 5 minutes.

[0030] Reduction treatment with reducing agent: The reaction conditions were 37°C for 16 hours.

[0031] 2.3 LAMP reaction system The LAMP reaction system includes LAMP amplification enzyme, a 10X primer set, and a 2X chromogenic buffer. The chromogenic buffer and primer set were prepared in-house. The 2X buffer consisted of 40 mM Tris-HCl, 4 mM MgCl, 20 mM (NH4)2SO4, 100 mM KCl, 4 mM MgSO4, 0.2% Tween-20, 2 mM dNTPs, and 0.2 μM SYBR Green.

[0032] For ease of reaction, the LAMP primer set was added to the fluorescence reaction system in advance. The final concentrations of the forward inner primer (SEQ ID NO.3 and SEQ ID NO.7), the reverse inner primer (SEQ ID NO.4 and SEQ ID NO.8), the forward outer primer (SEQ ID NO.5 and SEQ ID NO.9), and the reverse outer primer (SEQ ID NO.6 and SEQ ID NO.10) were 3.2 μM, 3.2 μM, 0.4 μM, and 0.4 μM, respectively.

[0033] Example 3: Implementation of the detection method The detection method of this invention is based on urine samples, is simple to operate, and is suitable for home self-testing. The specific steps are as follows: 3.1 Sample Collection The patient's first morning urine (approximately 5 mL) is collected using a urine collection tube and stored at 4°C for no more than 48 hours. This invention is also applicable to the testing of blood or tissue samples, wherein blood samples are centrifuged to obtain plasma, and the subsequent processing of plasma and tissue samples is the same as that of urine samples. To highlight the ease of use of home testing, this embodiment uses a urine sample as an example; the positive urine sample was provided by Chongming Hospital affiliated with Shanghai Health Medical College.

[0034] 3.2 Nucleic acid extraction Nucleic acid extraction was performed according to the method described in Example 2. The amount of sample and reagents added could be adjusted proportionally. After the reaction was completed, the mixture was allowed to stand for 2 minutes, and the supernatant was used for subsequent transformation processes.

[0035] 3.3. Enzymatic methylation conversion The nucleic acid extraction mixture was subjected to enzymatic methylation conversion according to the procedure described in Example 2. After conversion, the samples could be stored at 4°C for no more than 48 hours or at -20°C for no more than 2 weeks.

[0036] 3.4 LAMP fluorescence detection.

[0037] The enzymatic conversion reaction mixture (10 μL) was added to the LAMP fluorescence reaction system for isothermal amplification. After the reaction, the fluorescence signal was observed using a UV flashlight. The presence or absence of fluorescence based on the methylation status of the VIM and TMEFF2 genes was used to determine the presence of non-muscle-invasive bladder cancer. The LAMP reaction system is shown in the table below: The reaction conditions were 65 °C for 30 min.

[0038] Experimental results are as follows Figure 1 As shown, samples 1 and 2 are urine samples from patients with non-muscle-invasive bladder cancer provided by the hospital, while samples 3-8 are urine samples from healthy individuals provided by laboratory colleagues. The urine samples positive for bladder cancer produced fluorescent signals, while the urine samples from healthy individuals did not, confirming that this invention can be effectively used for the detection of non-muscle-invasive bladder cancer in urine samples.

[0039] Example 4: Performance Verification To evaluate the detection sensitivity limit of the present invention, a series of dilution gradient solutions (from high to low concentration) were constructed using VIM and TMEFF2 gene plasmids as templates, and enzymatic methylation transformation was performed according to the method described in Example 2; after transformation, detection was performed using the LAMP fluorescence method described in Example 3.

[0040] Test results as follows Figure 2 As shown (concentrations decreasing from left to right), a significant fluorescence signal can be observed at a plasmid concentration as low as 25 / 8 copies / μL (3.125 copies / μL). This result indicates that the detection limit of this invention is extremely low (<25 copies / μL), sufficient to meet the sensitivity requirements of real-world clinical samples (such as urine).

[0041] Example 5: Comparison with other methods Bisulfite conversion is the gold standard method for DNA methylation analysis, converting unmethylated cytosine (C) to uracil (U) through chemical treatment. However, this process involves high temperatures, acidity, and high concentrations of bisulfite, which can lead to DNA single-strand breaks, depurination, and depyrimidine reactions, resulting in significant degradation and loss, with an overall loss rate exceeding 90%. To test the conversion efficiency of the enzymatic conversion method, ACTB in total human DNA (gDNA) was selected as the detection target, and the conversion loss was assessed by comparing the CT values ​​of qPCR before and after enzymatic conversion.

[0042] The sequences of the forward primer (FP), reverse primer (RP), and fluorescent probe (Probe) for the ACTB gene are as follows: FP: 5'-ATGGAGGAGCCTCAGCAAGT (SEQ ID NO.11) RP: 5'-CTTGAAGGTTGCAGAGGCC (SEQ ID NO.12) Probe: 5'-CCACCCAGCACACAGTGGCAGAC (SEQ ID NO.13) The gDNA sample was treated using the enzymatic methylation transformation method described in Example 2. After transformation, the transformation product was purified using a nucleic acid extraction and purification kit (HaiMiao Biotechnology). Subsequently, qPCR detection was performed on an ABI 7500 qPCR instrument, and the reaction system is shown in Figure Y.

[0043] [Note: Experimental results show that the Ct value of the ACTB gene increased by <1.5 cycles after enzymatic transformation, indicating a DNA loss rate of <50%, which is significantly better than the bisulfite method (specific data can be added if applicable).] The transformation was performed using the enzyme transfection method described in Example 2. After transformation, nucleic acid extraction was performed using a nucleic acid extraction and purification kit (HaiMiao Biotechnology). After extraction, detection was performed using an ABI 7500 qPCR instrument. The reaction system is shown in the figure below. The amplification program is set as follows: Test results as follows Figure 3 As shown, the CT value before transformation was 26.18, and the CT value after transformation was 26.79. The conversion efficiency is roughly estimated to be 65.52%, which is significantly better than the bisulfite method.

[0044] Although the embodiments of the present invention have been disclosed above, they are not limited to the applications listed in the specification and embodiments. They can be applied to various fields suitable for the present invention. For those skilled in the art, other modifications can be easily made. Therefore, without departing from the general concept defined by the claims and their equivalents, the present invention is not limited to the specific details.

Claims

1. A primer composition for rapid detection of LAMP-based non-muscle invasive bladder cancer, characterized by, The primer set for targeting amplification of the VIM gene and the TMEFF2 gene, the primer set for targeting amplification of the VIM gene comprising primers with the following sequences: FIP: 5'-TGTTGCTTAAAAACCCCAATTTGATTATTGCTGCCAAAGATTCTGT-3'; BIP: 5'-ATACCTTTAATGACTTCCACCAGGCCATAGTTTCAAAATAGAACTCAGT-3'; F3: 5'-TGCTGTCCTAAAATTAACACAT-3'; B3: 5'-GTGAAAGAGGAAACTCAACAT-3'; The primer set for targeting amplification of the TMEFF2 gene comprises primers with the following sequences: FIP: 5'-ATCCGAACTAACGCCCCTCTTTATTTAGTCGCGGTTCGTA-3'; BIP: 5'-GTTTTGGAGCGGAGAGTGAGCTCGAACTTCAAAATAAACTACC-3'; F3: 5'-TTATTTTTAGTTCGGAGAGACG-3'; B3: 5'-AACCCGAATAAAACTAAACGA-3'.

2. The LAMP-based non-muscle invasive bladder cancer rapid detection primer composition according to claim 1, characterized by, The primer composition is designed for the CpG island region of the VIM gene and the TMEFF2 gene, and can specifically amplify the methylated DNA fragment.

3. A LAMP-based rapid test kit for non-muscle invasive bladder cancer, characterized by, The primer composition according to claim 1 or 2, and the following components: a) a nucleic acid extraction reagent for extracting DNA from a sample; b) an enzymatic methylation conversion reagent for converting unmethylated cytosine into uracil while retaining methylated cytosine; c) a LAMP reaction system comprising LAMP amplification enzymes, fluorescent dyes and buffers.

4. The kit of claim 3, wherein The sample is urine, plasma or a cancer tissue sample.

5. The kit of claim 3, wherein The LAMP reaction system amplifies the VIM gene and the TMEFF2 gene by the primer composition according to claim 1 or 2 using a LAMP reaction.

6. The kit of claim 5, wherein The LAMP reaction temperature is 60-65°C.

7. The kit of claim 6, wherein When the kit is used for non-muscle invasive bladder cancer detection, a hand-held ultraviolet lamp is used to irradiate the LAMP reaction product, and whether there is fluorescence is observed, so as to judge the methylation state of the VIM and TMEFF2 genes, and finally realize the detection of non-muscle invasive bladder cancer.

8. The kit of claim 7, wherein When the kit is used for non-muscle invasive bladder cancer detection, a hand-held ultraviolet lamp is used to irradiate the LAMP reaction product, and whether there is fluorescence is observed.

9. Use of the primer composition according to claim 1 or 2, or the kit according to any one of claims 3-9 in non-muscle invasive bladder cancer detection.

10. Use of the primer composition according to claim 1 or 2, or the kit according to any one of claims 3-9 in DNA methylation detection.