Anti-ALPP / ALPPL2 antibodies, antibody-drug conjugates and uses thereof

Abstract

The present technology provides antibodies, antigen binding fragments and antibody-drug conjugates (ADC) specific for placental alkaline phosphatase (ALPP) and / or placental-like alkaline phosphatase 2 (ALPPL2), which are useful as potential therapeutic agents for the treatment of diseases, including cancer.

Description

[0001] Cross-reference to related applications

[0002] This application claims priority to Singapore Patent Application No. 10202302410S, filed on August 25, 2023, which is incorporated herein by reference in its entirety. Technical Field

[0003] This technology relates to therapeutic antibodies targeting placental alkaline phosphatase (ALPP) and / or placental-like alkaline phosphatase 2 (ALPPL2), their antigen-binding fragments and antibody-drug conjugates (ADCs), and their use in cancer treatment.

[0004] References to sequence lists

[0005] The sequence list related to this application is provided electronically in XML file format and is incorporated herein by reference in its entirety. The XML file containing the sequence list is named AXCY_001_02WO_SeqList_ST26.xml. The XML file is 42,561 bytes in size and was created on August 20, 2024. Background Technology

[0006] ALPPL2 and ALPP, commonly co-expressed in cancers, exhibit high tumor specificity, making them attractive targets for cancer therapy. ALPP and ALPPL2 are membrane-bound proteins involved in the recycling of ATP from the extracellular space. Both proteins are expressed in ovarian cancer, endometrial cancer, gastric cancer, and testicular cancer, with limited expression in normal tissues. Currently, there are no approved drugs targeting ALPP / ALPPL2, although several clinical candidates are in preclinical and early-stage clinical trials. To address the unmet need for therapeutic agents targeting ALPP / ALPPL2 for cancer treatment, this technology provides optimized anti-ALPP / ALPPL2 antibodies or their antigen-binding fragments, as well as ADCs comprising said antibodies or their antigen-binding fragments and further comprising cytotoxic payloads, as novel therapeutic agents for cancer treatment. Summary of the Invention

[0007] This technology relates to a novel anti-ALPP / ALPPL2 antibody, its antigen-binding fragment, and an ADC, which can be used as a novel therapeutic agent for treating cancers, including, for example, mesothelioma, ovarian cancer, pancreatic cancer, endometrial cancer, non-small cell lung cancer, gastric cancer, gastroesophageal junction cancer, cervical cancer, colorectal cancer, and testicular cancer.

[0008] In some respects, a recombinant antibody or antigen-binding fragment thereof that specifically binds to ALPP and / or ALPPL2 is provided.

[0009] In some embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises a heavy chain variable region containing at least one, two or three complementarity-determining regions (CDRs) selected from SEQ ID NO: 10, 3, 11; and / or a light chain variable region containing at least one, two or three CDRs selected from SEQ ID NO: 6-8.

[0010] In some embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises a heavy chain variable region containing an amino acid sequence that is at least 80% identical to that of SEQ ID NO: 9, 12 or 13; and / or a light chain variable region containing an amino acid sequence that is at least 80% identical to that of SEQ ID NO: 14 or 15.

[0011] In some embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises a heavy chain variable region, said heavy chain variable region comprising at least one, two or three CDRs selected from GFSLTSYG (SEQ ID NO: 10), IWEX1X2ST (SEQ ID NO: 38) and AKPHYGSSYVGAMEY (SEQ ID NO: 11), wherein: X1 is E, H, Q, or S; and X2 can be A, E, L, or Q; And / or light chain variable regions, which contain at least one, two or three CDRs selected from SEQ ID NO: 6-8.

[0012] In some embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises: (a) a heavy chain variable region comprising a CDR having an amino acid sequence as shown in SEQ ID NO: 10, 17 and 11; and / or a light chain variable region comprising a CDR having an amino acid sequence as shown in SEQ ID NO: 6-8; (b) a heavy chain variable region comprising a CDR having an amino acid sequence as shown in SEQ ID NO: 10, 19 and 11; and / or a light chain variable region comprising a CDR having an amino acid sequence as shown in SEQ ID NO: 6-8; (c) a heavy chain variable region comprising a CDR having the amino acid sequences shown in SEQ ID NO: 10, 21 and 11; and / or a light chain variable region comprising a CDR having the amino acid sequences shown in SEQ ID NO: 6-8; (d) Heavy chain variable region comprising a CDR having the amino acid sequences shown in SEQ ID NO: 10, 23 and 11; and / or light chain variable region comprising a CDR having the amino acid sequences shown in SEQ ID NO: 6-8; (e) a heavy chain variable region comprising a CDR having an amino acid sequence as shown in SEQ ID NO: 10, 25 and 11; and / or a light chain variable region comprising a CDR having an amino acid sequence as shown in SEQ ID NO: 6-8; (f) Heavy chain variable region comprising a CDR having the amino acid sequences shown in SEQ ID NO: 10, 27 and 11; and / or light chain variable region comprising a CDR having the amino acid sequences shown in SEQ ID NO: 6-8; (g) a heavy chain variable region comprising a CDR having the amino acid sequences shown in SEQ ID NO: 10, 29, and 11; and / or a light chain variable region comprising a CDR having the amino acid sequences shown in SEQ ID NO: 6-8; or (h) a heavy chain variable region comprising a CDR having an amino acid sequence as shown in SEQ ID NO: 10, 31 and 11; and / or a light chain variable region comprising a CDR having an amino acid sequence as shown in SEQ ID NO: 6-8; In some embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises: (a) a heavy chain variable region containing an amino acid sequence that is at least 80% identical to that of SEQ ID NO: 16; and / or a light chain variable region containing an amino acid sequence that is at least 80% identical to that of SEQ ID NO: 15; (b) a heavy chain variable region containing an amino acid sequence that is at least 80% identical to that of SEQ ID NO: 18; and / or a light chain variable region containing an amino acid sequence that is at least 80% identical to that of SEQ ID NO: 15; (c) a heavy chain variable region containing an amino acid sequence that is at least 80% identical to that of SEQ ID NO: 20; and / or a light chain variable region containing an amino acid sequence that is at least 80% identical to that of SEQ ID NO: 15; (d) a heavy chain variable region containing an amino acid sequence that is at least 80% identical to that of SEQ ID NO: 22; and / or a light chain variable region containing an amino acid sequence that is at least 80% identical to that of SEQ ID NO: 15; (e) a heavy chain variable region comprising an amino acid sequence that is at least 80% identical to that of SEQ ID NO: 24; and / or a light chain variable region comprising an amino acid sequence that is at least 80% identical to that of SEQ ID NO: 15; (f) a heavy chain variable region containing an amino acid sequence that is at least 80% identical to that of SEQ ID NO: 26; and / or a light chain variable region containing an amino acid sequence that is at least 80% identical to that of SEQ ID NO: 15; (g) a heavy chain variable region comprising an amino acid sequence that is at least 80% identical to that of SEQ ID NO: 28; and / or a light chain variable region comprising an amino acid sequence that is at least 80% identical to that of SEQ ID NO: 15; or (h) a heavy chain variable region comprising an amino acid sequence that is at least 80% identical to that of SEQ ID NO: 30; and / or a light chain variable region comprising an amino acid sequence that is at least 80% identical to that of SEQ ID NO: 15; In some embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment further comprises a light chain constant region containing an amino acid sequence that is at least 80% identical to SEQ ID NO: 33, and / or a heavy chain constant region, wherein the heavy chain constant region comprises: (a) One or more amino acid substitutions at positions A121, S242, L237, L238, D268, K150, V205, C223, A330, and S443 relative to SEQ ID NO: 34; or (b) Substitution of one or more amino acids selected from the group consisting of SEQ ID NO: 34, relative to SEQ ID NO: 34; or (c) Having at least 80% identical amino acid sequence to any one of SEQ ID NO: 32, 35, 36 or 37.

[0013] In some implementations, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment is humanized, hypoimmune, does not bind to intestinal alkaline phosphatase (ALPI) and / or biomineralization-associated alkaline phosphatase (ALPL), and / or does not have cross-reactivity with non-human species.

[0014] In some aspects, a pharmaceutical composition comprising an anti-ALPP / ALPPL2 antibody or an antigen-binding fragment thereof according to various embodiments disclosed herein is provided.

[0015] In some aspects, a nucleic acid is provided comprising a nucleotide sequence encoding an anti-ALPP / ALPPL2 antibody or an antigen-binding fragment thereof according to various embodiments disclosed herein. In some embodiments, the nucleotide sequence is at least 80% identical to SEQ ID NO: 35 or 36. In some embodiments, the nucleic acid is in the form of a vector or virus.

[0016] In some respects, a host cell containing a nucleic acid or vector or virus according to various embodiments disclosed herein is provided.

[0017] In some aspects, a composition comprising a vector or virus or a host cell according to various embodiments disclosed herein is provided.

[0018] In some aspects, an ADC is provided comprising (1) an anti-ALPP / ALPPL2 antibody or an antigen-binding fragment thereof according to various embodiments disclosed herein; and (2) one or more payloads, wherein the anti-ALPP / ALPPL2 antibody or the antigen-binding fragment thereof is linked to each of the one or more payloads via a linker.

[0019] In some implementations, the ADC has the following formula: (I), Where Ab is the antibody or its antigen-binding fragment, L is the linker, D is the payload, and z is an integer from 1 to 20.

[0020] In some implementations, the connector (L) has the following structure: (L1A); (L1B); (L2A); (L2B); (L3A); (L3B); (L4); (L5); (L6); (L7); or (L8), Where D is the payload and n is an integer from 1 to 20. In some embodiments, the connector (L) has any of the structures L9-L21 provided in Table 3.

[0021] In some embodiments, the payload comprises monomethyloretine E (MMAE) or a derivative thereof, DXd / exatecan or a derivative thereof, trabectedin or a derivative thereof, lurbinectedin or a derivative thereof, and / or a pharmaceutically acceptable salt, ester, solvate, tautomer or stereoisomer of any of the foregoing substances.

[0022] In some embodiments, the payload comprises MMAE or its derivatives having the following structures: (II), Where R is a sugar, which may optionally be a monosaccharide.

[0023] In some implementations, the payload comprises DXd / ecientecan or a derivative thereof.

[0024] In some embodiments, the payload comprises rubitidine or its derivatives having the following structures: (III), in: R1 is -OH, -F, -Cl, -Br, -I, -NO2, -NH2, -COOH, carbonyl (-C(=O)R5), carboxyl (-C(=O)OR6 or -C≡N); preferably carbonyl, -OH, -NO2, -F or -C≡N; more preferably -OH, -F or -C≡N; and most preferably -OH or -C≡N, wherein R5 and R6 are independently H or aryl; R2 is either -H or -X (CH2). p C(=O) 0-1 (CH2) q (C(R7)2) 0-1 (X) 0-1 R8, where p and q are independent integers selected from 0 to 10, X is 0 or NH, and R7 and R8 are independent H or C. 1-4 alkyl; R3 is either -H or -X (CH2). m C(=O) 0-1 (CH2) n (C(R9)2) 0-1 (X) 0-1 R 10 Where m and n are independent integers selected from 0 to 10, X is 0 or NH, and R9 and R 10 Independently H or C 1-4 Alkyl groups; and R4 is -H or C 1-4 alkyl, Optionally, equation (III) does not include: R2 is -H, R3 is -H, and R4 is -H; and R2 is -OCH3, R3 is -H, and R4 is -H.

[0025] In some embodiments, the payload comprises rubitidine or its derivatives having the following structures: (IV), in: R1 is -OH, -F, -Cl, -Br, -I, -NO2, -NH2, -COOH, carbonyl (-C(=O)R5), carboxyl (-C(=O)OR6 or -C≡N); preferably carbonyl, -OH, -NO2, -F or -C≡N; more preferably -OH, -F or -C≡N; and most preferably -OH or -C≡N, wherein R5 and R6 are independently H or aryl; R2 is either -H or -X (CH2). p C(=O) 0-1 (CH2) q (C(R7)2) 0-1 (X) 0-1 R8, where p and q are independent integers selected from 0 to 10, X is 0 or NH, and R7 and R8 are independent H or C. 1-4 alkyl; R3 is either -H or -X (CH2). m C(=O) 0-1 (CH2) n (C(R9)2) 0-1 (X) 0-1 R 10 Where m and n are independent integers selected from 0 to 10, X is 0 or NH, and R9 and R 10 Independently H or C 1-4 Alkyl groups; and R4 is -H or -CH2NHR 11 , where R 11 For H or C 1-4 alkyl.

[0026] In some embodiments, the payload comprises trabectedine or its derivatives having the following structure: (V) in: R1 is -OH, -F, -Cl, -Br, -I, -NO2, -NH2, -COOH, carbonyl (-C(=O)R6), carboxyl (-C(=O)OR7 or -C≡N); preferably carbonyl, -OH, -NO2, -F or -C≡N; more preferably -OH, -F or -C≡N; and most preferably -OH or -C≡N, wherein R6 and R7 are independently H or aryl; R2 is either -H or -X (CH2). p C(=O) 0-1 (CH2) q (C(R8)2) 0-1 (X) 0-1 R9, where p and q are independent integers selected from 0 to 10, X is 0 or NH, and R8 and R9 are independent H or C. 1-4 alkyl; R3 is either -H or -X (CH2). m C(=O) 0-1 (CH2) n (C(R 10 )2) 0-1 (X) 0-1 R 11 Where m and n are independent integers selected from 0 to 10, X is 0 or NH, and R 10 and R 11 Independently H or C 1-4 Alkyl groups; and R4 is -H, -CH2OR 12 -CH2NHR 13 or -CH2C(=O)OR 14 , where R 12 R 13 And R 14 Independently H or C 1-4 Alkyl groups; and R5 is -H or C 1-4 alkyl, Optionally, formula (V) does not include: R2 is -OCH3, R3 is -OH, R4 is -H, and R5 is -H.

[0027] In some embodiments, the payload (D) has any of the structures of P1-P12 provided in Table 4. In some embodiments, the connector payload (LD) has any of the structures of PL1-PL38 provided in Table 8.

[0028] In some aspects, a pharmaceutical composition comprising an ADC according to various embodiments disclosed herein is provided.

[0029] In some aspects, a method for in vitro inhibition of the growth of cancer cells expressing ALPP and / or ALPPL2 is provided, according to various embodiments disclosed herein, the method comprising exposing cancer cells to an effective amount of an anti-ALPP / ALPPL2 antibody or an antigen-binding fragment thereof, an ADC, or a pharmaceutical composition containing the like.

[0030] In some aspects, a method is provided for treating cancers expressing ALPP and / or ALPPL2 in a subject in need, the method comprising administering to a subject in need a therapeutically effective amount of an anti-ALPP / ALPPL2 antibody or an antigen-binding fragment thereof, an ADC, or a pharmaceutical composition containing the like to the subject in need.

[0031] In some embodiments of a method for treating cancers expressing ALPP and / or ALPPL2, the method further includes administering one or more additional anticancer therapies to a subject. In some embodiments, one or more additional anticancer therapies are therapeutic antibodies, ADCs, chemotherapy, radiotherapy, endocrine therapy, targeted molecular agents, immunotherapy, or any combination thereof.

[0032] In some embodiments of methods for treating cancers expressing ALPP and / or ALPPL2, the cancer is a solid cancer, including, for example, mesothelioma, ovarian cancer, pancreatic cancer, endometrial cancer, non-small cell lung cancer, gastric cancer, gastroesophageal junction cancer, cervical cancer, colorectal cancer, and testicular cancer. Attached Figure Description

[0033] Figure 1 The binding of the original mouse antibody H17E2 (AT04-5A) to ALPPL2, ALPP and similar enzymes such as intestinal alkaline phosphatase (ALPI) and biomineralization-associated alkaline phosphatase (ALPL) was demonstrated.

[0034] Figure 2 The cross-reactivity of H17E2 (AT04-5A) to ALPPL2 in mice and monkeys was shown.

[0035] Figure 3 The binding of H17E2 (AT04-5A) to various cancer cell lines was demonstrated.

[0036] Figure 4 The hydrophobic interaction chromatographic analysis of H17E2 (AT04-5A) is shown.

[0037] Figure 5AThe process of humanizing H17E2 (AT04-5A) is shown, which generates six new constructs (AT04-10A to AT04-15A) by combining one of two humanized light chain designs (VL1 (SEQ ID NO: 14) and VL2 (SEQ ID NO: 15)) with one of three humanized heavy chain designs (VH4 (SEQ ID NO: 9), VH5 (SEQ ID NO: 12) and VH6 (SEQ ID NO: 13)) carrying different main chain mutations. Figure 5B The binding of the humanized antibody to ALPPL2 was demonstrated.

[0038] Figure 6 The hydrophobic interaction chromatographic analysis of the humanized antibody is shown.

[0039] Figure 7A The results show the optimization of antibody AT04-13A by performing post-translational modification (PTM) removal to improve its developability and by making certain mutations at D54 or G55 residues in the heavy chain to avoid antibody isomerization. Sequence alignment results of the heavy chain variable region of AT04-13A (SEQ ID NO: 9) and eight optimized antibodies AT04-16A to AT04-23A (SEQ ID NO: 16, 18, 20, 22, 24, 26, 28, 30; see Table 6) are presented. Figure 7B The optimal binding of the antibody to ALPPL2 was demonstrated.

[0040] Figure 8 The optimized antibody hydrophobic interaction chromatography analysis is shown.

[0041] Figure 9 Surface plasmon resonance (SPR) analyses of the parental and selected humanized / optimized antibodies AT04-5A, AT04-13A, AT04-23A, and AT04-26A are shown.

[0042] Figure 10 The specificity of the parental antibodies and selected humanized / optimized antibodies AT04-5A, AT04-13A, AT04-23A, and AT04-26A for ALPPL2, ALPP, and similar enzymes such as ALPI and ALPL is shown. ITC is an isotype control antibody lacking specificity for the stated targets and is used as a negative control.

[0043] Figure 11 The cross-reactivity of the parental antibodies and selected humanized / optimized antibodies AT04-5A, AT04-13A, AT04-23A, and AT04-26A with mouse and monkey ALPPL2 is shown. ITC is an isotype control.

[0044] Figure 12 The internalization data of AT04-23A in cell lines expressing ALPPL2 are shown.

[0045] Figure 13 An exemplary structure of an antibody-drug conjugate (ADC) based on monomethyloretine E (MMAE) is shown.

[0046] Figures 14A-14E The data show the cytotoxicity of ADCs prepared from various humanized and / or optimized antibodies against cancer cells.

[0047] Figure 15 The study demonstrated the strong antitumor activity of ADC-14 in mice from tumor cell-derived xenografts.

[0048] Figure 16 This study demonstrates the effective inhibition of tumor growth by ADC-14 in a patient-derived xenograft tumor model in mice.

[0049] Figure 17 This study demonstrates the effective inhibition of tumor growth by ADC-14 in a patient-derived xenograft tumor model in mice. Detailed Implementation

[0050] In various embodiments, this technology provides a novel anti-ALPP / ALPPL2 antibody, its antigen-binding fragment, and an ADC, which can be used as a novel therapeutic agent for treating cancers including, for example, mesothelioma, ovarian cancer, pancreatic cancer, endometrial cancer, non-small cell lung cancer, gastric cancer, gastroesophageal junction cancer, cervical cancer, colorectal cancer, and testicular cancer.

[0051] Travers and Bodmer identified one of the primary anti-ALPP / ALPPL2 mouse monoclonal antibodies (H17E2) of the IgG1 isotype purified from mice immunized with human full-term placental membranes. See Travers & Bodmer, Int. J. Cancer 1984; 33(5):633-41, the entire contents of which are incorporated herein by reference. The original mouse H17E2 clone has been “reshaped” and humanized, but due to its low degree of humanization, low yield, and poor pharmacokinetic properties (high hydrophobicity and high aggregation tendency), this humanized antibody has limitations in generating ADCs and is therefore unsuitable for conjugation with payloads.

[0052] As demonstrated in the working examples herein, this technology provides optimized anti-ALPP / ALPPL2 antibodies or antigen-binding fragments thereof with enhanced binding affinity (approximately 10-fold), enhanced hydrophilicity, and increased yield (approximately 5 to 15-fold). Furthermore, due to the enhanced hydrophilicity and reduced aggregation tendency, the anti-ALPP / ALPPL2 antibodies or antigen-binding fragments of this technology are suitable for developing ADCs, for example, by conjugation with cytotoxic payloads. Therefore, this technology provides promising therapeutic agents for treating various cancers, including, for example, ovarian cancer, endometrial cancer, gastric cancer, and testicular cancer carrying ALPP and / or ALPPL2 antigens.

[0053] While this disclosure may be implemented in various forms, the following description of several embodiments is intended as exemplary of the invention and is not intended to limit the invention to the specific embodiments shown. The headings are provided for convenience only and should not be construed as limiting the invention in any way. Embodiments shown under any heading may be combined with embodiments shown under any other heading.

[0054] Unless otherwise expressly stated, all numerical values ​​specified in this application are considered approximate, as the minimum and maximum values ​​within the range are preceded by the word "about". While not always explicitly stated, all numerical values ​​should be understood to be preceded by the term "about". It should be understood that this range form is used for convenience and brevity, and should be flexibly interpreted to include not only the numerical values ​​explicitly designated as the limits of the range, but also all individual numerical values ​​or sub-intervals covered within that range, as if each numerical value and sub-interval were explicitly specified. For example, a ratio in the range of about 1 to about 200 should be understood to include the explicitly listed limits of about 1 and about 200, but also individual ratios such as about 2, about 3, and about 4, and sub-intervals such as about 10 to about 50, about 20 to about 100, etc. It should also be understood that, although not always explicitly stated, the reagents described herein are merely exemplary, and their equivalents are known in the art.

[0055] If any material cited herein conflicts with this public document, this public document shall prevail.

[0056] definition

[0057] Unless otherwise stated, each of the following terms has the meaning set forth in this section.

[0058] The indefinite article “a” indicates at least one related noun and is used interchangeably with the terms “at least one” and “one or more”. For example, the phrase “a module” means at least one module or one or more modules.

[0059] The conjunctions “or” and “and / or” can be used interchangeably.

[0060] As used in this article, the term “about” when referring to measurable values, such as quantity or concentration, means a variation of 20%, 10%, 5%, 1%, 0.5%, or even 0.1% of a specific amount.

[0061] The term "amino acid" refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function similarly to naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code, and those that are subsequently modified. Amino acid analogs are compounds that have the same basic chemical structure as naturally occurring amino acids. These analogs have modified R groups or modified peptide backbones but retain the same basic chemical structure as naturally occurring amino acids. Amino acid mimetics are chemical compounds that have a structure different from the general chemical structure of amino acids but function similarly to naturally occurring amino acids.

[0062] The term "antibody" is used in its broadest sense herein and includes both polyclonal and monoclonal antibodies, such as intact antibodies and their functional (antigen-binding) fragments. The term covers genetically engineered and / or otherwise modified forms of immunoglobulins, such as intrabody, peptibody, chimeric antibody, fully human antibody, humanized antibody, synthetic antibody and heteroconjugated antibody, multispecific (e.g., bispecific) antibody, diabody, triabody, tetrabody, tandem two-scFv, and tandem three-scFv. Unless otherwise stated, the term covers intact or full-length antibodies, including antibodies of any class or subclass (e.g., IgG and its subclasses, such as IgG1, IgG2, IgG3, and IgG4; IgM; IgE; IgA, and IgD), as well as antibody fragments.

[0063] In embodiments where the antibody comprises an antigen-binding fragment of an immunoglobulin molecule, the antibody may include, but is not limited to, single-chain variable fragment antibodies (scFv), disulfide-linked Fv, single-domain antibodies (sdAb), VHH antibodies, antigen-binding fragments F(ab), F(ab'), F(ab')2, or double-chain antibodies. scFv antibodies are formed by linking the heavy chain (VHH) of an immunoglobulin molecule to a short linker peptide. H ) and light chains (V L The variable region of the antibody is derived from natural antibodies. Similarly, V is linked by interdomain disulfide bonds. H and VL Fv can be generated by disulfide bonds. On the other hand, sdAb consists only of variable regions from either the heavy or light chain, typically the smallest antigen-binding fragment of the antibody. VHH antibodies are only antigen-binding fragments of the heavy chain. Double-chain antibodies are dimers of scFv fragments, consisting of VFvs non-covalently or covalently linked together by small peptide linkers. H and V L Composition. The term "antigen-binding fragment" can refer to an immunogenic active fragment of an antibody that has the ability to specifically recognize, associate, conjugate, or bind to an antigen or target molecule. Antigen-binding fragments include any naturally occurring, synthetic, semi-synthetic, or recombinant-derived fragments. The antibodies and their antigen-binding fragments disclosed herein retain the ability to bind specific antigens. In some embodiments, the antigen-binding fragment of a full-length antibody can be used to prepare the antibody-drug conjugates of the present invention.

[0064] Antibodies may comprise a heavy chain (or a polypeptide sequence derived therefrom) and a light chain (or a polypeptide sequence derived therefrom). The term "variable region" or "variable domain" refers to a domain of the antibody's heavy or light chain that participates in the binding of the antibody to the antigen. The variable regions of the heavy and light chains (VH and VL, respectively) of natural antibodies typically have similar structures, with each domain containing four conserved framework regions and three complementarity-determining regions. Sometimes, a single VH or VL domain is sufficient to confer all or most of the antigen-binding specificity of the antibody. Furthermore, antibodies binding to specific antigens can be isolated from antibodies binding to antigens by using VH or VL domains, allowing for screening of libraries with complementary VL or VH domains, respectively. See, for example, Portolano et al., J. Immunol. 150:880-887 (1993); Clarkson et al., Nature 352:624-628 (1991).

[0065] As used herein, the term "antigen" refers to a molecule capable of eliciting an immune response. Antigens include, but are not limited to, cells, cell extracts, proteins, polypeptides, peptides, polysaccharides, polysaccharide conjugates, peptide and non-peptide mimics of polysaccharides and other molecules, small molecules, lipids, glycolipids, carbohydrates, viruses and viral extracts, and multicellular organisms such as parasites and allergens. The term antigen broadly encompasses any type of molecule recognized as foreign by the host's immune system. The term "neoantigen" can be used to refer to a cancer-specific antigen (i.e., an antigen found on cancer cells but not on non-cancer cells) specifically recognized by homologous binding molecules as described.

[0066] The terms "specific binding," "specifically binding," or "specifically recognizing" refer to an antibody or its antigen-binding fragment binding to a predetermined antigen / target molecule. Specific binding of an antibody or its antigen-binding fragment typically means that the affinity of that antibody or its antigen-binding fragment is at least 10.-7 M (represented by Kd value; preferably Kd value less than 10) -7 M is an antibody or antigen-binding fragment, wherein the antibody or its antigen-binding fragment has an affinity for a predetermined antigen / target molecule that is at least twice as strong as its affinity for a nonspecific antigen / target molecule (e.g., bovine serum albumin or casein), wherein the nonspecific antigen / target molecule is neither the predetermined antigen / target molecule nor an antigen / target molecule closely related to it. Specific binding of the antibody or its antigen-binding fragment does not preclude the antibody or conjugate from binding to multiple antigens / target molecules. The antibody preferably has at least 10 -7 M, at least 10 -8 M or at least 10 -9 M to 10 -11 The affinity of M. The Kd value can be determined, for example, by surface plasmon resonance spectroscopy.

[0067] "Clinically effective amount," "clinically effective concentration," or "clinically effective dose" refers to the concentration or dose of a peptide, composition, or pharmaceutical composition that has shown effectiveness in clinical trials or is predicted to be effective based on early or preclinical trials. In some embodiments, "clinically effective amount" is the same as "therapeutic effective amount." In some embodiments, "clinically effective amount" is higher or lower than "therapeutic effective amount." Furthermore, the effective amount may remain constant or may be adjusted using a sliding ratio or variable dose based on the subject's response to treatment. Various factors can affect the actual effective amount used for a particular application. For example, the frequency of administration, duration of treatment, use of multiple therapeutic agents, route of administration, and severity of illness may require increasing or decreasing the actual effective amount administered.

[0068] The term "codon-optimized" or "codon-optimized" when referring to nucleotide sequences is based on the finding that the frequency of synonymous codons (i.e., codons encoding the same amino acid) in coding nucleotide sequences is biased across different species. This codon degeneracy allows the same polypeptide to be encoded by multiple nucleotide sequences. Codon optimization refers to the process of replacing certain codons in a coding nucleotide sequence with synonymous codons, according to the preferences of the host cell, without altering the resulting polypeptide sequence. Various codon optimization methods are known in the art, including, for example, those disclosed in at least U.S. Patent Nos. 5,786,464 and 6,114,148.

[0069] The term “complementarity-determining region (CDR)” is synonymous with “hypervariable region” or “HVR” and is known in the art to refer to the amino acid sequence within an antibody variable region that typically confers antigen specificity and / or binding affinity and is separated from each other by a frame sequence in the primary structure. Frame regions (FRs) are the non-CDR portions of the variable domain. Typically, there are four FRs in each full-length heavy chain variable domain and four FRs in each full-length light chain variable domain. In some cases, frame amino acids may also contribute to binding. Typically, there are three CDRs in each variable region. Variable domain sequences can be aligned according to numbering schemes (e.g., Kabat, EU, International ImMunoGeneTics Information System® (IMGT®), and Aho), which allows for the annotation of equivalent residue positions and comparison of different molecules using Antibody Numbering and Antigen Receptor Classification (ANARCI) software tools (2016, Bioinformatics 15:298-300). The precise amino acid sequence boundaries of a given CDR or FR can be readily determined using any of several well-known schemes, including those described in: Kabat et al., 5th edition, Public Health Service, National Institutes of Health, Bethesda, MD (1991) (“Kabat” numbering scheme); Al-Lazikani et al., JMB 273, 927-948 (1997) (“Chothia” numbering scheme); MacCallum et al., J. Mol. Biol. 262: 732-745 (1996) (“contact” numbering scheme); Lefranc et al., Dev Comp Immunol. 27(1): 55-77 (2003) (“IMGT” numbering scheme); and Honegger and Pluckthun, J Mol Biol, 309(3): 657-70 (2001) (“Aho” numbering scheme). The boundaries of a given CDR or FR can vary depending on the scheme used for identification. For example, the Kabat scheme is based on sequence alignment, while the Chothia scheme is based on structural information. Both Kabat and Chothia numbering schemes are based on the length of the most common antibody region sequences and use an insert letter to indicate the inserted sequence, such as "30a". These two schemes place certain insertions and deletions ("indels") at different positions, resulting in different numbering. The contact scheme is based on the analysis of complex crystal structures and is similar to the Chothia numbering scheme in many ways.Unless otherwise stated, the CDR of the antibodies referred to herein can be identified according to any of the Kabat, Chothia, IMGT, and contact methods.

[0070] When referring to amino acid sequences, the term "conservative substitution" is understood in the art to mean that one amino acid replaces another amino acid with similar properties. Various criteria known to those skilled in the art indicate whether an amino acid substituted at a specific position in a peptide or polypeptide is conserved (or similar). For example, a similar amino acid or conserved amino acid substitution is a substitution in which an amino acid residue is replaced by an amino acid residue having a similar side chain. Similar amino acids can include those with basic side chains (e.g., lysine, arginine, histidine); amino acids with acidic side chains (e.g., aspartic acid, glutamic acid); amino acids with uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine); amino acids with nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan); amino acids with β-branched side chains (e.g., threonine, valine, isoleucine); and amino acids with aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan). Proline is considered more difficult to classify because it shares similar properties with amino acids that have aliphatic side chains, such as leucine, valine, isoleucine, and alanine. In some cases, glutamine replacing glutamic acid or asparagine replacing aspartic acid can be considered similar substitutions because glutamine and asparagine are amide derivatives of glutamic acid and aspartic acid, respectively.

[0071] The term "epitope" includes any molecule, structure, amino acid sequence, or protein determinant that is recognized and specifically bound by a cognate binding molecule, such as an antibody or T-cell receptor, or other binding molecules, domains, or proteins.

[0072] The term "expression" refers to the process by which a polypeptide is produced based on the coding sequence of a nucleic acid molecule, such as a gene. This process can include transcription, post-transcriptional control, post-transcriptional modification, translation, post-translational control, post-translational modification, or any combination thereof. The expressed nucleic acid molecule is typically effectively linked to an expression control sequence (e.g., a promoter).

[0073] As used in this article, “host cell” refers to a cell or microorganism that is genetically modified by introducing a construct or vector carrying a nucleotide sequence for expressing a target protein or polypeptide.

[0074] The term "nucleic acid" or "polynucleotide" refers to a polymeric compound comprising covalently linked nucleotides, wherein the nucleotides contain natural subunits (e.g., purine or pyrimidine bases). Purine bases include adenine and guanine, and pyrimidine bases include uracil, thymine, and cytosine. Nucleic acid molecules include polyribonucleic acid (RNA) and polydeoxyribonucleic acid (DNA), and DNA includes cDNA, genomic DNA, and synthetic DNA, any of which may be single-stranded or double-stranded. A nucleic acid molecule encoding an amino acid sequence comprises all nucleotide sequences encoding the same amino acid sequence.

[0075] The term "effective ligation" refers to the association of two or more nucleic acid molecules on a single nucleic acid fragment, such that the function of one is affected by the function of the other.

[0076] The terms “peptide,” “polypeptide,” and “protein” are used interchangeably and refer to a polymer of amino acid residues, and are not limited to a minimum length, although multiple amino acid residues may be specified. A polypeptide may include amino acid residues, including native and / or non-native amino acid residues. The term also includes post-expression modifications of the polypeptide, such as glycosylation, sialylation, acetylation, phosphorylation, etc. In some embodiments, the polypeptide may contain modifications to the original or native sequence, provided the protein retains the desired activity. These modifications may be intentional, such as through site-directed mutagenesis, or may be accidental, such as through mutations in the host producing the protein or due to errors in PCR amplification.

[0077] The term "subject" refers to a mammalian subject, preferably a human. "Subject in need" refers to a subject who has been diagnosed with cancer or is at an elevated risk of developing cancer. The phrases "subject" and "patient" are used interchangeably throughout this document.

[0078] As used herein with respect to cancer, the term "treatment" refers to the partial or complete relief of cancer, inhibition of cancer cell growth, reduction of cancer cell number, prevention of cancer, reduction of the likelihood of cancer occurrence or recurrence, slowing of cancer progression or development, or elimination, reduction, or slowing of the development of one or more cancer-related symptoms. For example, "treatment" can refer to preventing or slowing the growth of an existing tumor to a larger size, preventing or slowing the formation or metastasis of cancer, and / or slowing the development of certain symptoms of cancer. In some embodiments, the term "treatment" refers to a reduction in the number or size of tumors in a subject compared to a subject who has not received treatment. In some embodiments, the term "treatment" refers to the relief of one or more symptoms of cancer in a subject receiving a pharmaceutical composition as disclosed and described herein compared to a subject who has not received such treatment.

[0079] As used herein, a “therapeutic effective amount” is the amount that produces the desired effect in a subject for an indication, symptom, disease, or condition. In some embodiments, the therapeutic effective amount is the amount that produces the maximum therapeutic effect. In other embodiments, the therapeutic effective amount produces a therapeutic effect less than the maximum therapeutic effect. For example, a therapeutic effective amount may be the amount that produces a therapeutic effect while avoiding one or more side effects associated with the dose that produces the maximum therapeutic effect. The therapeutic effective amount of a particular composition will vary based on a variety of factors, including, but not limited to, the characteristics of the therapeutic composition (e.g., activity, pharmacokinetics, pharmacodynamics, and bioavailability); the physiological condition of the subject (e.g., age, weight, sex, type and stage of disease, medical history, general physical condition, responsiveness to a given dose, and other existing medications); the nature of any pharmaceutically acceptable carriers, excipients, and preservatives in the composition; and the route of administration. Those skilled in the art of clinical and pharmacology will be able to determine the therapeutic effective amount through routine experiments, i.e., by monitoring the subject’s response to administration of the therapeutic composition and adjusting the dose accordingly. For further guidance, see Remington: The Science and Practice of Pharmacy, 21st edition, Univ. of Sciences in Philadelphia (USIP), Lippincott Williams & Wilkins, Philadelphia, PA, 2005.

[0080] The term "variable region" or "variable domain" refers to a segment of the antibody heavy or light chain that participates in antigen binding. Antibody heavy chain (V H ) and light chains (V L The variable structural domains of a ) typically each contain four generally conservative frame regions (FRs) and three complementary determinant regions (CDRs). The frame regions separate the CDRs, such that the CDRs are located between the frame regions.

[0081] A "vector" refers to a DNA construct containing a nucleic acid molecule that is efficiently linked to a suitable control sequence capable of influencing the expression of that nucleic acid molecule in a suitable host. Such control sequences may include a promoter for initiating transcription, an optional operon sequence for controlling such transcription, a sequence encoding a suitable mRNA ribosome binding site, and sequences controlling the termination of transcription and translation. A vector can be a plasmid, a phage particle, a virus, or simply a potential genomic insertion fragment. Once transformed into a suitable host, the vector can replicate and function independently of the host genome, or in some cases, it can integrate into the genome itself.

[0082] Antibodies, antigen-binding fragments and their combinations

[0083] In some respects, recombinant antibodies or antigen-binding fragments thereof that specifically recognize or bind to ALPP and / or ALPPL2 are provided. Table 1 provides exemplary amino acid sequences, including CDRs, of the heavy and light chain variable and constant regions of anti-ALPP / ALPPL2 antibodies or antigen-binding fragments thereof.

[0084] In some embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises a heavy chain variable region and / or a light chain variable region derived from the mouse monoclonal antibody H17E2. In some of these embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises one or more (e.g., one, two, three, four, five, or six) complementarity-determining regions (CDRs) having amino acid sequences selected from SEQ ID NO: 2-4 and 6-8. In some embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises a heavy chain variable region containing one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from SEQ ID NO: 2-4; and / or a light chain variable region containing one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from SEQ ID NO: 6-8. In some of these embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises a heavy chain variable region comprising or consisting of the amino acid sequence of SEQ ID NO: 1 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to the amino acid sequence of SEQ ID NO: 1; and / or a light chain variable region comprising or consisting of the amino acid sequence of SEQ ID NO: 5 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to the amino acid sequence of SEQ ID NO: 5.

[0085] In some embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises a heavy chain variable region and / or a light chain variable region modified from the mouse monoclonal antibody H17E2, exhibiting improved binding affinity, improved hydrophilicity, improved yield, and / or reduced aggregation tendency compared to the original H17E2 antibody. Modifications may include mutations, substitutions, additions, or deletions of one or more amino acid mutations, substitutions, additions, or deletions in one or more CDRs and / or frame regions (FRs) of the heavy and / or light chains.

[0086] In some embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises a heavy chain variable region comprising one or more (e.g., one, two, or three) CDRs having an amino acid sequence selected from GFSLTSYG (SEQ ID NO: 10), IWEDGST (SEQ ID NO: 3), and AKPHYGSSYVGAMEY (SEQ ID NO: 11); and / or a light chain variable region comprising one or more (e.g., one, two, or three) CDRs having an amino acid sequence selected from SEQ ID NO: 6-8. In some of these embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 9, 12 or 13 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical) to or constitutes thereof; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 14 or 15 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical) to or constitutes thereof.

[0087] In some embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises a heavy chain variable region and / or a light chain variable region derived from further modification of the mouse monoclonal antibody H17E2, for example by removal via post-translational modification (PTM), to have improved binding affinity, improved hydrophilicity, improved yield, and / or reduced aggregation tendency compared to the original H17E2 antibody. Modification may include mutations, substitutions, additions, or deletions of one or more amino acid mutations, substitutions, additions, or deletions in one or more CDRs of the heavy chain and / or light chain.

[0088] In some embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises a heavy chain variable region, said heavy chain variable region comprising at least one, two, or three CDRs having an amino acid sequence selected from GFSLTSYG (SEQ ID NO: 10), IWEX1X2ST (SEQ ID NO: 38), and AKPHYGSSYVGAMEY (SEQ ID NO: 11), wherein: X1 is E, H, Q, or S; and X2 can be A, E, L, or Q.

[0089] In some embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises a light chain variable region, said light chain variable region comprising at least one, two or three CDRs having an amino acid sequence selected from SEQ ID NO: 6-8.

[0090] In some embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises a heavy chain variable region comprising one or more (e.g., one, two, or three) CDRs having an amino acid sequence selected from: GFSLTSYG (SEQ ID NO: 10), IWEEGST (SEQ ID NO: 17; containing a D54E mutation compared to the original H17E2 antibody heavy chain variable region sequence (SEQ ID NO: 1), and AKPHYGSSYVGAMEY (SEQ ID NO: 11); and / or a light chain variable region comprising one or more (e.g., one, two, or three) CDRs having an amino acid sequence selected from SEQ ID NO: 6-8. In some of these embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 16 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to or constitutes thereof; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 14 or 15 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to or constitutes thereof.

[0091] In some embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises a heavy chain variable region comprising one or more (e.g., one, two, or three) CDRs having an amino acid sequence selected from: GFSLTSYG (SEQ ID NO: 10), IWEHGST (SEQ ID NO: 19; containing a D54H mutation compared to the original H17E2 antibody heavy chain variable region sequence (SEQ ID NO: 1), and AKPHYGSSYVGAMEY (SEQ ID NO: 11); and / or a light chain variable region comprising one or more (e.g., one, two, or three) CDRs having an amino acid sequence selected from SEQ ID NO: 6-8. In some of these embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 18 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to or constitutes thereof; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 14 or 15 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to or constitutes thereof.

[0092] In some embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises a heavy chain variable region comprising one or more (e.g., one, two, or three) CDRs having an amino acid sequence selected from: GFSLTSYG (SEQ ID NO: 10), IWEQGST (SEQ ID NO: 21; containing a D54Q mutation compared to the original H17E2 antibody heavy chain variable region sequence (SEQ ID NO: 1), and AKPHYGSSYVGAMEY (SEQ ID NO: 11); and / or a light chain variable region comprising one or more (e.g., one, two, or three) CDRs having an amino acid sequence selected from SEQ ID NO: 6-8. In some of these embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 20 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to or constitutes thereof; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 14 or 15 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to or constitutes thereof.

[0093] In some embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises a heavy chain variable region comprising one or more (e.g., one, two, or three) CDRs having an amino acid sequence selected from: GFSLTSYG (SEQ ID NO: 10), IWESGST (SEQ ID NO: 23; containing a D54S mutation compared to the original H17E2 antibody heavy chain variable region sequence (SEQ ID NO: 1), and AKPHYGSSYVGAMEY (SEQ ID NO: 11); and / or a light chain variable region comprising one or more (e.g., one, two, or three) CDRs having an amino acid sequence selected from SEQ ID NO: 6-8. In some of these embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 22 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to or constitutes thereof; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 14 or 15 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to or constitutes thereof.

[0094] In some embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises a heavy chain variable region comprising one or more (e.g., one, two, or three) CDRs having an amino acid sequence selected from: GFSLTSYG (SEQ ID NO: 10), IWEDAST (SEQ ID NO: 25; containing a G55A mutation compared to the original H17E2 antibody heavy chain variable region sequence (SEQ ID NO: 1), and AKPHYGSSYVGAMEY (SEQ ID NO: 11); and / or a light chain variable region comprising one or more (e.g., one, two, or three) CDRs having an amino acid sequence selected from SEQ ID NO: 6-8. In some of these embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 24 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to or constitutes thereof; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 14 or 15 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to or constitutes thereof.

[0095] In some embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises a heavy chain variable region comprising one or more (e.g., one, two, or three) CDRs having an amino acid sequence selected from: GFSLTSYG (SEQ ID NO: 10), IWEDEST (SEQ ID NO: 27; containing a G55E mutation compared to the original H17E2 antibody heavy chain variable region sequence (SEQ ID NO: 1), and AKPHYGSSYVGAMEY (SEQ ID NO: 11); and / or a light chain variable region comprising one or more (e.g., one, two, or three) CDRs having an amino acid sequence selected from SEQ ID NO: 6-8. In some of these embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 26 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to or constitutes thereof; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 14 or 15 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to or constitutes thereof.

[0096] In some embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises a heavy chain variable region comprising one or more (e.g., one, two, or three) CDRs having an amino acid sequence selected from: GFSLTSYG (SEQ ID NO: 10), IWEDLST (SEQ ID NO: 29; containing a G55L mutation compared to the original H17E2 antibody heavy chain variable region sequence (SEQ ID NO: 1), and AKPHYGSSYVGAMEY (SEQ ID NO: 11); and / or a light chain variable region comprising one or more (e.g., one, two, or three) CDRs having an amino acid sequence selected from SEQ ID NO: 6-8. In some of these embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 28 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to or constitutes thereof; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 14 or 15 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to or constitutes thereof.

[0097] In some embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises a heavy chain variable region comprising one or more (e.g., one, two, or three) CDRs having an amino acid sequence selected from: GFSLTSYG (SEQ ID NO: 10), IWEDQST (SEQ ID NO: 31; containing a G55Q mutation compared to the original H17E2 antibody heavy chain variable region sequence (SEQ ID NO: 1), and AKPHYGSSYVGAMEY (SEQ ID NO: 11); and / or a light chain variable region comprising one or more (e.g., one, two, or three) CDRs having an amino acid sequence selected from SEQ ID NO: 6-8. In some of these embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 30 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to or constitutes thereof; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 14 or 15 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to or constitutes thereof.

[0098] In some embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises one or more (e.g., one, two, three, four, five, or six) complementarity-determining regions (CDRs) having amino acid sequences selected from SEQ ID NO: 10, 3, 11, and 6-8. In some embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises a heavy chain variable region containing one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from SEQ ID NO: 10, 3, and 11; and / or a light chain variable region containing one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from SEQ ID NO: 6-8. In some of these embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises a heavy chain variable region comprising or consisting of the amino acid sequence of SEQ ID NO: 9 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to or constitutes thereof; and / or a light chain variable region comprising or consisting of the amino acid sequence of SEQ ID NO: 15 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to or constitutes thereof.

[0099] In some embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises one or more (e.g., one, two, three, four, five, or six) complementarity-determining regions (CDRs) having amino acid sequences selected from SEQ ID NO: 10, 17, 11, and 6-8. In some embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises a heavy chain variable region containing one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from SEQ ID NO: 10, 17, and 11; and / or a light chain variable region containing one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from SEQ ID NO: 6-8. In some of these embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 16 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to or constitutes thereof; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 15 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to or constitutes thereof.

[0100] In some embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises one or more (e.g., one, two, three, four, five, or six) complementarity-determining regions (CDRs) having amino acid sequences selected from SEQ ID NO: 10, 19, 11, and 6-8. In some embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises a heavy chain variable region containing one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from SEQ ID NO: 10, 19, and 11; and / or a light chain variable region containing one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from SEQ ID NO: 6-8. In some of these embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises a heavy chain variable region comprising or consisting of the amino acid sequence of SEQ ID NO: 18 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to the amino acid sequence of SEQ ID NO: 18; and / or a light chain variable region comprising or consisting of the amino acid sequence of SEQ ID NO: 15 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to the amino acid sequence of SEQ ID NO: 15.

[0101] In some embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises one or more (e.g., one, two, three, four, five, or six) complementarity-determining regions (CDRs) having amino acid sequences selected from SEQ ID NO: 10, 21, 11, and 6-8. In some embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises a heavy chain variable region containing one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from SEQ ID NO: 10, 21, and 11; and / or a light chain variable region containing one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from SEQ ID NO: 6-8. In some of these embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises a heavy chain variable region comprising or consisting of the amino acid sequence of SEQ ID NO: 20 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to the amino acid sequence of SEQ ID NO: 20; and / or a light chain variable region comprising or consisting of the amino acid sequence of SEQ ID NO: 15 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to the amino acid sequence of SEQ ID NO: 15.

[0102] In some embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises one or more (e.g., one, two, three, four, five, or six) complementarity-determining regions (CDRs) having amino acid sequences selected from SEQ ID NO: 10, 23, 11, and 6-8. In some embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises a heavy chain variable region containing one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from SEQ ID NO: 10, 23, and 11; and / or a light chain variable region containing one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from SEQ ID NO: 6-8. In some of these embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 22 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to or constitutes thereof; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 15 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to or constitutes thereof.

[0103] In some embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises one or more (e.g., one, two, three, four, five, or six) complementarity-determining regions (CDRs) having amino acid sequences selected from SEQ ID NO: 10, 25, 11, and 6-8. In some embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises a heavy chain variable region containing one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from SEQ ID NO: 10, 25, and 11; and / or a light chain variable region containing one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from SEQ ID NO: 6-8. In some of these embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises a heavy chain variable region comprising or consisting of the amino acid sequence of SEQ ID NO: 24 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to the amino acid sequence of SEQ ID NO: 24; and / or a light chain variable region comprising or consisting of the amino acid sequence of SEQ ID NO: 15 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to the amino acid sequence of SEQ ID NO: 15.

[0104] In some embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises one or more (e.g., one, two, three, four, five, or six) complementarity-determining regions (CDRs) having amino acid sequences selected from SEQ ID NO: 10, 27, 11, and 6-8. In some embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises a heavy chain variable region containing one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from SEQ ID NO: 10, 27, and 11; and / or a light chain variable region containing one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from SEQ ID NO: 6-8. In some of these embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 26 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to or constitutes thereof; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 15 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to or constitutes thereof.

[0105] In some embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises one or more (e.g., one, two, three, four, five, or six) complementarity-determining regions (CDRs) having amino acid sequences selected from SEQ ID NO: 10, 29, 11, and 6-8. In some embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises a heavy chain variable region containing one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from SEQ ID NO: 10, 29, and 11; and / or a light chain variable region containing one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from SEQ ID NO: 6-8. In some of these embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises a heavy chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 28 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to or constitutes thereof; and / or a light chain variable region comprising or consisting of an amino acid sequence of SEQ ID NO: 15 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to or constitutes thereof.

[0106] In some embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises one or more (e.g., one, two, three, four, five, or six) complementarity-determining regions (CDRs) having amino acid sequences selected from SEQ ID NO: 10, 31, 11, and 6-8. In some embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises a heavy chain variable region containing one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from SEQ ID NO: 10, 31, and 11; and / or a light chain variable region containing one or more (e.g., one, two, or three) CDRs having amino acid sequences selected from SEQ ID NO: 6-8. In some of these embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises a heavy chain variable region comprising or consisting of the amino acid sequence of SEQ ID NO: 30 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to or constitutes thereof; and / or a light chain variable region comprising or consisting of the amino acid sequence of SEQ ID NO: 15 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to or constitutes thereof.

[0107] In any of the embodiments described herein, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment may contain one or more amino acid substitutions (e.g., conserved substitutions), insertions, and / or deletions in any exemplary amino acid sequence, including, for example, one, two, or three substitutions, insertions, and / or deletions in any exemplary CDR sequence. This technology particularly contemplates anti-ALPP / ALPPL2 antibodies or their antigen-binding fragments that have one or more (e.g., one, two, or three) substitutions, insertions, and / or deletions compared to the reference CDR sequence described herein, but still maintain a certain level of binding affinity for ALPP and / or ALPPL2 (e.g., human ALPP / ALPPL2). In some of these embodiments, when tested under the same or similar conditions, anti-ALPP / ALPPL2 antibodies or antigen-binding fragments thereof with one or more (e.g., one, two, or three) substitutions, insertions, and / or deletions compared to a reference CDR sequence as described herein will maintain at least 80% (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99%) of the binding affinity exhibited by anti-ALPP / ALPPL2 antibodies or antigen-binding fragments thereof having the reference CDR sequence. For example, the affinity (K0) of anti-ALPP / ALPPL2 antibodies or antigen-binding fragments thereof having one or more (e.g., one, two, or three) substitutions, insertions, and / or deletions compared to a reference CDR sequence as described herein for binding to ALPP / ALPP2 (e.g., human ALPP / ALPP2) is... D It is approximately 1x10 -11 -1x10 -7 M, for example, approximately 1x10 -11 -1x10 -8 M, approximately 1x10 -11 -1x10 -9 M, approximately 1x10 -11 -1x10 -10 M, approximately 1x10 -10 -1x10 -7 M, approximately 1x10 -10 -1x10 -8 M, approximately 1x10 -10 -1x10 -9 M, approximately 1x10 -11 -1x10 -7 M, approximately 1x10 -9 -1x10 -7 M, approximately 1x10 -9 -1x10 -8 M or approximately 1x10 -81 -1x10 -7 M.

[0108] Table 1. Exemplary sequences of anti-ALPP / ALPPL2 antibodies or their antigen-binding fragments.

[0109] In some embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment according to the various embodiments disclosed herein is humanized. A “humanized” form of a non-human (e.g., rodent) antibody is a chimeric antibody containing a sequence derived from a non-human antibody. In cases where the antibody or its antigen-binding fragment is derived from a non-human species, the antibody or its antigen-binding fragment may be humanized to reduce immunogenicity in human subjects. For example, a non-human antibody may be humanized via CDR grafting, wherein the CDR of the non-human antibody is placed at a corresponding position within a compatible human antibody framework. As another example, the constant region of a non-human antibody may be replaced with a human sequence. Techniques for humanizing monoclonal antibodies are within the capabilities of those skilled in the art.

[0110] In some embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment further comprises a heavy chain constant region and / or a light chain constant region. In some of these embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises a heavy chain constant region comprising or consisting of the amino acid sequence of SEQ ID NO: 32 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to or constitutes thereof; and / or a light chain constant region comprising or consisting of the amino acid sequence of SEQ ID NO: 33 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to or constitutes thereof.

[0111] In some embodiments, the constant regions of the heavy and / or light chains of the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment are further modified to include strategically placed reactive cysteine ​​residues, for example, for subsequent conjugation with a drug payload to generate an ADC. In some embodiments, the constant regions of the modified anti-ALPP / ALPPL2 antibody or its antigen-binding fragment contain one or more of the following mutations compared to the original H17E2 antibody heavy chain sequence (SEQ ID NO: 34): A121C, K150C, V205C, C223S, S242C, D268C, A330C, and S443C. In some embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises a heavy chain constant region comprising or consisting of an amino acid sequence of SEQ ID NO: 35 (containing A121C and S242C mutations compared to the original H17E2 antibody heavy chain sequence (SEQ ID NO: 34)) or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to or constitutes thereof; and / or a light chain constant region comprising or consisting of an amino acid sequence of SEQ ID NO: 33 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to or constitutes thereof. In some embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises a heavy chain constant region comprising or consisting of an amino acid sequence of SEQ ID NO: 36 (containing mutations A121C, L237A, L238A, and D268C compared to the original H17E2 antibody heavy chain sequence (SEQ ID NO: 34)) or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to or constitutes thereof; and / or a light chain constant region comprising or consisting of an amino acid sequence of SEQ ID NO: 33 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to or constitutes thereof.In some embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment comprises a heavy chain constant region comprising or consisting of an amino acid sequence of SEQ ID NO:37 (containing mutations A121C, L237A, L238A, and S242C compared to the original H17E2 antibody heavy chain sequence (SEQ ID NO: 34)) or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to or constitutes thereof; and / or a light chain constant region comprising or consisting of an amino acid sequence of SEQ ID NO: 33 or an amino acid sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to or constitutes thereof.

[0112] In some embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment according to the various embodiments disclosed herein has low immunogenicity, for example, it is not likely to induce an immune response or immune rejection in a subject receiving the antibody transplant.

[0113] In some embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment according to the various embodiments disclosed herein is specific to ALPP / ALPPL2 and does not bind to proteins that have some degree of sequence homology with ALPP / ALPPL2, including, for example, intestinal alkaline phosphatase (ALPI) and / or biomineralization-associated alkaline phosphatase (ALPL).

[0114] In some embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment according to the various embodiments disclosed herein is specific to human ALPP / ALPPL2, i.e., it does not have cross-reactivity with ALPP / ALPPL2 from non-human species.

[0115] In some aspects, pharmaceutical compositions are provided comprising a recombinant anti-ALPP / ALPPL2 antibody or an antigen-binding fragment thereof according to the various embodiments disclosed and described herein. The pharmaceutical composition may also comprise one or more pharmaceutically acceptable carriers, excipients, preservatives, or combinations thereof. A “pharmaceutically acceptable carrier or excipient” means a pharmaceutically acceptable material, composition, or solvent involved in carrying or transporting a target compound from one tissue, organ, or site of the body to another tissue, organ, or site of the body. For example, a carrier or excipient may be a liquid or solid filler, diluent, excipient, solvent, or encapsulating material, or some combination thereof. Each component of the carrier or excipient must be “pharmaceutical acceptable” because it must be compatible with the other components of the formulation. It must also be suitable for contact with any tissue, organ, or site of the body it may encounter, meaning that it must not pose a risk of toxicity, irritation, allergic reactions, immunogenicity, or any other complication that outweighs its therapeutic benefit. Non-limiting examples of such carriers or excipients include, but are not limited to, water, saline, Ringer's solution, glucose solution, and 5% human serum albumin. Liposomes and non-aqueous solvents (such as non-volatile oils) can also be used for this purpose.

[0116] In some embodiments, pharmaceutical compositions can be formulated (e.g., injectable, lyophilized, liquid, or oral formulations) to be compatible with their intended route of administration. Examples of routes of administration include oral administration, in vitro administration, parenteral administration, intravenous administration, subcutaneous administration, intralesional administration (e.g., injection into a tumor), and administration to biological spaces infiltrated by the tumor (e.g., intraspinal, intracerebellar, intraperitoneal, intralymphatic, intranodal, and / or pleural administration). For example, the pharmaceutical compositions provided herein can be administered systemically via oral administration or intravenous administration (e.g., injection or infusion). Solutions or suspensions intended for parenteral, intradermal, or subcutaneous application may include the following components: sterile diluents such as water for injection, saline solution, non-volatile oils, polyethylene glycol, glycerin, propylene glycol, or other synthetic solvents; antibacterial agents such as benzyl alcohol or methylparaben; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid (EDTA); buffers such as acetates, citrates, or phosphates; and tonic agents such as sodium chloride or glucose. pH may be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. Parenteral preparations may be packaged in ampoules, disposable syringes, or multi-dose vials made of glass or plastic.

[0117] In some embodiments, the pharmaceutical composition may be co-formulated into the same dosage unit or may be formulated separately into separate dosage units. The term "dosage unit" herein refers to a formulation unit of a pharmaceutical composition containing an amount of therapeutic agent suitable for a single administration to provide a therapeutic effect. Such dosage units may be administered once or more daily (e.g., 1 to about 10, 1 to 8, 1 to 6, 1 to 4, or 1 to 2 times), or administered as needed to elicit a therapeutic response.

[0118] Nucleic acids, vectors, host cells and their combinations

[0119] In some aspects, nucleic acids are provided that comprise nucleotide sequences encoding recombinant anti-ALPP / ALPPL2 antibodies or antigen-binding fragments thereof according to various embodiments disclosed and described herein. The nucleic acids can be used (e.g., in the form of a vector) to transfect or transduce host cells, thereby causing the host cells to express the recombinant anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof. Exemplary nucleotide sequences used in this technique are provided in Table 2.

[0120] In some embodiments, the nucleic acid comprises a nucleotide sequence encoding an anti-ALPP / ALPPL2 antibody or an antigen-binding fragment thereof. In some embodiments, the nucleic acid comprises the nucleotide sequence of SEQ ID NO: 39 or a nucleotide sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO: 39. In some embodiments, the nucleic acid comprises the nucleotide sequence of SEQ ID NO: 40 or a nucleotide sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to SEQ ID NO: 40.

[0121] In some embodiments, the nucleic acid comprises a nucleotide sequence codon-optimized for a host cell (e.g., human cell) using techniques known to those skilled in the art. The codon-optimized sequence includes partially or fully codon-optimized sequences.

[0122] Table 2 lists exemplary nucleotide sequences encoding anti-ALPP / ALPPL2 antibodies or their antigen-binding fragments.

[0123] In some embodiments, the nucleic acid containing a nucleotide sequence encoding an anti-ALPP / ALPPL2 antibody or an antigen-binding fragment thereof may be present in the form of a vector (e.g., a plasmid or viral vector) or packaged into a virus for introduction into a host cell. The vector may be any type of vector suitable for introducing the nucleotide sequence into the host cell, including, for example, plasmids, adenovirus vectors, adeno-associated virus (AAV) vectors, retrovirus vectors, lentivirus vectors, bacteriophages, and donor vectors based on homology-directed repair (HDR). The virus may be any type of virus suitable for transducing and introducing the nucleotide sequence into the host cell, including, for example, adenoviruses, adeno-associated viruses (AAVs), retroviruses, lentiviruses, and bacteriophages. In some embodiments, the nucleotide sequence is in a vector (e.g., a viral vector) or virus, which, upon introduction into the host cell, facilitates the integration of the nucleotide sequence into the host cell's genome, thereby replicating together with the host genome. In some embodiments, such a nucleotide sequence may be present within the host cell, for example, integrated into the host cell's genome, for the production of encoded proteins within the host cell.

[0124] In some embodiments, nucleic acids according to the various embodiments disclosed herein may be delivered to host cells via one or more non-viral delivery methods and / or using one or more non-viral vectors, including but not limited to physical / mechanical methods, inorganic particles, and synthetic or natural biodegradable particles. Non-limiting examples of physical / mechanical methods include needle injection, ballistic injection, gene gun, electroporation, sonoporation, photoporation, optoporation, magnetic transfection, and hydroporation. Non-limiting examples of inorganic particles include calcium phosphate, silica, gold, and magnetic particles. Non-limiting examples of synthetic or natural biodegradable particles include polymer-based non-viral vectors (e.g., polylactic acid-co-glycolic acid, polylactic acid, polyethyleneimine, chitosan, dendritic polymers, polymethacrylate), cationic lipid-based non-viral vectors (e.g., cationic liposomes, cationic emulsions, solid lipid nanoparticles), and peptide-based non-viral vectors (e.g., poly-L-lysine).

[0125] In some embodiments, the nucleic acids according to the various embodiments disclosed herein can be efficiently linked to certain regulatory elements of the vector. As those skilled in the art know, expression vectors are typically engineered to contain polynucleotide sequences that are required to influence the expression and processing of the coding sequences to which they are efficiently linked. Expression control sequences may include suitable transcription initiation, termination, promoter, and enhancer sequences; effective RNA processing signals, such as splicing and polyadenylation signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency; sequences that enhance protein stability; and sequences that may enhance protein secretion. If the expression regulatory sequences are adjacent to the target gene, or if these expression regulatory sequences regulate the target gene in a trans-acting or long-distance manner, they can be efficiently linked together.

[0126] In some implementations, the vector may contain a promoter that drives constitutive gene expression in a host cell (e.g., a mammalian cell). Commonly used promoters include, for example, the elongation factor 1α (EF1α) promoter, the cytomegalovirus (CMV) immediate early promoter (Greenaway et al., Gene 18: 355-360 (1982)), the simian vacuolating virus 40 (SV40) early promoter (Fiers et al., Nature 273:113-120 (1978)), the spleen focal formation virus (SFFV) promoter, the phosphoglycerate kinase (PGK) promoter (Adra et al., Gene 60(1):65-74 (1987)), the human β-actin promoter, the polyubiquitin C gene (UBC) promoter, and the CAG promoter (Nitoshi et al., Gene 108:193-199 (1991)).

[0127] In some implementations, the vector may contain an inducible promoter. Unlike constitutive promoters, inducible promoters can switch between on and off states in response to certain stimuli (e.g., chemical reagents, temperature, light) and can be regulated in a tissue- or cell-specific manner. Commonly used non-limiting examples of inducible promoters include the tetracycline-on (Tet-On) system and the tetracycline-off (Tet-Off) system, which utilize a tetracycline response element (TRE) located upstream of a minimal promoter (e.g., the CMV promoter) (Gossen & Bujard, Proc. Natl. Acad. Sci. USA 89(12):5547-5551(1992)). The TRE consists of seven repeats of a 19-nucleotide tetracycline operon (tetO) sequence and is recognized by a tetracycline repressor protein (tetR). In the Tet-Off system, a tetracycline-controlled transactivator protein (tTA) was developed by fusing tetR with the activation domain of herpes simplex virus virosomal protein 16. In the absence of tetracycline or its analogues (e.g., doxycycline), tTA binds to the tetO sequence of the TRE and drives expression; in the presence of tetracycline, rTA binds to tetracycline but not to the TRE, resulting in decreased gene expression. Conversely, in the Tet-On system, the inverse transactivator protein (rtTA) is generated by mutagenesis of key amino acid residues that repress tetracycline-dependently, which binds to the TRE and drives gene expression in the presence of tetracycline or doxycycline (Gossen et al., Science 268(5218):1766-1769 (1995)). Other examples of inducible promoters include, for example, AlcA, LexA, and Cre.

[0128] In some embodiments, the vector also includes a Kozak consortium sequence, typically located upstream of the coding sequence. The Kozak consortium sequence is a nucleic acid motif that acts as a protein translation initiation site in most eukaryotic mRNA transcripts and mediates ribosome assembly and translation initiation. In some embodiments, the Kozak consortium sequence comprises or consists of the sequence (gcc)gccrccatgg (SEQ ID NO: 41), where R is a purine (i.e., a or g). In this disclosure, sequences enclosed in parentheses “()” are optional.

[0129] In some embodiments, the vector further comprises a post-transcriptional regulatory element (WPRE) of marmot hepatitis virus (WHV), optionally located after the coding sequence. A WPRE is a DNA sequence that produces a tertiary structure that enhances expression during transcription. WPRE sequences are commonly used to increase the expression of genes delivered by viral vectors. In some embodiments, the WPRE sequence comprises or consists of the nucleotide sequence of SEQ ID NO: 42 or a nucleotide sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical) to or constitutes thereof: aatcaacctctggattacaaaatttgtgaaagattgactggtattcttaactatgttgctccttttacgctatgtggatacgctgctttaatgcctttgtatcatgctattgcttcccgtatggctttcattttctcctccttgtat aaatcctggttgctgtctctttatgaggagttgtggcccgttgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagctcctttccgggactttcgctttcccc ctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggacaggggctcggctgttgggcactgacaattccgtggtgttgtcggggaaatcatcgtcctttccttggctgctcgcctgtgttgccacctggatt ctgcgcgggacgtccttctgctacgtcccttcggccctcaatccagcggaccttccttcccgcggcctgctgccggctctgcggcctcttccgcgtcttcgccttcgccctcagacgagtcggatctccctttgggccgcctccccgc (SEQ ID NO:42).

[0130] In some aspects, according to the various embodiments disclosed herein, a host cell, such as a bacterial, yeast, or mammalian cell, is provided containing a nucleic acid comprising a nucleotide sequence encoding an anti-ALPP / ALPPL2 antibody or an antigen-binding fragment thereof, and / or expressing an anti-ALPP / ALPPL2 antibody or an antigen-binding fragment thereof.

[0131] In some embodiments, a vector, virus, or host cell comprising a nucleotide sequence encoding an anti-ALPP / ALPPL2 antibody or an antigen-binding fragment thereof according to the various embodiments disclosed herein may be present in the composition. In some embodiments, the composition may also comprise one or more pharmaceutically acceptable carriers, excipients, preservatives, or combinations thereof. A “pharmaceutically acceptable carrier or excipient” refers to a pharmaceutically acceptable material, composition, or solvent involved in carrying or transporting a target compound from one tissue, organ, or site of the body to another tissue, organ, or site of the body. For example, a carrier or excipient may be a liquid or solid filler, diluent, excipient, solvent, or encapsulating material, or a combination thereof. Each component of the carrier or excipient must be “pharmaceutically acceptable” because it must be compatible with the other components of the formulation. It must also be suitable for contact with any tissue, organ, or site of the body it may encounter, meaning it must not pose a risk of toxicity, irritation, allergic reactions, immunogenicity, or any other complication that outweighs its therapeutic benefit. Suitable excipients include water, saline, glucose, glycerol, and combinations thereof.

[0132] ADC and its compositions

[0133] In some aspects, an ADC is provided, comprising (1) an antibody or antigen-binding fragment thereof that specifically recognizes or binds to ALPP and / or ALPPL2; and (2) one or more payloads, wherein the anti-ALPP / ALPPL2 antibody or antigen-binding fragment thereof is linked to each of the one or more payloads via a linker. An ADC may have a general formula as shown in formula (I): (I) Where Ab is an antibody or its antigen-binding fragment (e.g., anti-ALPP / ALPPL2 antibody or its antigen-binding fragment), L is a linker, D is the payload, and z is an integer from 1 to 20. The linker may be covalently linked to the antibody or its antigen-binding fragment, and the payload may be covalently linked to the linker, for example, by means of nitrogen or oxygen present in the payload. The LD fragment of the ADC may be referred to herein as the "linker payload".

[0134] In some implementations, the ADC has the following structure:

[0135] Where Ab is an antibody or its antigen-binding fragment (e.g., an anti-ALPP / ALPPL2 antibody or its antigen-binding fragment), D is the payload, n is an integer from 1 to 20, and z is an integer from 1 to 20. In these embodiments, the linker has an L1A structure: (L1A) Where D is the payload and n is an integer from 1 to 20, such as 1, 2, 3, 4, 5 or 6.

[0136] In some implementations, the ADC has the following structure:

[0137] Where Ab is an antibody or its antigen-binding fragment (e.g., an anti-ALPP / ALPPL2 antibody or its antigen-binding fragment), D is the payload, n is an integer from 1 to 20, and z is an integer from 1 to 20. In these embodiments, the linker has an L1B structure: (L1B) Where D is the payload and n is an integer from 1 to 20, such as 1, 2, 3, 4, 5 or 6.

[0138] In some implementations, the ADC has the following structure:

[0139] Where Ab is an antibody or its antigen-binding fragment (e.g., an anti-ALPP / ALPPL2 antibody or its antigen-binding fragment), D is the payload, n is an integer from 1 to 20, and z is an integer from 1 to 20. In these embodiments, the linker has an L2A structure: (L2A) Where D is the payload and n is an integer from 1 to 20, such as 1, 2, 3, 4, 5 or 6.

[0140] In some implementations, the ADC has the following structure:

[0141] Where Ab is an antibody or its antigen-binding fragment (e.g., an anti-ALPP / ALPPL2 antibody or its antigen-binding fragment), D is the payload, n is an integer from 1 to 20, and z is an integer from 1 to 20. In these embodiments, the linker has an L2B structure: (L2B) Where D is the payload and n is an integer from 1 to 20, such as 1, 2, 3, 4, 5 or 6.

[0142] In some implementations, the ADC has the following structure:

[0143] Where Ab is an antibody or its antigen-binding fragment (e.g., anti-ALPP / ALPPL2 antibody or its antigen-binding fragment), D is the payload, n is an integer from 1 to 20, and z is an integer from 1 to 20. In these embodiments, the linker has an L3A structure: (L3A) Where D is the payload and n is an integer from 1 to 20, such as 1, 2, 3, 4, 5 or 6.

[0144] In some implementations, the ADC has the following structure:

[0145] Where Ab is an antibody or its antigen-binding fragment (e.g., an anti-ALPP / ALPPL2 antibody or its antigen-binding fragment), D is the payload, n is an integer from 1 to 20, and z is an integer from 1 to 20. In these embodiments, the linker has an L3B structure: (L3B) Where D is the payload and n is an integer from 1 to 20, such as 1, 2, 3, 4, 5 or 6.

[0146] In some implementations, the ADC has the following structure:

[0147] Where Ab is an antibody or its antigen-binding fragment (e.g., an anti-ALPP / ALPPL2 antibody or its antigen-binding fragment), D is the payload, and z is an integer from 1 to 20. In these embodiments, the linker has an L4 structure: (L4) Where D is the effective payload.

[0148] In some implementations, the ADC has the following structure:

[0149] Where Ab is an antibody or its antigen-binding fragment (e.g., an anti-ALPP / ALPPL2 antibody or its antigen-binding fragment), D is the payload, and z is an integer from 1 to 20. In these embodiments, the linker has an L5 structure: (L5) Where D is the effective payload.

[0150] In some implementations, the ADC has the following structure:

[0151] Where Ab is an antibody or its antigen-binding fragment (e.g., an anti-ALPP / ALPPL2 antibody or its antigen-binding fragment), D is the payload, and z is an integer from 1 to 20. In these embodiments, the linker has an L6 structure: (L6) Where D is the effective payload.

[0152] In some implementations, the ADC has the following structure:

[0153] Where Ab is an antibody or its antigen-binding fragment (e.g., an anti-ALPP / ALPPL2 antibody or its antigen-binding fragment), D is the payload, and z is an integer from 1 to 20. In these embodiments, the linker has an L7 structure: (L7) Where D is the effective payload.

[0154] In some implementations, the ADC has the following structure:

[0155] Where Ab is an antibody or its antigen-binding fragment (e.g., an anti-ALPP / ALPPL2 antibody or its antigen-binding fragment), D is the payload, and z is an integer from 1 to 20. In these embodiments, the linker has an L8 structure: (L8) Where D is the effective payload.

[0156] As is known to those skilled in the art, other linkers commonly used and / or suitable for linking payloads to antibodies or their antigen-binding fragments may be used in this technique, including, for example, the structures provided in Table 3: Table 3. Other exemplary connection substructures

[0157] Where D is the effective payload.

[0158] In some embodiments, the payload fragment of the ADC comprises a cytotoxic agent or an anticancer agent. In some embodiments, the payload comprises monomethylolpropionate E (MMAE), DXd / exatecan, trabectedin, lurbinectedin, and / or derivatives of any of the foregoing substances. In any embodiment, a pharmaceutically acceptable salt, ester, solvate, tautomer, or stereoisomer of the particular agent may also be used.

[0159] In some embodiments, the payload comprises MMAE or a derivative thereof. MMAE is a potent antimitotic drug that inhibits cell division by blocking the polymerization of microtubules. MMAE is typically linked to a monoclonal antibody that directs it to cancer cells expressing the target of the monoclonal antibody binding. MMAE and its derivatives have the general formula shown in formula (II) below:

[0160] (II)

[0161] R can be a sugar (e.g., a monosaccharide) that is bound to MMAE via an O-glycosidic bond. Non-limiting examples of sugars or monosaccharides include β-D-galactose, N-acetyl-β-D-galactosamine, N-acetyl-α-D-galactosamine, N-acetyl-β-D-glucosamine, β-D-glucuronic acid, α-L-iduronic acid, α-D-galactose, α-D-glucose, β-D-glucose, α-D-mannose, β-D-mannose, α-L-fucose, β-D-xylose, neuraminic acid, and products of any of the foregoing substances modified with sulfate, phosphate, carboxyl, amino, or O-acetyl groups.

[0162] In some embodiments, MMAE or its derivatives have the structure of P1 or P2 provided in Table 4.

[0163] In some embodiments, the payload comprises exatecan, Dxd, or a derivative thereof. Exatecan is a structural analog of camptothecin with antitumor activity. Dxd is an exatecan derivative for use in ADCs. Both are potent inhibitors of DNA topoisomerase I. In some embodiments, Dxd / exatecan or a derivative thereof has the structure of any one of P3-P5 provided in Table 4.

[0164] In some embodiments, the payload comprises lurbinectedin or a derivative thereof. Lubricectedin is a synthetic tetrahydropyrrolo[4,3,2-de]quinoline-8(1H)-one alkaloid analog with antitumor activity. Lubricectedin covalently binds to residues located in the minor groove of DNA, which may lead to delayed S phase progression, cell cycle arrest in G2 / M phase, and cell death. Lubricectedin is marketed under the brand name ZEPZELCA®, an approved drug for the treatment of small cell lung cancer. In some embodiments, lurbinectedin and its derivatives have the general formula of formula (III) shown below: (III) in: R1 is -OH, -F, -Cl, -Br, -I, -NO2, -NH2, -COOH, carbonyl (-C(=O)R5), carboxyl (-C(=O)OR6 or -C≡N); preferably carbonyl, -OH, -NO2, -F or -C≡N; more preferably -OH, -F or -C≡N; and most preferably -OH or -C≡N, wherein R5 and R6 are independently H or aryl; R2 is either -H or -X (CH2). p C(=O) 0-1 (CH2) q (C(R7)2) 0-1 (X) 0-1 R8, where p and q are independent integers selected from 0 to 10, X is 0 or NH, and R7 and R8 are independent H or C. 1-4 alkyl; R3 is either -H or -X (CH2). m C(=O) 0-1 (CH2) n (C(R9)2) 0-1 (X) 0-1 R 10 Where m and n are independent integers selected from 0 to 10, X is 0 or NH, and R9 and R 10 Independently H or C 1-4 Alkyl groups; and R4 is -H or C 1-4 alkyl, Optionally, the following combinations of R2, R3, and R4 are excluded from equation (III): R2 is -H, R3 is -H, and R4 is -H; and R2 is -OCH3, R3 is -H, and R4 is -H.

[0165] Unless otherwise specified, the term "alkyl" as used herein refers to an unsubstituted saturated hydrocarbon group (branched or unbranched). Where specified, the carbon number refers to all carbons present in the group, including carbons in the side chains. For example, the term "C 1-4 Alkyl groups include -CH3, -CH2CH3, -CH2CH2CH3 (n-propyl), -CH(CH3)2 (isopropyl), -CH2CH2CH2CH3 (n-butyl), -CH2CH2CH(CH3)2 (isobutyl), -CH(CH3)CH2CH3 (sec-butyl) and -CH(CH3)3 (tert-butyl).

[0166] Alternatively, in some embodiments, rubitidine and its derivatives have the general formula shown in formula (IV) below: (IV) in: R1 is -OH, -F, -Cl, -Br, -I, -NO2, -NH2, -COOH, carbonyl (-C(=O)R5), carboxyl (-C(=O)OR6 or -C≡N); preferably carbonyl, -OH, -NO2, -F or -C≡N; more preferably -OH, -F or -C≡N; and most preferably -OH or -C≡N, wherein R5 and R6 are independently H or aryl; R2 is either -H or -X (CH2). p C(=O) 0-1 (CH2) q (C(R7)2) 0-1 (X) 0-1 R8, where p and q are independent integers selected from 0 to 10, X is 0 or NH, and R7 and R8 are independent H or C. 1-4 alkyl; R3 is either -H or -X (CH2). m C(=O) 0-1 (CH2) n (C(R9)2) 0-1 (X) 0-1 R 10 Where m and n are independent integers selected from 0 to 10, X is 0 or NH, and R9 and R 10 Independently H or C 1-4 Alkyl groups; and R4 is -H or -CH2NHR 11 , where R 11 For H or C 1-4 alkyl.

[0167] In some embodiments, rubitidine or its derivatives have the structure of P6 provided in Table 4.

[0168] In some implementations, the payload comprises trabectedin or a derivative thereof. Trabectedin is a chemotherapeutic agent marketed under the brand name YONDELIS® for the treatment of advanced soft tissue sarcoma and ovarian cancer. Trabectedin and its derivatives have the general formula shown in formula (V) below: (V) in: R1 is -OH, -F, -Cl, -Br, -I, -NO2, -NH2, -COOH, carbonyl (-C(=O)R6), carboxyl (-C(=O)OR7 or -C≡N); preferably carbonyl, -OH, -NO2, -F or -C≡N; more preferably -OH, -F or -C≡N; and most preferably -OH or -C≡N, wherein R6 and R7 are independently H or aryl; R2 is either -H or -X (CH2). p C(=O) 0-1 (CH2) q (C(R8)2) 0-1 (X) 0-1 R9, where p and q are independent integers selected from 0 to 10, X is 0 or NH, and R8 and R9 are independent H or C. 1-4 alkyl; R3 is either -H or -X (CH2). m C(=O) 0-1 (CH2) n (C(R 10 )2) 0-1 (X) 0-1 R 11 Where m and n are independent integers selected from 0 to 10, X is 0 or NH, and R 10 and R 11 Independently H or C 1-4 Alkyl groups; and R4 is -H, -CH2OR 12 -CH2NHR 13 or -CH2C(=O)OR 14 , where R 12 R 13 And R 14 Independently H or C 1-4 Alkyl groups; and R5 is -H or C 1-4 alkyl, Optionally, the following combinations of R2, R3, R4, and R5 are excluded from equation (V): R2 is -OCH3, R3 is -OH, R4 is -H, and R5 is -H.

[0169] In some embodiments, trabectedin or its derivatives have the structure of any one of P7-P12 provided in Table 4.

[0170] Table 4. Exemplary Payload Structures

[0171] The connector payload fragment of an ADC may contain any combination of any connector and any payload disclosed herein. Table 8 provides exemplary connector payloads that can be used in this technology.

[0172] In some aspects, pharmaceutical compositions comprising an ADC according to various embodiments disclosed and described herein are provided. The pharmaceutical composition may also comprise one or more pharmaceutically acceptable carriers, excipients, preservatives, or combinations thereof. For example, the carrier or excipient may be a liquid or solid filler, diluent, excipient, solvent, or encapsulating material, or some combination thereof. Non-limiting examples of such carriers or excipients include, but are not limited to, water, saline, Ringer's solution, glucose solution, and 5% human serum albumin. Liposomes and non-aqueous solvents (e.g., non-volatile oils) may also be used for this purpose.

[0173] In some embodiments, pharmaceutical compositions can be formulated (e.g., injectable, lyophilized, liquid, or oral formulations) to be compatible with their intended route of administration. Examples of routes of administration include oral administration, in vitro administration, parenteral administration, intravenous administration, subcutaneous administration, intralesional administration (e.g., injection into a tumor), and administration to biological spaces infiltrated by the tumor (e.g., intraspinal, intracerebellar, intraperitoneal, intralymphatic, intranodal, and / or pleural administration). For example, the pharmaceutical compositions provided herein can be administered systemically via oral administration or intravenous administration (e.g., injection or infusion). Solutions or suspensions intended for parenteral, intradermal, or subcutaneous application may include the following components: sterile diluents such as water for injection, saline solution, non-volatile oils, polyethylene glycol, glycerin, propylene glycol, or other synthetic solvents; antibacterial agents such as benzyl alcohol or methylparaben; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid (EDTA); buffers such as acetates, citrates, or phosphates; and tonic agents such as sodium chloride or glucose. pH may be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. Parenteral preparations may be packaged in ampoules, disposable syringes, or multi-dose vials made of glass or plastic.

[0174] In some embodiments, the pharmaceutical composition may be co-formulated into the same dosage unit or may be formulated separately into separate dosage units. The term "dosage unit" herein refers to a formulation unit of a pharmaceutical composition containing an amount of therapeutic agent suitable for a single administration to provide a therapeutic effect. Such dosage units may be administered once or more daily (e.g., 1 to about 10, 1 to 8, 1 to 6, 1 to 4, or 1 to 2 times), or administered as needed to elicit a therapeutic response.

[0175] Treatment

[0176] In some aspects, methods are provided for in vitro inhibition of the growth of cells (e.g., cancer cells) expressing ALPP and / or ALPPL2. According to various embodiments disclosed herein, the methods include contacting cells with an effective amount of an anti-ALPP / ALPPL2 antibody or an antigen-binding fragment thereof, an ADC comprising an anti-ALPP / ALPPL2 antibody or an antigen-binding fragment thereof linked to a payload via a linker, or a pharmaceutical composition comprising the thereof.

[0177] In some aspects, methods are provided for treating and / or preventing disease in a subject in need. According to various embodiments disclosed herein, the methods include administering to a subject a therapeutically effective or clinically effective amount of an anti-ALPP / ALPPL2 antibody or an antigen-binding fragment thereof, an ADC comprising an anti-ALPP / ALPPL2 antibody or an antigen-binding fragment thereof linked to a payload via a linker, or a pharmaceutical composition comprising the latter. The subject may be a mammal, such as, but not limited to, primates (e.g., humans and non-human primates such as chimpanzees, baboons, or monkeys), dogs, cats, pigs, sheep, rabbits, mice, and rats. In some embodiments, the subject is a human.

[0178] In some implementations, the disease is cancer, including, for example, cancers that express ALPP and / or ALPPL2 or carry ALPP and / or ALPPL2 antigens, or cancers that involve or depend on the signaling of ALPP and / or ALPPL2.

[0179] In some implementations, the cancer is a solid tumor. Non-limiting examples of solid tumors include pancreatic cancer, glioma, glioblastoma, colorectal cancer, thyroid cancer, gastric cancer, ovarian cancer, melanoma, endometrial cancer, lung cancer, kidney cancer, cervical cancer, prostate cancer, breast cancer, urothelial carcinoma, testicular cancer, head and neck cancer, liver cancer, esophageal cancer, and other types of solid tumors. In some implementations, the cancer is mesothelioma, ovarian cancer, pancreatic cancer, endometrial cancer, non-small cell lung cancer, gastric cancer, gastroesophageal junction cancer, cervical cancer, colorectal cancer, or testicular cancer.

[0180] Those skilled in the art are capable of selecting appropriate routes of administration, such as oral, in vitro, parenteral, intravenous, subcutaneous, intralesional (e.g., injection into the tumor), and administration to tumor-infiltrating biological spaces (e.g., intraspinal, intracerebellar, intraperitoneal, intralymphatic, intranodal, and / or pleural). For the treatment of subjects in need, anti-ALPP / ALPPL2 antibodies or their antigen-binding fragments, ADCs, or pharmaceutical compositions containing them may be administered continuously or intermittently to achieve immediate, controlled, or sustained-release effects.

[0181] In some embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment, ADC, or pharmaceutical composition containing them is administered to the subject in doses ranging from about 0.1 mg / kg to about 30 mg / kg, 0.1 mg / kg to about 10 mg / kg, or 0.1 mg / kg to about 3 mg / kg, for example, doses of about 0.1 mg / kg, about 0.2 mg / kg, about 0.3 mg / kg, about 0.4 mg / kg, about 0.5 mg / kg, about 0.6 mg / kg, about 0.7 mg / kg, about 0.8 mg / kg, about 0.9 mg / kg, about 1 mg / kg, about 2 mg / kg, about 3 mg / kg, about 4 mg / kg, about 5 mg / kg, about 6 mg / kg, about 7 mg / kg, about 8 mg / kg, about 9 mg / kg, about 10 mg / kg, about 15 mg / kg, about 20 mg / kg, about 25 mg / kg, or about 30 mg / kg. In some implementations, a single dose or multiple doses may be administered to the subject. In some implementations, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment, ADC, or pharmaceutical composition containing the same may be administered once or more daily.

[0182] In some implementations, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment, ADC, or pharmaceutical composition containing it is administered to the subject once, twice, three times, or four times daily for approximately 1 day, approximately 2 days, approximately 3 days, approximately 5 days, approximately 7 days, approximately 10 days, approximately 2 weeks, approximately 3 weeks, approximately 4 weeks, approximately 1 month, approximately 2 months, approximately 3 months, approximately 4 months, approximately 5 months, approximately 6 months, approximately 7 months, approximately 8 months, approximately 9 months, approximately 10 months, approximately 11 months, approximately 1 year, approximately 2 years, approximately 3 years, approximately 4 years, approximately 5 years, or more than approximately 5 years. In some implementations, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment, ADC, or pharmaceutical composition containing it may be administered daily, every other day, three times a week, every three days, weekly, every two weeks (i.e., every other week), every three weeks, monthly, every month, every three months, every four months, every five months, every six months, every nine months, annually, every 18 months, every two years, every five years, every ten years, or every 20 years. In some implementations, the above dosage regimens may be repeated for approximately one week, approximately one month, approximately two months, approximately three months, approximately four months, approximately five months, approximately six months, approximately seven months, approximately eight months, approximately nine months, approximately ten months, approximately eleven months, approximately one year, approximately two years, approximately three years, approximately four years, approximately five years, or more than approximately five years later. In some embodiments, the administration schedule is a combination of these times; for example, an anti-ALPP / ALPPL2 antibody or its antigen-binding fragment, an ADC, or a pharmaceutical composition containing it is administered multiple times weekly, and this pattern is repeated multiple times monthly or every two, three, four, five, or six months, and as described above, the duration of treatment varies from a portion of a year to several years depending on this pattern. In some embodiments, the anti-ALPP / ALPPL2 antibody or its antigen-binding fragment, an ADC, or a pharmaceutical composition containing it is administered in a cycle, multiple times within one or two weeks, and as described above, this cycle is repeated at intervals over months or years. In some embodiments, treatment continues until the disease is eliminated, until no further improvement is achieved, or as long as the disease does not progress. In some embodiments, any suitable method known to a person skilled in the art can be used to monitor the cancer in the subject to be treated to evaluate the effectiveness of the treatment. For example, imaging techniques or laboratory assays can be used to assess the number of cancer cells and / or the size of the tumor in the subject. They can also be used to assess the location of cancer cells and / or the tumor in the subject.

[0183] In some embodiments, an anti-ALPP / ALPPL2 antibody or its antigen-binding fragment, an ADC, or a pharmaceutical composition containing the same is administered over a predetermined period of time. Alternatively, an anti-ALPP / ALPPL2 antibody or its antigen-binding fragment, an ADC, or a pharmaceutical composition containing the same is administered until a specific therapeutic benchmark is reached. In some embodiments, the methods provided herein also include the step of evaluating one or more therapeutic benchmarks in a biological sample, such as, but not limited to, the levels of cancer biomarkers, to determine whether treatment should continue.

[0184] In some embodiments, the method further includes administering one or more other cancer therapies, such as surgery, immunotherapy, radiotherapy, and / or chemotherapy, to the subject sequentially or simultaneously.

[0185] In some embodiments, the method further includes administering to the subject a pharmaceutically or clinically effective amount of one or more additional anticancer therapies to achieve an improved or synergistic therapeutic effect. Examples of one or more additional anticancer therapies include, but are not limited to, biologics (e.g., therapeutic antibodies and ADCs), chemotherapy, radiotherapy, endocrine therapy, targeted molecular agents, and immunotherapy. In some embodiments, one or more additional anticancer therapies comprise chemotherapy and / or radiotherapy. In some embodiments, one or more additional anticancer therapies or agents are selected from immunotherapy, chemotherapy, and biologics. Examples of therapeutic agents used in chemotherapy include, but are not limited to, platinum compounds (e.g., cisplatin or carboplatin), taxanes (e.g., paclitaxel, docetaxel, or albumin-bound paclitaxel such as nab-paclitaxel), hexamethylmelamine, capecitabine, alkylating agents (e.g., cyclophosphamide, ifosfamide, melphalan, nitrogen mustard, chlorambucil, or thiotepa), etoposide (VP-16), gemcitabine, irinotecan (CPT-11), anthracyclines (e.g., liposomal doxorubicin, daunorubicin, epirubicin, or idarubicin), pemetrexed, topotecan, vinblastine alkaloids and their derivatives (e.g., vincristine or vinorelbine), and any combination thereof. In some embodiments, corticosteroids are used in combination with chemotherapeutic agents. Examples of other anticancer agents include, but are not limited to, luteinizing hormone-releasing hormone (LHRH) agonists (e.g., goserelin and leuprorelin), anti-estrogens (e.g., tamoxifen), aromatase inhibitors (e.g., letrozole, anastrozole, and exemestane), angiogenesis inhibitors (e.g., bevacizumab), poly(ADP)-ribose polymerase (PARP) inhibitors (e.g., olaparib, rucaparib, and niraparib), and radioactive phosphorus. Examples of biologics include, but are not limited to, checkpoint inhibitors (e.g., anti-CTLA-4 antibodies, anti-PD-1 antibodies, or anti-PD-L1 antibodies), cytokines (e.g., IL-2, IL-12, or IL-15), other bispecific antibodies, and any combination thereof.

[0186] In some embodiments, one or more other anticancer agents are administered to the subject prior to administration of an anti-ALPP / ALPPL2 antibody or its antigen-binding fragment, ADC, or pharmaceutical composition containing the same. In some embodiments, one or more other anticancer agents and an anti-ALPP / ALPPL2 antibody or its antigen-binding fragment, ADC, or pharmaceutical composition containing the same are co-administered to the subject. In some embodiments, one or more other anticancer agents are administered to the subject after administration of an anti-ALPP / ALPPL2 antibody or its antigen-binding fragment, ADC, or pharmaceutical composition containing the same. As will be understood by those skilled in the art, one or more additional anticancer agents and anti-ALPP / ALPPL2 antibodies or their antigen-binding fragments, ADCs, or pharmaceutical compositions containing the same may be administered once or multiple times to a subject in need, at the same or different doses, depending on the subject's diagnosis and prognosis. If a subject is administered more than one dose of an anti-ALPP / ALPPL2 antibody or its antigen-binding fragment, ADC, or pharmaceutical composition containing the same, one or more additional anticancer therapies may be administered before or after all said doses, and / or between doses. Those skilled in the art can combine one or more of these therapies in different sequences to achieve the desired therapeutic outcome.

[0187] Example

[0188] Example 1. Humanization and optimization of mouse anti-ALPP / ALPPL2 antibody H17E2

[0189] In this study, the original mouse anti-ALPP / ALPPL2 antibody H17E2 was humanized and / or optimized to generate a novel antibody for use in this technology. The antigen specificity, cross-reactivity with non-human species, and hydrophobicity of the original H17E2 antibody and the humanized / optimized antibody were tested.

[0190] First, the original mouse antibody H17E2 was tested. For example... Figure 1 As shown, H17E2 (AT04-5A) is selective for ALPPL2 and ALPP, but not for ALPI and ALPL. H17E2 (AT04-5A) cross-reacts with monkey ALPPL2, but not with mouse ALPPL2. Figure 2 When tested on cell lines, such as by flow cytometry, H17E2 (AT04-5A) strongly binds to Lovo (colorectal cancer) and NCI-N87 (gastric cancer), weakly binds to SKOV3 (ovarian cancer), but does not bind to other cell lines including 293T (embryonic kidney), A549 (lung cancer), BT549 (breast cancer), and MCF7 (breast cancer). Figure 3Then, H17E2 was analyzed by hydrophobic interaction chromatography (HIC). The HIC retention time of the antibody was 21.83 min, indicating that it has strong hydrophobicity. Figure 4 ).

[0191] Subsequently, steps were taken to humanize the H17E2 antibody. Six constructs (AT04-10A to AT04-15A) were prepared from two humanized light chain designs (VL1 and VL2) and three humanized heavy chain designs carrying different mutations in FR (VH4, VH5, and VH6) (see [link to documentation]). Figure 5A Table 5). ELISA was performed to detect the binding of humanized antibodies to ALPPL2; the results showed that all six constructs exhibited improved binding to ALPPL2 compared to the parental H17E2 antibody. Figure 5B After humanization, the hydrophobicity of the antibodies was tested on a HIC column. All antibodies showed shorter retention times (less hydrophobic) than the parental H17E2 antibody. Figure 6 ).

[0192] Table 5 Parental H17E2 and Humanized Anti-ALPP / ALPPL2 Antibodies

[0193] Next, antibody AT04-13A (construct VH4 VL2) was selected as a starting point to develop further optimized antibodies, such as by performing PTM removal to improve its developability. Eight constructs (AT04-16A to AT04-23A) were prepared in which either D54 or G55 residues were mutated (referring to the amino acid position of the variable region of the heavy chain of the original H17E2 antibody (SEQ ID NO: 1)) to avoid antibody isomerization (see [link to original H17E2 antibody heavy chain variable region SEQ ID NO: 1]). Figure 7A (Table 6). ELISA was performed on the constructed constructs, and most constructs retained good binding with ALPPL2 ( Figure 7B ).

[0194] Table 6. Optimized anti-ALPP / ALPPL2 antibodies

[0195] HIC analysis of the optimized antibody showed that the HIC retention time was similar to that before PTM removal, and the optimized antibody was less hydrophobic than the parental H17E2 antibody. Figure 8 ).

[0196] To further engineer the antibody, which has reactive cysteine ​​residues for drug conjugation, mutations were made at one or more of the following sites in the original H17E2 antibody heavy chain sequence (SEQ ID NO: 34): A121C, K150C, V205C, C223S, S242C, D268C, A330C, and S443C. For example, antibodies AT04-25A and AT04-26A were generated (see Table 7).

[0197] Table 7. Cysteine-modified anti-ALPP / ALPPL2 antibodies

[0198] Figure 9 Surface plasmon resonance (SPR) analyses of the parental H17E2 antibody (AT04-5A) and selected humanized / optimized antibodies (AT04-13A, AT04-23A, and AT04-26A) are shown. Specifically, AT04-23 showed a higher binding affinity than the parental H17E2 antibody (AT04-5A). Figure 10 The parental H17E2 (AT04-5A) and selected humanized / optimized antibodies (AT04-13A, AT04-23A, and AT04-26A) were shown to be specific for ALPPL2, ALPP, and similar enzymes such as ALPI and ALPL. An isotype control (ITC) antibody lacking target specificity was used as a negative control. Figure 11 Cross-reactivity of parental H17E2 (AT04-5A) and selected humanized / optimized antibodies (AT04-13A, AT04-23A, and AT04-26A) with mouse and monkey ALPPL2 was demonstrated. All antibodies retained similar binding specificity and selectivity to the parental H17E2 antibody (AT04-5A). Figure 10-11 ).in addition, Figure 12 This study demonstrates optimized antibody internalization into cells expressing ALPPL2.

[0199] In summary, these data demonstrate that the humanized and / or optimized anti-ALPP / ALPPL2 antibodies developed in this study retain high antigenicity and species selectivity, and further exhibit improved hydrophilicity, yield, and reduced aggregation tendency, making them suitable for therapeutic use either on their own or in the development of ADCs.

[0200] Example 2. Development of ADC using humanized / optimized anti-ALPP / ALPPL2 antibody

[0201] In this study, the humanized and / or optimized anti-ALPP / ALPPL2 antibody developed in Example 1 was used to generate an ADC with a payload to target cells carrying the ALPP / ALPPL2 antigen.

[0202] First, the ADC is generated by coupling the payload to the anti-ALPP / ALPPL2 antibody via a linker using the following general steps. Figure 13 Exemplary connector payloads for the ADC generated below are shown (top structure, see Table 8, LP26; bottom structure, see Table 8, LP14).

[0203] General coupling steps for ADC preparation (maleimide coupling)

[0204] Place the monoclonal antibody (1 equivalent) in a centrifuge tube, then add 25 mM Na₂B₄O₇, 25 mM NaCl, and 1 mM DTPA pH 7.4 buffer to dilute the antibody concentration to 3–4 mg / mL. Add 2 mg / mL of TCEP (3 to 9 equivalents) aqueous solution to the mixture for antibody reduction. After vortexing, place the reaction mixture on a thermostat and reduce at 37°C for 2.0 h. Add 10 mg / mL of linker payload (3 to 12 equivalents) in DMSO, and add DMSO at 10% of the final total volume of the reaction solution. After vortexing, place the solution on a thermostat and couple at 25°C for 1.0 h.

[0205] Uncoupled residual linker payloads in the reaction solution were removed using a Zeba centrifugal desalting column (MWCO 40K). The flow-through containing the desired ADC was ultrafiltered 3–4 times using a Pierce PES protein concentrator (MWCO 50K) to replace the buffer in the appropriate storage buffer. The final product was stored at -80°C.

[0206] A common coupling step for the preparation of ADCs (allenamide coupling)

[0207] Place the monoclonal antibody (1 equivalent) in a centrifuge tube, then add 25 mM Na₂B₄O₇, 25 mM NaCl, and 1 mM DTPA pH 7.4 buffer to dilute the antibody concentration to 3–4 mg / mL. Add 2 mg / mL of TCEP (3 to 9 equivalents) aqueous solution to the mixture for antibody reduction. After vortexing, place the reaction mixture on a thermostat and reduce at 37°C for 2.0 h. Add an equal volume of 0.5 M Tris pH 8.8 buffer. Add 10 mg / mL of linker payload (3 to 12 equivalents) in DMSO, and add DMSO at 10% of the final total volume of the reaction solution. After vortexing, place the solution on a thermostat and react at 37°C for 16 h.

[0208] Uncoupled residual linker payloads in the reaction solution were removed using a Zeba centrifugal desalting column (MWCO 40K). The flow-through containing the desired ADC was ultrafiltered 3–4 times using a Pierce protein concentrator (MWCO 50K) to replace the buffer in the appropriate storage buffer. The final product was stored at -80°C.

[0209] General characterization scheme for ADC

[0210] (a) Measurement of ADC DAR value by HIC-HPLC analysis

[0211] HPLC system: Agilent 1260 Bio-Inert high performance liquid chromatography system.

[0212] Column: AdvanceBio HIC column, 4.6 × 100 mm, 3.5 μm (manufacturer: Agilent).

[0213] Mobile phases: Mobile phase A (MPA): 50 mM phosphate buffer (pH 7) with 1.5 M ammonium sulfate; Mobile phase B (MPB): 50 mM phosphate buffer (pH 7.0) / isopropanol (75:25 V / V); Elution was performed according to the following gradient steps, wherein the composition of mobile phase B was 30%-100% from 0 to 30 min. Mobile phase B was maintained at 100% from 30 to 44.99 min, and reduced to 30% at 45 min. The run time was 10 min.

[0214] Detection conditions: The flow rate of the mobile phase was set to 0.4 mL / min, the detection wavelength was set to 280 nm, and the column temperature was set to 25℃.

[0215] Experimental procedure: Inject 50 μg of ADC sample (volume depends on sample concentration) into HPLC, elute using the above elution steps, and record the chromatogram.

[0216] The DAR value is calculated as follows: DAR = Σ(relative peak area × number of drugs loaded) / 100.

[0217] (b) Measurement of ADC aggregates by SEC-HPLC analysis

[0218] HPLC system: Agilent 1260 Bio-Inert high performance liquid chromatography system.

[0219] Column: AdvanceBio SEC 300Å, 7.8×300 mm, 2.7 µm.

[0220] Mobile phase: 1×PBS / isopropanol (90:10 V / V), isocratic flow.

[0221] Detection conditions: The flow rate of the mobile phase was set to 0.86 mL / min, the detection wavelength was set to 280 nm, and the column temperature was set to 35℃.

[0222] Experimental procedure: Inject 30 μg of ADC sample (volume depends on sample concentration) into HPLC, elute using the above elution steps, and record the chromatogram.

[0223] Calculation formulas: Monomer purity (%) = Monomer peak area / Total peak area × 100%; Aggregate purity (%) = Aggregate peak area / Total peak area × 100%.

[0224] ADC prepared from antibody AT04-10A

[0225] (a) Preparation of ADC-1

[0226] Following the standard coupling procedure for ADC preparation (maleimide coupling), AT04-10A (0.45 mg, 6.39 mg / mL, 1.0 equivalent) was partially reduced by adding an aqueous solution of TCEP (2 mg / mL, 3.0 equivalent). The reduction was carried out at 37°C for 2.0 h, followed by coupling with maleimide hexanoyl (mc)-vc-PAB-MMAE (10 mg / mL, 10.0 equivalent) in DMSO at 25°C for 1.0 h. The mixture was purified as described to obtain ADC-1 (C ADC (mg / mL): 2.52, V (mL): 0.10, yield: 56.0%).

[0227] The following eigenvalues ​​were obtained based on the commonly used characterization schemes for ADCs: HIC-DAR: 5.08, SEC purity: 99.7%.

[0228] ADC-1 has the following structure (see also) Figure 13 (Base map; Table 8, LP14):

[0229] (b) Preparation of ADC-2

[0230] Following the standard coupling procedure for ADC preparation (maleimide coupling), AT04-10A (0.45 mg, 6.39 mg / mL, 1.0 equivalent) was partially reduced by adding an aqueous solution of TCEP (2 mg / mL, 9.0 equivalent). Reduction was carried out at 37°C for 2.0 h, followed by coupling with mc-vc-PAB-MMAE (10 mg / mL, 12.0 equivalent) in DMSO at 25°C for 1.0 h. The mixture was purified as described to obtain ADC-2 (C ADC (mg / mL): 2.18, V (mL): 0.10, yield: 48.4%).

[0231] The following eigenvalues ​​were obtained based on the commonly used characterization schemes for ADCs: HIC-DAR: 8.00, SEC purity: 99.6%.

[0232] The ADC-2 has the following structure (see also...) Figure 13 (Base map; Table 8, LP14):

[0233] (c) Preparation of ADC-3

[0234] Following the standard coupling procedure for ADC preparation (propadienamide coupling), AT04-10A (0.45 mg, 6.39 mg / mL, 1.0 equivalent) was partially reduced by adding TCEP (2 mg / mL, 3.0 equivalent) aqueous solution. Reduction was carried out at 37°C for 2.0 h. An equal volume of 0.5 M Tris pH 8.8 buffer was added. Coupling with DMSO of propadienamide hexanoyl(ac)-vc-MMAE (10 mg / mL, 10.0 equivalent) was carried out at 37°C for 16.0 h. The mixture was purified as described to obtain ADC-3 (C ADC (mg / mL): 2.87, V (mL): 0.10, Yield: 63.7%).

[0235] The following eigenvalues ​​were obtained using common characterization schemes for ADCs: HIC-DAR: 4.57, SEC purity: 93.2%.

[0236] The ADC-3 has the following structure (see also...) Figure 13 Top Figure; Table 8, LP26; Table 3, L11):

[0237] (d) Preparation of ADC-4

[0238] Following the standard coupling procedure for ADC preparation (propadienamide coupling), AT04-10A (0.35 mg, 6.39 mg / mL, 1.0 equivalent) was partially reduced by adding TCEP (2 mg / mL, 9.0 equivalent) aqueous solution. Reduction was carried out at 37°C for 2.0 h. An equal volume of 0.5 M Tris pH 8.8 buffer was added. Coupling with ac-vc-MMAE in DMSO was carried out at 37°C for 16.0 h. The mixture was purified as described to obtain ADC-4 (C ADC (mg / mL): 2.04, V (mL): 0.10, Yield: 58.2%).

[0239] The following eigenvalues ​​were obtained based on commonly used characterization schemes for ADCs: HIC-DAR: 7.89, SEC purity: 86.6%.

[0240] The ADC-4 has the following structure (see also...) Figure 13 Top Figure; Table 8, LP26; Table 3, L11):

[0241] ADC prepared from antibody AT04-13A

[0242] (a) Preparation of ADC-5

[0243] Following the standard coupling procedure for ADC preparation (maleimide coupling), AT04-13A (0.45 mg, 6.49 mg / mL, 1.0 equivalent) was partially reduced by adding an aqueous solution of TCEP (2 mg / mL, 3.0 equivalent). The reduction was carried out at 37°C for 2.0 h, followed by coupling with mc-vc-PAB-MMAE (10 mg / mL, 10.0 equivalent) in DMSO at 25°C for 1.0 h. The mixture was purified as described to obtain ADC-5 (C ADC (mg / ml): 2.38, V (ml): 0.10, yield: 52.9%).

[0244] The following eigenvalues ​​were obtained based on commonly used characterization schemes for ADCs: HIC-DAR: 5.84, SEC purity: 98.8%.

[0245] The ADC-5 has the following structure (see also...) Figure 13 (Base map; Table 8, LP14):

[0246] (b) Preparation of ADC-6

[0247] Following the standard coupling procedure for ADC preparation (maleimide coupling), AT04-13A (0.355 mg, 4.15 mg / mL, 1.0 equivalent) was partially reduced by adding an aqueous solution of TCEP (2 mg / mL, 9.0 equivalent). The reduction was carried out at 37°C for 2.0 h, followed by coupling with mc-vc-PAB-MMAE (10 mg / mL, 12.0 equivalent) in DMSO at 25°C for 1.0 h. The mixture was purified as described to obtain ADC-6 (C ADC (mg / mL): 1.66, V (mL): 0.10, Yield: 46.7%).

[0248] The following eigenvalues ​​were obtained based on commonly used characterization schemes for ADCs: HIC-DAR: 7.98, SEC purity: 99.5%.

[0249] The ADC-6 has the following structure (see also...) Figure 13 (Base map; Table 8, LP14):

[0250] (c) Preparation of ADC-7

[0251] Following the standard coupling procedure for ADC preparation (propenamide coupling), AT04-13A (0.4 mg, 4.15 mg / mL, 1.0 equivalence) was partially reduced by adding TCEP (2 mg / mL, 3.0 equivalence) aqueous solution. Reduction was carried out at 37°C for 2.0 h. An equal volume of 0.5 M Tris pH 8.8 buffer was added. Coupling was then performed with ac-vc-MMAE (10 mg / mL, 10.0 equivalence) in DMSO at 37°C for 16.0 h. The mixture was purified as described to obtain ADC-7 (C ADC (mg / mL): 2.14, V (mL): 0.10, Yield: 53.6%).

[0252] The following eigenvalues ​​were obtained based on commonly used ADC characterization schemes: HIC-DAR: 4.23, SEC purity: 85.1%.

[0253] The ADC-7 has the following structure (see also...) Figure 13 Top Figure; Table 8, LP26; Table 3, L11):

[0254] (d) Preparation of ADC-8

[0255] Following the standard coupling procedure for ADC preparation (propenamide coupling), AT04-13A (0.4 mg, 4.15 mg / mL, 1.0 equivalence) was partially reduced by adding TCEP (2 mg / mL, 9.0 equivalence) aqueous solution. Reduction was carried out at 37°C for 2.0 h. An equal volume of 0.5 M Tris pH 8.8 buffer was added. Coupling was then performed with ac-vc-MMAE (10 mg / mL, 12.0 equivalence) in DMSO at 37°C for 16.0 h. The mixture was purified as described to obtain ADC-8 (C ADC (mg / mL): 1.91, V (mL): 0.10, yield: 47.8%).

[0256] The following eigenvalues ​​were obtained based on commonly used ADC characterization schemes: HIC-DAR: 8.00, SEC purity: 81.0%.

[0257] The ADC-8 has the following structure (see also...) Figure 13 Top Figure; Table 8, LP26; Table 3, L11):

[0258] (e) Preparation of ADC-9

[0259] Following the standard coupling procedure for ADC preparation (maleimide coupling), AT04-13A (0.63 mg, 4.36 mg / mL, 1.0 equivalent) was partially reduced by adding an aqueous solution of TCEP (1 mg / mL, 4.5 equivalents). The reduction was carried out at 20°C for 1.5 h, followed by coupling at 20°C with LP4 (see Table 8) (10 mg / mL, 5.0 equivalents) in DMSO for 0.5 h. The mixture was purified as described to obtain ADC-9 (C ADC (mg / mL): 1.63, V (mL): 0.24, Yield: 61.8%).

[0260] The following eigenvalues ​​were obtained based on the commonly used characterization schemes for ADCs: HIC-DAR: 5.07, SEC purity: 85.5%.

[0261] The ADC-9 has the following structure (see also Table 8, LP4):

[0262] (f) Preparation of ADC-10

[0263] Following the standard coupling procedure for ADC preparation (propenamide coupling), AT04-13A (0.448 mg, 4.07 mg / mL, 1.0 equivalent) was partially reduced by adding TCEP (1 mg / mL, 4.0 equivalent) aqueous solution. Reduction was carried out at 37°C for 2.0 h. An equal volume of 0.5 M Tris pH 8.8 buffer was added. Coupling was then performed at 25°C for 1 h with LP1 (see Table 8) in DMSO (10 mg / mL, 10.0 equivalent). The mixture was purified as described to obtain ADC-10 (C ADC (mg / mL): 1.91, V (mL): 0.08, yield: 36.2%).

[0264] The following eigenvalues ​​were obtained based on the commonly used characterization schemes for ADCs: HIC-DAR: 5.13, SEC purity: 97.7%.

[0265] The ADC-10 has the following structure (see also Table 8, LP1):

[0266] ADC prepared from antibody AT04-23A

[0267] (a) Preparation of ADC-11

[0268] Following the standard coupling procedure for ADC preparation (maleimide coupling), AT04-23A (0.45 mg, 7.72 mg / mL, 1.0 equivalent) was partially reduced by adding an aqueous solution of TCEP (2 mg / mL, 9.0 equivalent). The reduction was carried out at 37°C for 2.0 h, followed by coupling with mc-vc-PAB-MMAE (10 mg / mL, 12.0 equivalent) in DMSO at 25°C for 1.0 h. The mixture was purified as described to obtain ADC-11 (C ADC (mg / mL): 1.78, V (mL): 0.10, yield: 39.5%).

[0269] The following eigenvalues ​​were obtained using common characterization schemes for ADCs: HIC-DAR: 7.86, SEC purity: 100.0%.

[0270] The ADC-11 has the following structure (see also...) Figure 13 (Base map; Table 8, LP14):

[0271] (b) Preparation of ADC-12

[0272] Following the standard coupling procedure for ADC preparation (propenamide coupling), AT04-23A (0.45 mg, 7.72 mg / mL, 1.0 equivalence) was partially reduced by adding TCEP (2 mg / mL, 9.0 equivalence) aqueous solution. Reduction was carried out at 37°C for 2.0 h. An equal volume of 0.5 M Tris pH 8.8 buffer was added. Coupling was then performed with ac-vc-MMAE (10 mg / mL, 12.0 equivalence) in DMSO at 37°C for 16.0 h. The mixture was purified as described to obtain ADC-12 (C ADC (mg / mL): 2.20, V (mL): 0.10, Yield: 48.8%).

[0273] The following eigenvalues ​​were obtained using common characterization schemes for ADCs: HIC-DAR: 7.84, SEC purity: 84.0%.

[0274] The ADC-12 has the following structure (see also...) Figure 13 Top Figure; Table 8, LP26; Table 3, L11):

[0275] ADC prepared from antibodies AT04-25A and AT04-26A

[0276] (a) General site-specific coupling steps for preparing ADCs

[0277] Antibodies modified with reactive cysteine ​​residues for conjugation (e.g., AT04-25A and AT04-26A) were generated and conjugated with various linkers using the following general steps to prepare ADC-13 to ADC-16.

[0278] In short, the monoclonal antibody buffer was replaced with 2 mM EDTA and 100 mM Tris-HCl (pH 8.0). 1 mg of antibody was added to a 1.5 mL centrifuge tube and mixed with 200 equivalents of DTT. The antibody was incubated overnight at 22°C for reduction. The reduced antibody buffer was replaced with 2 mM EDTA, 150 mM NaCl, and 50 mM Tris-HCl (pH 7.5), and 20 equivalents of DHAA were added. After pipetting and mixing, the reaction mixture was incubated at 22°C for 2 hours. DHAA was transferred to a buffer containing 150 mM NaCl and 50 mM Tris-HCl (pH 7.5) using a Zeba centrifugal desalting column. 6 equivalents of linker-loaded polymerase were added. The mixture was incubated at 20°C for 4 hours with stirring. At the end of the reaction, free small molecules were removed, and the ADC storage buffer was replaced with 50 mM His-HAC (pH 5.5). Store the coupled ADC at -80°C for later use.

[0279] (b) Preparation of ADC-13

[0280] The ADC-13 prepared by AT04-25A has the following characteristic values ​​obtained according to the common characterization scheme of ADC: HIC-DAR: 3.9, SEC purity: 97.0%.

[0281] The ADC-13 has the following structure (see also...) Figure 13 (Base map; Table 8, LP14):

[0282] (c) Preparation of ADC-14

[0283] The ADC-14 prepared by AT04-26A has the following characteristic values ​​obtained according to the common characterization scheme of ADC: HIC-DAR: 3.9, SEC purity: 94.0%.

[0284] The ADC-14 has the following structure (see also...) Figure 13 (Base map; Table 8, LP14):

[0285] (d) Preparation of ADC-15

[0286] The ADC-15 prepared by AT04-25A has the following characteristic values ​​obtained according to the common characterization scheme of ADC: HIC-DAR: 4.0, SEC purity: 94.0%.

[0287] The ADC-15 has the following structure (see also Table 8, LP8):

[0288] (e) Preparation of ADC-16

[0289] The ADC-16 prepared from AT04-26A has the following characteristic values ​​obtained according to common ADC characterization schemes: HIC-DAR: 4.0, SEC purity: 92.0%.

[0290] The ADC-16 has the following structure (see Table 8, LP8): In summary, these data demonstrate that the humanized and / or optimized anti-ALPP / ALPPL2 antibody developed in this study can be conjugated with a payload to generate an ADC that will target cells expressing ALPP / ALPPL2.

[0291] Table 8 Exemplary Connector Payload

[0292] Example 3. Efficacy determination of an ADC targeting ALPP / ALPPL2

[0293] In this study, the ability of generated ADCs, ADC-1 to ADC-16, to mediate ALPP / ALPPL2-dependent cytotoxicity was evaluated in NCI-N87 cells. N87 cells were seeded, allowed to adhere overnight, and then treated for 120 hours with each of at least nine different concentrations of ADC-1 to ADC-16 prepared by serial dilution. Cell viability of NCI-N87 cells was determined using the CellTitre-Glo cell viability assay kit according to the manufacturer's instructions. ADC-1 to ADC-4 (…) were generated. Figure 14A ), ADC-5 to ADC-8 ( Figure 14B ), ADC-9 to ADC-10 ( Figure 14C ), ADC-11 to ADC-12 ( Figure 14D ) and ADC-13 to ADC-16 ( Figure 14E The dose-response curves were obtained. The half-maximal inhibitory concentration (IC50) of each ADC was calculated, and the potent cytotoxicity of the ADCs was demonstrated in the range of 0.0081 nM to 618.6 nM.

[0294] ADC-14 was then tested in mouse xenograft models of pancreatic (HPAC) and gastric (NCI-N87) tumor cells. Tumor cells were injected into BALB / c nude mice. Mice were treated intravenously with 3 mg / kg ADC-14 on days 0 and 7 after the tumors became palpable. Unbound IgG1 anti-DT conjugated to maleimide hexanoyl (mc)-vc-MMAE (DAR 3.8) was used as an allotype ADC control, and PBS was used as a solvent control. Tumor size was determined by measurement with calipers at least twice a week. Figure 15 As shown, in pancreatic (HPAC) and gastric (NCI-N87) tumor cell models expressing ALPP / ALPPL2, ADC-14 at 3 mg / kg (QWx2) inhibited tumor growth and induced tumor regression without significantly affecting body weight.

[0295] Finally, ADC-14 was tested in a patient-derived xenograft (PDX) mouse cancer model. The cancer will be derived from gastric cancer (…). Figure 16 ) or gastroesophageal junction cancer ( Figure 17 Tumor cells isolated from patient tissue biopsies were implanted into BALB / c nude mice. Once the tumor was palpable, 3 mg / kg of [agent / method] was administered on days 0, 7, and 14. Figure 16 ) or 6 mg / kg ( Figure 17 Mice were treated with ADC-14 (QWx3). At the end of the experiment, the tumor growth inhibition rate (TGI, %) was calculated using the following formula: TGI (%) = [1 - (RTV of the treatment group) / (RTV of the control group)] × 100 (%). RTV or relative tumor volume was calculated using the following formula: RTV = (tumor volume on measurement day) / (tumor volume on day 0). ADC-14 was administered at 3 mg / kg ( Figure 16 ) and 6 mg / kg ( Figure 17 It inhibited tumor growth and induced tumor regression, with a TGI of 93% at a dose of 3 mg / kg and 100% at a dose of 6 mg / kg. In summary, these results demonstrate that ADCs targeting ALPP / ALPPL2 are safe, produce potent antitumor activity, and show great promise for therapeutic applications in cancer treatment.

[0296] The above detailed description of embodiments of the present technology is not intended to exhaust all possibilities or limit the technology to the precise forms described above. Although specific embodiments and examples of the present technology have been described above for illustrative purposes, those skilled in the art will recognize that various equivalent modifications can be made within the scope of the present technology. The various embodiments described herein can also be combined to provide other embodiments.

[0297] Unless otherwise stated herein or clearly contradicted by the context, all methods described herein may be performed in any suitable order. The use of any and all examples or exemplary language (e.g., “such as”) provided with respect to certain embodiments herein is intended only to better illustrate this disclosure and not to limit the scope of this disclosure as otherwise claimed. Nothing in the specification should be construed as indicating that any element not mentioned in the claims is essential for carrying out this disclosure.

[0298] All publications, patents, patent applications, and other references cited in this application are incorporated herein by reference in their full text for all purposes, to the same extent that each individual publication, patent, patent application, or other reference is expressly and individually indicated to be incorporated herein in its full text for all purposes. References cited herein should not be construed as an admission that such reference is prior art to this disclosure.

Claims

1. A recombinant antibody or an antigen-binding fragment thereof, said recombinant antibody or antigen-binding fragment thereof specifically binding to placental alkaline phosphatase (ALPP) and / or placental-like alkaline phosphatase 2 (ALPPL2).

2. The antibody or antigen-binding fragment thereof according to claim 1, comprising a heavy chain variable region and / or a light chain variable region, wherein the heavy chain variable region comprises at least one, two or three complementarity-determining regions (CDRs) selected from SEQ ID NO: 10, 3, 11, and the light chain variable region comprises at least one, two or three CDRs selected from SEQ ID NO: 6-8.

3. The antibody or antigen-binding fragment thereof according to claim 2, comprising a heavy chain variable region and / or a light chain variable region, wherein the heavy chain variable region comprises an amino acid sequence that is at least 80% identical to that of SEQ ID NO: 9, 12 or 13, and the light chain variable region comprises an amino acid sequence that is at least 80% identical to that of SEQ ID NO: 14 or 15.

4. The antibody or antigen-binding fragment thereof according to claim 1, comprising a heavy chain variable region and / or a light chain variable region, wherein the heavy chain variable region comprises at least one, two, or three CDRs selected from GFSLTSYG (SEQ ID NO: 10), IWEX1X2ST (SEQ ID NO: 38), and AKPHYGSSYVGAMEY (SEQ ID NO: 11), wherein: X1 is E, H, Q, or S; and X2 can be A, E, L, or Q; The light chain variable region comprises at least one, two, or three CDRs selected from SEQ ID NO: 6-8.

5. The antibody or antigen-binding fragment thereof according to claim 4, comprising: (a) a heavy chain variable region comprising a CDR having an amino acid sequence as shown in SEQ ID NO: 10, 17 and 11; and / or a light chain variable region comprising a CDR having an amino acid sequence as shown in SEQ ID NO: 6-8; (b) a heavy chain variable region comprising a CDR having an amino acid sequence as shown in SEQ ID NO: 10, 19 and 11; and / or a light chain variable region comprising a CDR having an amino acid sequence as shown in SEQ ID NO: 6-8; (c) a heavy chain variable region comprising a CDR having the amino acid sequences shown in SEQ ID NO: 10, 21 and 11; and / or a light chain variable region comprising a CDR having the amino acid sequences shown in SEQ ID NO: 6-8; (d) Heavy chain variable region comprising a CDR having the amino acid sequences shown in SEQ ID NO: 10, 23 and 11; and / or light chain variable region comprising a CDR having the amino acid sequences shown in SEQ ID NO: 6-8; (e) a heavy chain variable region comprising a CDR having an amino acid sequence as shown in SEQ ID NO: 10, 25 and 11; and / or a light chain variable region comprising a CDR having an amino acid sequence as shown in SEQ ID NO: 6-8; (f) Heavy chain variable region comprising a CDR having the amino acid sequences shown in SEQ ID NO: 10, 27 and 11; and / or light chain variable region comprising a CDR having the amino acid sequences shown in SEQ ID NO: 6-8; (g) a heavy chain variable region comprising a CDR having the amino acid sequences shown in SEQ ID NO: 10, 29, and 11; and / or a light chain variable region comprising a CDR having the amino acid sequences shown in SEQ ID NO: 6-8; or (h) a heavy chain variable region comprising a CDR having an amino acid sequence as shown in SEQ ID NO: 10, 31 and 11; and / or a light chain variable region comprising a CDR having an amino acid sequence as shown in SEQ ID NO: 6-8.

6. The antibody or antigen-binding fragment thereof according to claim 5, comprising: (a) a heavy chain variable region containing an amino acid sequence that is at least 80% identical to that of SEQ ID NO: 16; and / or a light chain variable region containing an amino acid sequence that is at least 80% identical to that of SEQ ID NO: 15; (b) a heavy chain variable region containing an amino acid sequence that is at least 80% identical to that of SEQ ID NO: 18; and / or a light chain variable region containing an amino acid sequence that is at least 80% identical to that of SEQ ID NO: 15; (c) a heavy chain variable region containing an amino acid sequence that is at least 80% identical to that of SEQ ID NO: 20; and / or a light chain variable region containing an amino acid sequence that is at least 80% identical to that of SEQ ID NO: 15; (d) a heavy chain variable region containing an amino acid sequence that is at least 80% identical to that of SEQ ID NO: 22; and / or a light chain variable region containing an amino acid sequence that is at least 80% identical to that of SEQ ID NO: 15; (e) a heavy chain variable region comprising an amino acid sequence that is at least 80% identical to that of SEQ ID NO: 24; and / or a light chain variable region comprising an amino acid sequence that is at least 80% identical to that of SEQ ID NO: 15; (f) a heavy chain variable region containing an amino acid sequence that is at least 80% identical to that of SEQ ID NO: 26; and / or a light chain variable region containing an amino acid sequence that is at least 80% identical to that of SEQ ID NO: 15; (g) a heavy chain variable region comprising an amino acid sequence that is at least 80% identical to that of SEQ ID NO: 28; and / or a light chain variable region comprising an amino acid sequence that is at least 80% identical to that of SEQ ID NO: 15; or (h) a heavy chain variable region containing an amino acid sequence that is at least 80% identical to that of SEQ ID NO: 30; and / or a light chain variable region containing an amino acid sequence that is at least 80% identical to that of SEQ ID NO:

15.

7. The antibody or antigen-binding fragment thereof according to any one of claims 1-6, further comprising a light chain constant region comprising an amino acid sequence that is at least 80% identical to SEQ ID NO: 33, and / or a heavy chain constant region, wherein the heavy chain constant region comprises: (a) One or more amino acid substitutions at positions A121, S242, L237, L238, D268, K150, V205, C223, A330, and S443 relative to SEQ ID NO: 34; or (b) Substitution of one or more amino acids selected from the group consisting of SEQ ID NO: 34, relative to SEQ ID NO: 34; or (c) An amino acid sequence that is at least 80% identical to any of the sequences in SEQ ID NO: 32, 35, 36 or 37.

8. The antibody or antigen-binding fragment thereof according to any one of claims 1-7, wherein the antibody or antigen-binding fragment thereof is humanized.

9. The antibody or antigen-binding fragment thereof according to any one of claims 1-8, wherein the antibody or antigen-binding fragment thereof is of low immunogenicity.

10. The antibody or antigen-binding fragment thereof according to any one of claims 1-9, wherein the antibody or antigen-binding fragment thereof does not bind to intestinal alkaline phosphatase (ALPI) and / or biomineralization-associated alkaline phosphatase (ALPL).

11. The antibody or antigen-binding fragment thereof according to any one of claims 1-10, wherein the antibody or antigen-binding fragment thereof does not have cross-reactivity with non-human species.

12. A pharmaceutical composition comprising the antibody or antigen-binding fragment thereof as described in any one of claims 1-11.

13. A nucleic acid comprising a nucleotide sequence encoding an antibody or an antigen-binding fragment thereof as described in any one of claims 1-11.

14. The nucleic acid according to claim 13, wherein the nucleotide sequence is at least 80% identical to SEQ ID NO: 35 or SEQ ID NO:

36.

15. A vector comprising the nucleic acid of claim 13 or claim 14.

16. The vector according to claim 15, wherein the vector is a viral vector or a non-viral vector.

17. The vector according to claim 16, wherein the vector is a viral vector.

18. The vector according to claim 17, wherein the vector is a lentiviral vector.

19. A host cell containing the nucleic acid of claim 13 or claim 14 or the vector of any one of claims 15-18.

20. A composition comprising the carrier of any one of claims 15-18 or the host cell of claim 19.

21. An antibody-drug conjugate (ADC) comprising (i) an antibody or an antigen-binding fragment thereof as described in any one of claims 1-11; and (ii) one or more payloads, wherein the antibody or the antigen-binding fragment thereof is directly or indirectly connected to each of the one or more payloads via a linker.

22. The ADC according to claim 21, having the following formula: (I)， Where Ab is the antibody or its antigen-binding fragment, L is the linker, D is the payload, and z is an integer between 1 and 20.

23. The ADC according to claim 21 or claim 22, wherein the connector (L) has the following structure: (L1A); (L1B); (L2A); (L2B); (L3A); (L3B); (L4)； (L5)； (L6)； (L7); or (L8)， Where D is the payload and n is an integer between 1 and 20.

24. The ADC according to claim 21 or claim 22, wherein the connector (L) has a structure of any one of L9-L21 provided in Table 3.

25. The ADC according to any one of claims 21-24, wherein the payload comprises an antimitotic agent, a DNA topoisomerase I inhibitor, or a DNA minor groove binder.

26. The ADC of claim 25, wherein the payload comprises an antimitotic agent comprising monomethylolpropamine E (MMAE) or a derivative thereof and / or a pharmaceutically acceptable salt, ester, solvate, tautomer or stereoisomer of any of the foregoing substances.

27. The ADC of claim 25, wherein the payload comprises a DNA topoisomerase I inhibitor, the DNA topoisomerase I inhibitor comprising DXd or eczema or a derivative thereof and / or a pharmaceutically acceptable salt, ester, solvate, tautomer or stereoisomer of any of the foregoing substances.

28. The ADC of claim 25, wherein the payload comprises a DNA minor groove binder, the DNA minor groove binder comprising trabectedin or a derivative thereof, rubitidine or a derivative thereof and / or any pharmaceutically acceptable salt, ester, solvate, tautomer or stereoisomer of the foregoing.

29. The ADC of claim 26, wherein the payload comprises an MMAE or a derivative thereof having the following structure: (II), Where R is a sugar, which may optionally be a monosaccharide.

30. The ADC of claim 27, wherein the payload comprises Dxd / ecientecan or a derivative thereof.

31. The ADC of claim 28, wherein the payload comprises rubitidine or a derivative thereof having the following structure: (III), in: R1 is -OH, -F, -Cl, -Br, -I, -NO2, -NH2, -COOH, carbonyl (-C(=O)R5), carboxyl (-C(=O)OR6 or -C≡N); preferably carbonyl, -OH, -NO2, -F or -C≡N; more preferably -OH, -F or -C≡N; and most preferably -OH or -C≡N, wherein R5 and R6 are independently H or aryl; R2 is either -H or -X (CH2). p C(=O) 0-1 (CH2) q (C(R7)2) 0-1 (X) 0-1 R8, where p and q are independent integers selected from 0 to 10, X is 0 or NH, and R7 and R8 are independent H or C. 1-4 alkyl; R3 is either -H or -X (CH2). m C(=O) 0-1 (CH2) n (C(R9)2) 0-1 (X) 0-1 R 10 Where m and n are independent integers selected from 0 to 10, X is 0 or NH, and R9 and R 10 Independently H or C 1-4 Alkyl groups; and R4 is -H or C 1-4 alkyl, Optionally, equation (III) does not include: R2 is -H, R3 is -H, and R4 is -H; and R2 is -OCH3, R3 is -H, and R4 is -H.

32. The ADC of claim 28, wherein the payload comprises rubitidine or a derivative thereof having the following structure: (IV), in: R1 is -OH, -F, -Cl, -Br, -I, -NO2, -NH2, -COOH, carbonyl (-C(=O)R5), carboxyl (-C(=O)OR6 or -C≡N); preferably carbonyl, -OH, -NO2, -F or -C≡N; more preferably -OH, -F or -C≡N; and most preferably -OH or -C≡N, wherein R5 and R6 are independently H or aryl; R2 is either -H or -X (CH2). p C(=O) 0-1 (CH2) q (C(R7)2) 0-1 (X) 0-1 R8, where p and q are independent integers selected from 0 to 10, X is 0 or NH, and R7 and R8 are independent H or C. 1-4 alkyl; R3 is either -H or -X (CH2). m C(=O) 0-1 (CH2) n (C(R9)2) 0-1 (X) 0-1 R 10 Where m and n are independent integers selected from 0 to 10, X is 0 or NH, and R9 and R 10 Independently H or C 1-4 Alkyl groups; and R4 is -H or -CH2NHR 11 , where R 11 For H or C 1-4 alkyl.

33. The ADC of claim 28, wherein the payload comprises trabectedin or a derivative thereof having the following structure: (V) in: R1 is -OH, -F, -Cl, -Br, -I, -NO2, -NH2, -COOH, carbonyl (-C(=O)R6), carboxyl (-C(=O)OR7 or -C≡N); preferably carbonyl, -OH, -NO2, -F or -C≡N; more preferably -OH, -F or -C≡N; and most preferably -OH or -C≡N, wherein R6 and R7 are independently H or aryl; R2 is either -H or -X (CH2). p C(=O) 0-1 (CH2) q (C(R8)2) 0-1 (X) 0-1 R9, where p and q are independent integers selected from 0 to 10, X is 0 or NH, and R8 and R9 are independent H or C. 1-4 alkyl; R3 is either -H or -X (CH2). m C(=O) 0-1 (CH2) n (C(R 10 )2) 0-1 (X) 0-1 R 11 Where m and n are independent integers selected from 0 to 10, X is 0 or NH, and R 10 and R 11 Independently H or C 1-4 Alkyl groups; and R4 is -H, -CH2OR 12 -CH2NHR 13 or -CH2C(=O)OR 14 , where R 12 R 13 And R 14 Independently H or C 1-4 Alkyl groups; and R5 is -H or C 1-4 alkyl, Optionally, formula (V) does not include: R2 is -OCH3, R3 is -OH, R4 is -H, and R5 is -H.

34. The ADC according to any one of claims 21-24, wherein the payload (D) has a structure of any one of P1-P12 provided in Table 4.

35. The ADC of claim 21 or claim 22, wherein the connector payload (LD) has a structure of any one of PL1-PL38 provided in Table 8.

36. A pharmaceutical composition comprising the ADC of any one of claims 21-35.

37. A method for in vitro inhibition of the growth of cancer cells expressing ALPP and / or ALPPL2, the method comprising exposing the cancer cells to an effective amount of an antibody or antigen-binding fragment thereof as described in any one of claims 1-11, a pharmaceutical composition as described in claim 12, an ADC as described in any one of claims 21-35, or a pharmaceutical composition as described in claim 36.

38. A method of treating cancer expressing ALPP and / or ALPPL2 in a subject in need, the method comprising administering to the subject a therapeutically effective amount of an antibody or antigen-binding fragment thereof as described in any one of claims 1-11, a pharmaceutical composition as described in claim 12, an ADC as described in any one of claims 21-35, or a pharmaceutical composition as described in claim 36.

39. The method according to claims 38, further comprising administering one or more additional anticancer therapies to the subject.

40. The method of claim 39, wherein one or more of the additional anticancer therapies are therapeutic antibodies, ADCs, chemotherapy, radiotherapy, endocrine therapy, targeted molecular agents, immunotherapy, or any combination thereof.

41. The method according to any one of claims 38-40, wherein the cancer is a solid cancer.

42. The method according to claim 41, wherein the solid carcinoma is mesothelioma, ovarian cancer, pancreatic cancer, endometrial cancer, non-small cell lung cancer, gastric cancer, gastroesophageal junction cancer, cervical cancer, colorectal cancer, or testicular cancer.

Images