Application of targeted AARS2 inhibitor in preparation of tumor treatment medicine
By intervening in lactate metabolism in HCC cells by targeting AARS2 inhibitors, the problem of limited response to existing HCC treatments has been solved, achieving effective inhibition of HCC and improved prognosis.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-14
- Publication Date
- 2026-04-03
AI Technical Summary
Current treatments have limited response to hepatocellular carcinoma (HCC), exhibit high heterogeneity and are prone to developing treatment resistance. The lack of effective diagnostic markers and therapeutic targets leads to poor patient prognosis.
Developing AARS2-targeting inhibitors to regulate lactate metabolism in hepatocellular carcinoma by intervening in AARS2 function, thereby inhibiting tumor growth and development, and providing a new treatment strategy.
Targeted AARS2 inhibitors can inhibit the proliferation, growth and metastasis of HCC cells, improve patient prognosis, and provide new directions for the development of targeted drugs for HCC.
Smart Images

Figure CN121775142A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of life science research, specifically to the use of AARS2-targeting inhibitors in the preparation of tumor therapeutic drugs. Background Technology
[0002] Hepatocellular carcinoma (HCC) is one of the most prevalent malignant cancers worldwide, with over 800,000 new cases annually and a persistently high mortality rate. The occurrence and development of HCC are closely related to chronic liver disease, cirrhosis, and infection with hepatitis B virus (HBV) or hepatitis C virus (HCV). Currently, treatment options for HCC mainly include surgical resection, liver transplantation, local ablation, transarterial chemoembolization (TACE), molecular targeted therapy, and immunotherapy. In recent years, immunotherapy, represented by immune checkpoint inhibitors, has shown significant efficacy in some HCC patients, offering new hope for advanced-stage patients. However, due to the high heterogeneity of HCC and its tendency to develop treatment resistance, most patients respond limitedly to existing therapies, resulting in a persistently low 5-year survival rate and a persistently high risk of recurrence and metastasis. Therefore, in-depth exploration of the molecular mechanisms of HCC development and progression, and the identification of new diagnostic biomarkers and therapeutic targets, are crucial for improving patient prognosis.
[0003] In recent years, metabolic reprogramming has been recognized as a key characteristic of tumors. In various cancers, tumor cells adjust their metabolic pathways to meet the energy and biosynthetic demands of their rapid proliferation. Lactic acid metabolism plays a crucial role in the formation of the tumor microenvironment and tumor progression. Hepatocellular carcinoma (HCC), a metabolically abnormally active tumor, exhibits abnormal lactic acid metabolism that is closely related to tumor growth, invasion, metastasis, and immune escape. Studies have shown that lactic acid can act as a signaling molecule, energy substrate, and mediator of microenvironment acidification, participating in the regulation of malignant behavior of tumor cells. Therefore, identifying key regulators of lactic acid metabolism in HCC cells and designing corresponding intervention strategies may provide a new breakthrough for HCC treatment.
[0004] AARS2 (alanyl-tRNA synthetase 2), a member of the mitochondrial aminoacyl-tRNA synthetase family, is primarily responsible for the synthesis of alanyl-tRNA in mitochondria and participates in mitochondrial protein translation. Recent studies have found that AARS2 is abnormally expressed in various tumors and may participate in tumorigenesis and development by influencing cellular metabolism, oxidative stress, and signal transduction. However, the specific role and mechanism of AARS2 in the regulation of lactate metabolism in hepatocellular carcinoma (HCC) remain unclear. Summary of the Invention
[0005] To address the shortcomings of existing technologies, this invention proposes the use of AARS2-targeting inhibitors in the preparation of tumor therapeutic drugs. The aim is to regulate the lactate metabolism process in hepatocellular carcinoma by intervening in AARS2 function, thereby inhibiting tumor growth and development, and providing a new direction for drug development for the treatment of HCC and other related tumors.
[0006] The technical solution adopted by this invention to solve the technical problem is as follows:
[0007] A first aspect of the present invention provides the use of an AARS2-targeting inhibitor in the preparation of a tumor therapeutic agent.
[0008] In one embodiment, the tumor treatment drug has at least one of the following functions:
[0009] It inhibits the proliferation of tumor cells and inhibits tumor growth.
[0010] In one embodiment, the AARS2 inhibitor inhibits AARS2 activity or inhibits AARS2 gene transcription or expression.
[0011] The AARS2 inhibitor is siRNA, shRNA, antibody, or small molecule compound.
[0012] The tumor described in this invention is a tumor that overexpresses AARS2, and more specifically, hepatocellular carcinoma that overexpresses AARS2.
[0013] This invention also provides the use of AARS2 inhibitors in the preparation of medicaments having at least one of the following functions: inhibiting lactate metabolism in tumor cells; inhibiting AP-2γ lactation in tumor cells.
[0014] Compared with the prior art, the beneficial effects of the present invention are as follows: The present invention provides a method to inhibit the lactation of AP-2γ in HCC cells by targeting AARS2, focusing on recognizing AARS2 as a key factor promoting the malignant progression of tumors in HCC cells, thereby providing a new treatment strategy with the prospect of being applied to the preparation of HCC targeted drugs. Attached Figure Description
[0015] Figure 1 UMAP plots show different cell subpopulations in scRNA-seq data.
[0016] Figure 2 UMAP visualization based on the inferred copy number variation profile of each single-cell genome. Figure 3 Hepatocytes were divided into malignant and non-malignant groups based on copy number variation.
[0017] Figure 4We combined MACdb and human phenotypic ontology gene sets to analyze the differences in metabolic activity among different cell subpopulations.
[0018] Figure 5 The violin diagram illustrates the lactate metabolism scores of three tumor cell subsets.
[0019] Figure 6 Pseudo-temporal analysis of tumor cells revealed the association between lactate metabolic activity and the sequence of tumor progression.
[0020] Figure 7 Based on transcriptome throughput analysis, LAMs exhibited a gradient of metabolic activation. Cohen's D values were color-coded under the condition of FDR < 0.05 (Wilcoxon test): red indicates high expression in LAMs, and blue indicates low expression in LAMs.
[0021] Figure 8 The correlation plot shows the correlation between lactation metabolism score and protein lactation modification score.
[0022] Figure 9 Correlation analysis of lactate metabolism scores with various tumor cell biological behaviors. Figure 10 Spatial transcriptomic data showed LAM scores and subsequent high / low groupings within HCC loci.
[0023] Figure 11 Differential gene analysis was performed on lactation-modifying enzyme families based on spatial LAM high / low grouping to screen for candidate genes.
[0024] Figure 12 A. The AARS2 transcription levels in tumor tissue and adjacent normal tissue were detected in samples from 90 patients.
[0025] B. Immunohistochemical results of tissue microarrays from 90 patients showed the levels of AARS2 protein in tumor tissue and adjacent normal tissue.
[0026] C. Immunohistochemical staining of tumor tissue microarrays from 90 patients showed the Ki67 level in the tumor tissue.
[0027] D. The correlation plot shows the correlation between AARS2 and Ki67.
[0028] Figure 13 .A. AARS2 protein levels in different HCC cell lines and normal hepatocyte cell lines
[0029] Detection of protein levels after B.AARS2 knockdown or overexpression
[0030] C. Assess overall lactation levels using pan-kla antibody.
[0031] Figure 14 The CCK-8 assay showed changes in cell proliferation capacity after AARS2 regulation.
[0032] Figure 15 EdU experiments showed changes in cell proliferation capacity after AARS2 regulation.
[0033] Figure 16 Colony formation assays showed changes in cell proliferation capacity after AARS2 regulation.
[0034] Figure 17 Transwell assays showed changes in cell invasion and migration abilities after AARS2 regulation.
[0035] Figure 18 Quantitative indicators of mouse tumors.
[0036] Figure 19 .Alb-cre + Aars2 fl / fl With Alb-cre - Aars2 fl / fl Comparison of Kaplan-Meier survival curves in mice.
[0037] Figure 20 AARS2 knockdown or overexpression subcutaneous xenograft mouse models and corresponding statistical results.
[0038] Figure 21 H&E, immunohistochemistry, and Ki67 staining results for AARS2 knockdown or overexpression subcutaneous tumors.
[0039] Figure 22 AARS2 knockdown or overexpression in mouse models of orthotopic liver tumors and corresponding statistical results. Figure 23 .AARS2 knockdown or overexpression mouse models of lung metastases and corresponding statistical results.
[0040] Figure 24 Survival analysis of mouse models of lung metastases with AARS2 knockdown or overexpression.
[0041] Figure 25 Bar chart comparing the abundance of immune cell clusters between groups.
[0042] Figure 26 Silver staining results show the location of AARS2 and other proteins.
[0043] Figure 27 Validation of the knockdown efficiency of specific small interfering RNA.
[0044] Figure 28An EdU experiment showed changes in cell proliferation capacity after knocking down five different genes;
[0045] B. Transwell experiments showed changes in cell migration ability after knocking down five different genes.
[0046] Figure 29 .AB is an immunoprecipitation assay used to verify the interaction between AARS2 and AP-2γ;
[0047] C. In-situ verification of AARS2-AP-2γ interaction using proximity connection experiments.
[0048] Figure 30 Schematic diagram of the construction of AARS2 and AP-2γ truncated bodies.
[0049] Figure 31 Immunoprecipitation analysis of truncated protein-protein interaction patterns.
[0050] Figure 32 Immunoprecipitation results of site-specific mutants affecting AARS2-AP-2γ interaction.
[0051] Figure 33 Immunoprecipitation showed AARS2-mediated AP-2γ pan-lysine lactation modification.
[0052] B. Immunoprecipitation showed that the AP-2γ K444R mutation resulted in decreased lactation levels.
[0053] C. Immunoprecipitation confirmed K444 as the major lactation site.
[0054] D. Three-dimensional molecular docking simulations show the effect of K444 lactation on the structure of AP-2γ.
[0055] Figure 34 . Schematic diagram of the active site and mutations of the AARS2 enzyme.
[0056] Figure 35 A is an immunoprecipitation assay showing the binding affinity of the AARS2 enzyme activity mutant to AP-2γ.
[0057] B is an immunoprecipitation finding that the AARS2 enzyme activity mutant cannot mediate AP-2γ lactation.
[0058] C indicates that immunoprecipitation shows that AARS2-AP-2γ binding is a necessary condition for lactation.
[0059] Figure 36 Colony formation assays showed changes and statistics in cell proliferation capacity after overexpression of AARS2-WT or AARS2-EA-MUT.
[0060] Figure 37 Transwell assays showed changes and statistics in cell migration and invasion abilities after overexpression of AARS2-WT or AARS2-EA-MUT.
[0061] Figure 38 A represents the change in AP-2γ protein levels after AARS2 overexpression, and B represents the Western blot analysis of AP-2γ protein levels in the cytoplasm, nucleus, and total protein lysate.
[0062] Figure 39 Immunofluorescence images show changes in AP-2γ localization after AARS2 overexpression.
[0063] Figure 40 Western blot analysis of AP-2γ protein levels in cytoplasm, nucleus, and total protein lysate after transfection with wild-type or K444 mutant AP-2γ.
[0064] Figure 41 Immunofluorescence images showing altered subcellular localization of AP-2γ after AARS2 overexpression in cells transfected with wild-type AP-2γ or its K444 mutant.
[0065] Figure 42 Western blot analysis of AP-2γ protein levels in cytoplasm, nucleus, and total protein lysate after transfection with wild-type AARS2 or its lactation active site mutant.
[0066] Figure 43 Immunofluorescence images showing altered subcellular localization of AP-2γ after AARS2 overexpression in cells transfected with wild-type AARS2 or its lactation-deficient mutant.
[0067] In all statistical charts, data are expressed as mean ± standard deviation. p < 0.05, **p < 0.001; ns indicates no statistical difference. Detailed Implementation
[0068] To provide a further understanding of the purpose, structure, features, and functions of the present invention, detailed descriptions are provided below with reference to specific embodiments.
[0069] This invention provides the use of AARS2 inhibitors in the preparation of tumor therapeutic drugs.
[0070] The key findings of the invention are as follows:
[0071] AARS2 identification: through bioinformatics analysis, combined with reference... Figure 1-25Studies have found that AARS2 is associated with increased lactate metabolism and malignancy. Furthermore, elevated AARS2 expression in hepatocellular carcinoma patients is associated with poor prognosis, highlighting the clinical significance of targeting AARS2.
[0072] Mechanism research: combined with reference Figure 26-43 Mechanistically, AARS2 enhances the malignant progression of HCC by promoting the lactation and nuclear translocation of AP-2γ.
[0073] Therapeutic potential: Targeting AARS2 can inhibit the malignant progression of tumors in hepatocellular carcinoma.
[0074] The tissue samples used in the following examples were obtained from patients who underwent hepatocellular carcinoma surgery. Patients and their families were fully informed of the research purpose and procedures before surgery and signed informed consent forms. This study has been approved by the institution's ethics committee.
[0075] The hepatocellular carcinoma cell lines Huh7, Hep3B, and H22 used were all purchased from Shanghai Anwei Biotechnology Co., Ltd.
[0076] The cell culture medium used was prepared with DMEM / F12, 10% fetal bovine serum, 1% penicillin and 1% streptomycin, Gibco Technologies.
[0077] TRIzol used for RNA extraction was purchased from Invitrogen.
[0078] All reagents used in qRT-PCR were purchased from Nanjing Norwegian Zan Company.
[0079] The interfering gene sequences involved in the examples are as follows:
[0080] shAARS2 HumanshRNA1: GCCGCCTTTCTGAACTTCTTT (SEQ ID NO.1)
[0081] shRNA2: CCTGGTCTTCATGCAACACAA (SEQ ID NO.2)
[0082] shRNA3: CCTCAGTATAGCCCAAACCTA (SEQ ID NO.3)
[0083] Example 1: Lactate-modifying enzyme AARS2 is a key regulator of malignant progression of hepatocellular carcinoma.
[0084] Combined with reference Figure 1-12 We conducted a comprehensive screening of key metabolic features and regulatory factors in HCC by combining scRNA-seq with spatial transcriptomics of HCC tissues. Unbiased cluster analysis identified normal hepatocytes, tumor cells, and other cell subsets. Figure 1-3 After completing the cell subtype classification, we analyzed multiple metabolic pathways among the different subtypes. In malignant tumor cells, the lactate-dominated metabolic pathway was significantly upregulated, showing a marked difference from normal hepatocytes. Figure 4 Based on lactate metabolism scores, the malignant cell population was further divided into three groups. Further pseudo-time series analysis revealed that these three tumor cell subpopulations exhibited different evolutionary trajectories corresponding to their lactate metabolism scores. Figure 6 This indicates a significant correlation between lactate metabolism and tumor progression and differentiation.
[0085] To validate the association between transcriptome-based LAM scores and lactate metabolism pathways, we used a metabolite-associated gene algorithm to identify differentially expressed genes among three tumor subgroups. Compared to the low-score subgroup, the high-LAM-score subgroup showed more upregulated genes related to lactate metabolites, supporting our previous finding of an association between LAM scores and lactate metabolism pathways. Figure 7 Based on this, we found a strong positive correlation between lactate metabolism and lactation score. Figure 8 Further analysis showed that elevated lactate metabolism activity was positively correlated with various malignant cell behaviors. Figure 9 Overall, these results elucidate the close link between LAM, protein lactation, and malignant tumor progression.
[0086] In addition, we performed differential analysis by stratifying HCC loci in spatial transcriptome data into high / low lactate metabolomes. Figure 10 Through intersection analysis of internal and external datasets, AARS2 was identified as the candidate gene with the highest expression in the high lactate metabolism HCC region. Figure 11 After identifying the candidate gene AARS2, we performed differential expression analysis on tumors and adjacent normal tissues in clinical samples and verified its association with malignant tumors. Figure 12 In summary, this panoramic screening study identified the lactate-modifying enzyme AARS2 as a key regulator linking lactate metabolism to the malignant progression of HCC.
[0087] Example 2: Increased AARS2 expression promotes malignant progression of HCC in vitro.
[0088] Combined with reference Figure 13-17 Preliminary analysis of AARS2 protein levels in HCC cell line and normal hepatocyte cell line THLE-2 revealed that AARS2 expression was increased in HCC cell line compared to THLE-2. Figure 13A). To investigate the biological function of AARS2 in HCC, we overexpressed AARS2 in Huh7 cells with low endogenous expression (AARS2-OE) and knocked down AARS2 in Hep3B cells with high endogenous expression (shAARS2). Figure 13 B). We first examined the overall cellular pan-lactation (pan-Kla) level regulated by AARS2. Western blot analysis showed that AARS2 overexpression significantly increased pan-Kla levels (B). Figure 13 C). Subsequently, sh1 and sh2, which had higher knockdown efficiency, were selected for subsequent functional experiments. The results of the CCK-8 assay, EdU labeling, and colony formation assays showed that AARS2 knockdown reduced the cell line's proliferation ability, while its overexpression significantly enhanced proliferation ability. Figure 14 , 15 16). Similarly, Transwell experiments confirmed that AARS2 knockdown reduced the migration and invasion abilities of Hep3B cells, while overexpression produced the opposite effect. Figure 17 In summary, these findings indicate that AARS2 can enhance the proliferation, migration, and invasion capabilities of Hep3B and Huh7 cells in vitro.
[0089] Example 3: Increased AARS2 expression promotes malignant progression of HCC in vivo
[0090] Experimental methods for constructing mouse models
[0091] DEN / CCl4-induced HCC model: To induce liver cancer, 2-week-old Alb-cre + Aars2 fl / fl and Alb-cre - Aars2 fl / fl Mice were administered DEN at a dose of 25 mg / kg via intraperitoneal injection. Two weeks after DEN injection, they were administered carbon tetrachloride dissolved in olive oil via intraperitoneal injection once weekly for a total of 20 weeks. After 24 weeks of treatment, tumor growth in the liver was observed by magnetic resonance imaging, and liver tissue was sectioned and stained with H&E. Overall survival of the mice was analyzed in a separate experiment.
[0092] Subcutaneous tumorigenesis model: Hepa1-6, Hep3B, or Huh7 cells stably expressing luciferase were subcutaneously injected into the flank of 4-week-old male C57BL / 6 mice or nude mice. All mice were sacrificed after 21 days, and tumor tissue was collected.
[0093] Orthotopic transplantation model: Four-week-old male C57BL / 6 mice or nude mice were anesthetized by intraperitoneal injection of 3% sodium pentobarbital. Tumor tissue obtained from subcutaneous tumorigenesis models of Hepa1-6, Hep3B, or Huh7 cells was cut into small pieces of approximately 2 mm³ and transplanted into the livers of mice. Seven days after surgical orthotopic transplantation, mice with similar tumor growth were randomly assigned to different treatment groups. The tumor growth capacity in the liver was observed using bioluminescence imaging. Overall survival of mice was analyzed in a separate experiment. Regarding combination therapy, starting from day 7 post-tumor transplantation, mice were intraperitoneally injected with DMSO / cucomethaline A or α-PD-1 / IgG every other day for two weeks, depending on their grouping.
[0094] Lung metastasis model: Transfected Hep3B and Huh7 cells were resuspended in 100 μL PBS via tail vein injection and then injected into nude mice. Twenty-eight days after injection, the ability of tumors to metastasize to the lungs was observed using bioluminescence imaging. Ten independent biological replicates were performed for survival analysis.
[0095] Combined with reference Figure 18-25 Magnetic resonance imaging showed that, compared with Alb-cre + Aars2 fl / fl Compared to mice, Alb-cre - Aars2 fl / fl Mice developed more and larger tumors—both their maximum diameter and tumor area were significantly increased. Figure 18 Independent survival analysis further indicates that Alb-cre - Aars2 fl / fl The mice had a shorter overall survival, confirming the tumor-promoting effect of Aars2 in vivo. Figure 19 Consistent results were also observed by injecting transfected Hep3B and Huh7 cells into a subcutaneous xenograft model established in nude mice. Figure 20 Hematoxylin-eosin (H&E) staining and immunohistochemical analysis of the transplanted tumors supported these findings. Figure 21 Results from the nude mouse orthotopic transplantation model showed that AARS2 knockdown inhibited tumor growth in vivo, while AARS2 overexpression had the opposite effect. Figure 22 Bioluminescent imaging of the lung metastasis model further revealed that AARS2 knockdown significantly reduced the lung metastasis ability of the cell line, while overexpression promoted metastasis. Figure 23 Survival analysis of the lung metastasis model further showed that the AARS2shRNA transfection group had prolonged survival, while the overexpression group had shortened survival. Figure 24 ).
[0096] Given the broad relevance of lactation regulation in immunity, we investigated DEN / CCl4-induced Alb-cre -Aars2 fl / fl and Alb-cre + Aars2 fl / fl CyTOF-based immune cell analysis was performed on mouse tumors. Among the immune cell subsets, multiple cell types, including CD8+ T cells, Tregs, and NK cells, showed statistically significant differences in abundance between groups. Figure 25 These results indicate that AARS2 contributes to the formation of an immunosuppressive microenvironment in HCC.
[0097] Example 4: AARS2 can interact with AP-2γ
[0098] Combined with reference Figure 26-32 We performed immunoprecipitation-mass spectrometry (IP-MS) and lactation proteomics analysis in cells transfected with Flag-AARS2. Figure 26 Intersection analysis of these datasets identified five candidate genes: SFPQ, H4C1, AP-2γ, RCC2, and SF1. These five candidate genes were then knocked down using siRNA, and their functional changes were verified in vitro. Figure 27 EdU and Transwell experiments showed that knockdown of TFAP2C had the most significant inhibitory effect on cell line proliferation and migration. Figure 28 A, B). Based on these findings, we further investigated the interaction between AARS2 and AP-2γ. Through co-immunoprecipitation and proximity junction assays, we confirmed the existence of an interaction between AARS2 and AP-2γ (A, B). Figure 29 To determine the interaction domains between the two proteins, we constructed a series of truncated mutants of AARS2 and AP-2γ (AC). Figure 30 Co-IP analysis showed that amino acid residues 1-658 of AARS2 and amino acid residues 127-450 of AP-2γ are the interaction region. Figure 31 Based on AlphaFold3 molecular docking simulations, this interaction may involve potential amino acid binding sites such as Q706 and L734 on AARS2 and Q55 and E53 on AP-2γ. Site-directed mutagenesis experiments on these residues confirmed their functional roles in mediating the AARS2–AP-2γ interaction. Figure 32 In summary, these findings demonstrate that AARS2 directly interacts with AP-2γ, thus identifying AP-2γ as a downstream target of AARS2.
[0099] Example 5: The enzymatic activity of AARS2 and its lactation modification of AP-2γ are crucial for promoting tumor progression.
[0100] Combined with reference Figure 33-37 Overexpression of AARS2 increased the lactation level of AP-2γ. Figure 33 A). Lactic acidification proteomics identified the lysine 444 site (K444) of AP-2γ as the only site significantly modified after AARS2 overexpression. To confirm site specificity, a K444 mutant of AP-2γ was constructed. Co-IP analysis showed that the pan-lactation level of AP-2γ (K444R) showed only minimal change regardless of whether AARS2 was overexpressed. Figure 33 B). Using a specific antibody against the AP-2γ K444 site lactation mimicking mutation, Co-IP assays showed that AARS2 overexpression significantly increased lactation levels at this site. Figure 33 C) suggests that AARS2 specifically targets K444 for lactation modification. Figure 33 D).
[0101] To conduct functional studies, we mutated the lactase active site of AARS2 to eliminate its enzymatic activity. Figure 34 The enzyme-active mutant HA-AP-2γ (K444R) can still bind to AP-2γ like the wild-type AARS2, but it cannot induce lactation modification of AP-2γ. Figure 35 A, B). The interaction between AARS2 and AP-2γ is a necessary condition for AARS2 to perform lactation modification. Figure 35 C). This fully demonstrates the direct binding of AARS2 to AP-2γ and its direct lactation modification process. To determine whether the enzymatic activity of AARS2 is crucial for the oncogenic function of the AARS2-AP-2γ axis, we conducted functional experiments using mutants of the AARS2 enzyme active site. Colony formation ( Figure 36 ) and Transwell ( Figure 37 Experimental results showed that the lactation catalytic site of mutant AARS2 could reverse the enhanced proliferation, invasion, and migration capabilities resulting from AARS2 overexpression. In summary, AARS2 exerts its oncogenic function by lactating its downstream target AP-2γ, a process dependent on its enzymatic activity.
[0102] Example 6: AARS2-mediated AP-2γ lactation modification promotes its nuclear translocation
[0103] Combined with reference Figures 38-43 We then explored the downstream functional effects of AP-2γ lactation modification. Western blot analysis showed that AARS2 overexpression did not alter the total protein level of AP-2γ ( Figure 38 A). However, Western blot results confirmed that, with the total level unchanged, AP-2γ decreased in the cytoplasm and increased in the nucleus (A). Figure 38 B). Further multiplex immunofluorescence showed that AARS2 overexpression increased the nuclear localization of AP-2γ (B). Figure 39 This indicates that lactation modification of AP-2γ by AARS2 promotes its nuclear translocation. Subsequently, we examined the subcellular localization of the AP-2γ (K444R) mutant. Western blot analysis and multiplex immunofluorescence assays showed that the nuclear translocation ability of AP-2γ was significantly inhibited after mutation at the K444 site. Figure 40 , Figure 41 Furthermore, by mutating the lactation catalytic site of AARS2, we verified the crucial role of its enzymatic activity in AP-2γ nuclear translocation. Western blot analysis and multiplex immunofluorescence assays showed that overexpression of the catalytically inactive AARS2 mutant significantly reversed AP-2γ nuclear translocation induced by wild-type AARS2 overexpression. Figure 42 , Figure 43 ).
[0104] The above embodiments illustrate that AARS2, discovered in this invention, can inhibit the malignant progression of HCC cells as a therapeutic target, thereby providing a new strategy in the treatment of hepatocellular carcinoma.
[0105] The present invention has been described in the above-described embodiments; however, these embodiments are merely examples for implementing the present invention. It must be noted that the disclosed embodiments do not limit the scope of the present invention. Conversely, any modifications and refinements made without departing from the spirit and scope of the present invention are within the scope of patent protection of the present invention.
Claims
1. The use of AARS2-targeting inhibitors in the preparation of tumor therapeutic drugs.
2. The use of the AARS2-targeting inhibitor as described in claim 1 in the preparation of a tumor therapeutic drug, characterized in that, The tumor treatment drug has at least one of the following functions: inhibiting the proliferation of tumor cells; inhibiting tumor growth.
3. The use of the AARS2-targeting inhibitor as described in claim 2 in the preparation of tumor therapeutic drugs, characterized in that, The tumor is one that overexpresses AARS2.
4. The use of the AARS2-targeting inhibitor as described in claim 1 in the preparation of tumor therapeutic drugs, characterized in that, The tumor is hepatocellular carcinoma.
5. The use of the AARS2-targeting inhibitor as described in claim 1 in the preparation of a tumor therapeutic drug, characterized in that, The AARS2 inhibitor is siRNA, shRNA, antibody, or small molecule compound.
6. The use of the AARS2-targeting inhibitor as described in claim 1 in the preparation of a tumor therapeutic drug, characterized in that, The AARS2 inhibitor is the sole or one of the active ingredients in the tumor treatment drug.
7. Use of AARS2 inhibitors in the preparation of drugs having at least one of the following functions: inhibiting lactate metabolism in tumor cells; inhibiting AP-2γ lactation in tumor cells.