Fusarium verticillium GQBF-1 and application thereof in preventing and treating powdery mildew of plants
By providing Fusarium verticillata GQBF-1 and its inoculum, the conidia of powdery mildew pathogens are inhibited and killed by the hyperparasitic mechanism, solving the problem of resource scarcity in existing technologies and achieving highly efficient biological control of powdery mildew in wolfberry and apple.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-09
- Publication Date
- 2026-04-03
AI Technical Summary
In the existing technology, non-pathogenic Fusarium resources are scarce, especially the application of Fusarium verticillatum GQBF-1 in the control of powdery mildew in plants has not been fully developed, resulting in insignificant biological control effects and difficulty in large-scale promotion.
We provide Fusarium verticillata GQBF-1 and its inoculum, which inhibits and kills the conidia of powdery mildew pathogens through hyperparasitism. It is used for the control of powdery mildew in wolfberry and apple. The inoculum contains live bacteria, metabolites and an agriculturally acceptable liquid carrier, in the form of water-dispersible granules or suspensions.
Fusarium verticillata GQBF-1 significantly inhibited the germination rate of conidia of powdery mildew in wolfberry and apple by 82% and 91%, respectively, demonstrating significant control effects against powdery mildew in wolfberry and apple.
Smart Images

Figure CN121780339A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biological control technology for plant diseases, specifically to a Fusarium verticillioides GQBF-1 and its application in controlling powdery mildew in plants. Background Technology
[0002] Powdery mildew is a major global plant disease caused by obligate parasitic fungi in the order Erythromycetes of the phylum Ascomycota. It has an extremely wide host range, encompassing thousands of food crops, economic forest fruits, and ornamental plants, including wolfberry and apple trees, posing a serious threat to agricultural production and the horticulture industry. In the early stages, a white, powdery mold layer, ranging in size from pinhead to grain of rice, appears on the upper and lower surfaces of leaves, young branches, buds, and even the surface of fruits. This is actually the conidia and mycelium of the fungus, and feels finely powdery to the touch. As the disease progresses, the white mold layer gradually turns grayish-white and grayish-brown, and later, black cleistothecia (the fungus's overwintering reproductive structure) will form. This infection directly hinders photosynthesis, leading to yellowing and curling of leaves, premature leaf drop, deformed growth of young branches, and rough, cracked fruit surfaces. This not only significantly reduces crop yield but also severely affects its market quality, causing substantial economic losses to growers.
[0003] For the prevention and control of powdery mildew in plants, the industry generally follows the core principle of "prevention first, comprehensive control." Among these, biological control, due to its environmental friendliness and safety, has become a core means in the development of green agriculture. Currently, commonly used biocontrol bacteria include dominant groups such as Trichoderma and Bacillus subtilis. These strains can be applied flexibly through foliar spraying, soil basal application, or seed treatment. Their disease control mechanisms are diverse and highly efficient. They can both entangle and disintegrate the mycelium of powdery mildew through hyperparasitism, and secrete antibacterial substances to inhibit the germination of fungal spores. At the same time, they can also induce the plant to develop its own disease resistance, leaving no pesticide residues throughout the process. Some strains can also secrete growth-promoting substances, achieving a dual effect of "disease prevention + growth promotion," making them suitable for various cultivation scenarios such as open fields and greenhouses.
[0004] Fusarium fungi are traditionally considered highly pathogenic plant pathogens, frequently causing diseases such as wilt and Fusarium head blight in crops. However, recent studies have discovered a special group of strains within this genus that are non-pathogenic to plants and can even play a beneficial role. These strains can also precisely target pathogens such as powdery mildew through hyperparasitism, inhibiting their infection and reproduction, providing a new direction for the biological control of powdery mildew. However, among the non-pathogenic Fusarium fungi reported so far, the number of strains with clear control effects, high-efficiency antifungal activity, and stable field application is extremely small, especially high-quality biocontrol resources related to Fusarium verticillioides, which is even scarcer. This situation limits the large-scale application and promotion of such biocontrol fungi. Summary of the Invention
[0005] This invention provides a Fusarium verticillioides GQBF-1 and its application in the control of powdery mildew in plants. The Fusarium verticillioides GQBF-1 exhibits hyperparasitism against powdery mildew fungi, significantly inhibiting the germination of conidia of powdery mildew pathogens and causing their death; it can be used for the effective control of powdery mildew in plants, including powdery mildew of wolfberry and powdery mildew of apple.
[0006] On the one hand, the present invention provides a Fusarium verticillata GQBF-1.
[0007] The *Fusarium verticillatum* GQBF-1 significantly inhibited and killed the conidia of *Arthrocladiella mougeotii* and *Podosphaera leucotricha*.
[0008] The *Fusarium verticillata* GQBF-1 strain was deposited on January 22, 2026, at the China Center for Type Culture Collection (CCTCC), located at Wuhan University, No. 299 Bayi Road, Wuchang District, Wuhan, Hubei Province, with accession number CCTCC M2026195. It possesses the ITS sequence shown in SEQ ID NO.1.
[0009] The *Fusarium verticillatum* GQBF-1 strain was isolated and screened from wolfberry leaves, and this strain has the following morphological characteristics:
[0010] Colony characteristics: When cultured in PDA medium (potato dextrose agar) at 25-28℃ in the dark for 4-7 days, the colony diameter can reach 6.5-7.8 cm. The colony initially presents as white, fluffy aerial mycelia, which gradually turn into typical light purple in the later stages. The aerial mycelia are moderately dense, the conidiomata are sparsely formed, and there is no obvious pigment diffusion into the culture medium.
[0011] Spore characteristics: This strain does not produce large conidia; small conidia are colorless and transparent, mainly elliptical in shape, mostly 0-septate (single-celled) structures, with a size of (5.2-11.8) μm × (2.1-3.6) μm, and the spores are arranged in a chain-like or pseudocapital pattern, with good dispersibility.
[0012] On the other hand, the present invention provides an application of Fusarium verticillatum GQBF-1 in the control of plant powdery mildew, wherein the application involves using Fusarium verticillatum GQBF-1 to inhibit the germination of conidia of plant powdery mildew pathogens and kill them; the plant powdery mildew includes wolfberry powdery mildew and apple powdery mildew.
[0013] Furthermore, the pathogen causing powdery mildew in wolfberry is *Arthrocladiella mougeotii* of the genus *Arthrocladiella*; the pathogen causing powdery mildew in apple is *Podosphaera leucotricha* of the genus *Podosphaera*.
[0014] In another aspect, the present invention provides a Fusarium verticillata GQBF-1 inoculum, the inoculum comprising one or more of the following: live Fusarium verticillata GQBF-1 cells, Fusarium verticillata GQBF-1 metabolites, and Fusarium verticillata GQBF-1 spore suspension.
[0015] The term "metabolite" refers to the primary and / or secondary metabolites produced during microbial metabolism. Primary metabolism refers to the process by which microorganisms absorb various nutrients from the external environment and, through catabolism and anabolism, generate substances and energy to sustain life activities. The products of primary metabolism are called primary metabolites, such as monosaccharides or monosaccharide derivatives, nucleotides, vitamins, amino acids, fatty acids, and various macromolecular polymers composed of them, such as proteins, nucleic acids, polysaccharides, and lipids. Secondary metabolism refers to the process by which microorganisms, at a certain growth stage, use primary metabolites as precursors to synthesize substances that have no clearly defined function for their life activities. The products of secondary metabolism are called secondary metabolites, and are mostly compounds with relatively complex molecular structures. Based on their functions, they can be classified into types such as antibiotics, hormones, alkaloids, and toxins.
[0016] Furthermore, the Fusarium verticillata GQBF-1 inoculant also contains an agriculturally acceptable carrier.
[0017] Furthermore, the carrier is a liquid carrier, including water, sugar solution, polyol solution, Tween 80, and Span 60.
[0018] Furthermore, the form of Fusarium verticillata GQBF-1 inoculum can be water-dispersible granules or suspension concentrates.
[0019] Furthermore, the preparation method of the *Fusarium verticillatum* GQBF-1 inoculum specifically includes the following steps:
[0020] S1. Strain activation: Inoculate the preserved GQBF-1 strain onto PDA medium (potato dextrose agar) and incubate at 25-28°C for 4-7 days;
[0021] S2. Strain culture: Transfer the GQBF-1 strain cultured in step S1 above to fresh PDA medium and culture it in an incubator at 25~28℃ for 4~7 days;
[0022] S3. Fermentation culture: Fusarium verticillata GQBF-1 was inoculated into PDB culture medium (potato dextrose liquid medium) and cultured with shaking at 25~28℃ and 150~200 rpm for 4~7 days to obtain a fermentation broth rich in live cells and spores.
[0023] Furthermore, the preparation method of the Fusarium verticillata GQBF-1 inoculum can also include the preparation of spore suspension after step S2: pick the edge hyphae of PDA medium, place them in a 10mL centrifuge tube, add 10mL of distilled water, shake and mix for 10min, filter to remove hyphae fragments, and collect the spore suspension.
[0024] Furthermore, the preparation method of the Fusarium Verticillium GQBF-1 inoculant may also include step S4: formulation processing: after centrifugation / filtration, the live cells of the fermentation broth prepared in step S3 are collected, and the live cells and the carrier are mixed evenly at a mass ratio of 1:10 to 1:50.
[0025] Furthermore, the carrier is a liquid carrier, including water, sugar solution, polyol solution, Tween 80, and Span 60.
[0026] Furthermore, the specific steps for using the *Fusarium verticillatum* GQBF-1 inoculant are as follows: the inoculant is diluted with sterile water to obtain a viable bacteria concentration of 10. 3 Apply or spray a bacterial suspension of CFU / mL onto the leaves of wolfberry or apple seedlings for 7-9 days.
[0027] Compared with the prior art, the present invention has the following beneficial effects:
[0028] This invention demonstrates that *Fusarium verticillatum* GQBF-1 exhibits significant hyperparasitic activity against powdery mildew of wolfberry and apple, inhibiting and killing the conidia of both fungi. When *Fusarium verticillatum* GQBF-1 suspension was applied or sprayed onto diseased wolfberry and apple leaves, the results showed that *Fusarium verticillatum* GQBF-1 inhibited the germination of *F. verticillatum* powdery mildew by up to 82% and the germination of *F. verticillatum* powdery mildew by up to 91%. Attached Figure Description
[0029] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.
[0030] Figure 1 The images show ultramicroscopic morphological diagrams of the interaction between *Fusarium verticillatum* GQBF-1 and *Erysiphe lycium*. Figure (A) shows the morphology of *Erysiphe lycium* conidia during normal germination; Figure (B) shows the image of *Fusarium verticillatum* GQBF-1 hyphae covering *Erysiphe lycium* conidia observed after 9 days of interaction; and Figure (C) shows the morphology of *Fusarium verticillatum* GQBF-1 spores.
[0031] Figure 2 The images show optical microscopic morphological diagrams of the interaction between Fusarium verticillatum GQBF-1 and Lycium barbarum powdery mildew. Figure (A) shows the inhibition of Lycium barbarum powdery mildew conidia germination by Fusarium verticillatum GQBF-1, while Figure (B) shows the normal germination of Lycium barbarum powdery mildew conidia.
[0032] Figure 3 The optical microscope images show the interaction between Fusarium verticillatum GQBF-1 and Powdery mildew of apple. Figure (A) shows the normal germination of Powdery mildew conidia after 9 days, and Figure (B) shows the germination of Powdery mildew conidia after 9 days of mixed culture of hyperparasitic spores and Powdery mildew conidia.
[0033] Figure 4 The images show the effects of Fusarium verticillatum GQBF-1 on potted wolfberry plants infected with powdery mildew. Figure (A) shows the potted wolfberry plants and leaves infected with powdery mildew; Figure (B) is a control image of wolfberry plants infected with powdery mildew one week after being sprayed with a suspension of parasitic bacteria. Detailed Implementation
[0034] Example 1
[0035] Isolation and purification of Fusarium verticillatum strain GQBF-1:
[0036] Leaves infected with powdery mildew on wolfberry plants were taken and cut into 1cm × 1cm squares using sterile scissors. Five leaf pieces were placed on sterile PDA medium (9cm) in each dish and incubated at 25℃ for 7 days. Single colonies of different colors and morphologies were selected and transferred to sterile PDA medium (9cm) for incubation at 25℃ for 7 days. This experiment was repeated five times to obtain a purified strain. The purified strain was inoculated onto PDA slant tubes and stored at -20℃ for later use. The colonies were pale purple and did not produce large conidia. The small conidia were colorless and mostly 0-septate and 1-septate, with fewer chlamydospores produced.
[0037] Example 2
[0038] ITS identification of Fusarium verticillatum strain GQBF-1:
[0039] DNA was extracted from the fungi isolated and purified in Example 1 and subjected to ITS sequencing.
[0040] (1) The primers and sequences for PCR amplification are shown in Table 1.
[0041] Table 1 Primers and sequences for fungal ITS-PCR amplification
[0042] (2) The PCR amplification system is shown in Table 2.
[0043] Table 2. Fungal ITS PCR Amplification System
[0044]
[0045] (3) The PCR reaction conditions are shown in Table 3.
[0046] Table 3. PCR reaction conditions for fungal ITS
[0047]
[0048] (4) Sequencing and comparison of PCR products: The PCR amplification products after 1.5% agarose gel electrophoresis were sent to Shanghai Sangon Biotech Co., Ltd. for sequencing and identification, and compared and analyzed in the NCBI Blast (https: / / www.ncbi.nlm.nih.gov / ) database to determine the species of the strain. The specific result was Fusarium verticillioides.
[0049] (5) The ITS sequence of this strain (SEQ ID NO.1 in the sequence listing):
[0050] CCTGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCCTGTGAACATACCAATTGTTGCCTCGGCGGATCAGCCCGCTCCCGGTAAAACGGGACGGCCCGCCAGAGGACCCTAAACTCTGTTTCTATATGTAACTTCTGAGTAAAACCATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCG AATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCAGCTTGGTGTTGGGACTCGCGAGTCAAATCGCGTTCCCCAAATTGATTGGCGG TCACGTCGAGCTTCCATAGCGTAGTAGTAAAACCCTCGTTACTGGTAATCGTCGCGGCCACGCCGTTAAACCCCAACTTCTGAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATC
[0051] Example 3
[0052] The test materials included *Arthrocladiella mougeotii* isolated from naturally diseased *Lycium barbarum* leaves, *Fusarium verticillatum* GQBF-1 preserved in the laboratory, and robust *Lycium barbarum* seedlings with uniform growth (30 days old, 3-4 true leaves) that had undergone acclimatization culture for 3 days prior. The experiment included a treatment group and a control group, with 3 biological replicates per group and 3 seedlings per replicate. Fresh conidia of *Arthrocladiella mougeotii* were first collected and diluted with sterile water to a concentration of 10⁻⁶. 5 A bacterial suspension was prepared at CFU / mL; the activated Fusarium verticillata GQBF-1 was eluted with sterile water and the concentration was adjusted to 10. 3A bacterial suspension was prepared at CFU / mL, and an equal volume of sterile water was prepared for later use. In the treatment group, the *P. lychnophora* suspension was evenly applied to both sides of the 2nd and 3rd true leaves of *L. lychnophora* seedlings using a sterile brush. After inoculation, the seedlings were placed in an artificial climate chamber at 25±1℃, 60%-70% relative humidity, and 12h light / 12h dark. One day later, the same method was used to apply *Fusarium verticillata* GQBF-1 bacterial suspension, and incubation continued. In the blank control group, the inoculation method, inoculation amount, and initial culture conditions were the same as the treatment group. One day later, an equal volume of sterile water was applied, and subsequent culture conditions were the same. Both groups were observed after 9 days of incubation.
[0053] (1) The results of scanning electron microscopy observation are shown in Figure 1 In the blank control group, the conidia of *Alternaria alternata* germinated normally and the germ tubes extended completely. In the treatment group, the hyphae of *Fusarium verticillatum* GQBF-1 tightly covered the conidia of *Alternaria alternata*, preventing them from germinating.
[0054] The results of optical microscopy observation are shown below Figure 2 When a suspension of hyperparasitic spores was co-cultured with conidia of *Erythromyces lycopersicum* for 9 days, the conidia of *Erythromyces lycopersicum* did not germinate; however, the conidia of *Erythromyces lycopersicum* without the hyperparasitic suspension germinated and grew normally after 9 days.
[0055] (2) The germination of conidia was counted based on the germ tube length being greater than or equal to the spore diameter. 100 independent spores were counted in each group each time, and a total of 300 spores were counted in 3 replicates.
[0056] The calculation formula is: Germination inhibition rate (%) = (Germination rate of control group - Germination rate of treatment group) / Germination rate of control group × 100%.
[0057] The germination rate was 85% in the blank control group and 15.3% in the treatment group. Ultimately, Fusarium verticillatum GQBF-1 inhibited the germination of conidia of Lycium barbarum powdery mildew by 82%.
[0058] The isolation process of the above-mentioned powdery mildew fungus [Arthrocladiella mougeotii] was as follows: Ningqi No. 5 was planted in a plant culture box, and healthy seedlings were obtained after 30 days. Naturally diseased powdery mildew fungus was artificially inoculated onto the leaves of healthy seedlings. After 15 days, single conidia of powdery mildew fungus were picked from diseased leaves and inoculated onto the leaves of healthy seedlings. This was repeated 3 times to obtain purified powdery mildew fungus conidial strains, which were sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. The sequencing result was Arthrocladiella mougeotii.
[0059] Example 4
[0060] The test materials included *Podosphaeraleucotricha* isolated from naturally diseased apple leaves, *Fusarium verticillatum* GQBF-1 preserved in the laboratory, and robust, uniformly growing apple seedlings (35 days old, 4-5 true leaves) that had undergone 3 days of pre-acclimatization. The experiment included a treatment group and a control group, with 3 biological replicates per group and 3 seedlings per replicate. Fresh conidia of *P. appleiculatus* were collected and diluted with sterile water to a concentration of 10⁻⁶. 5 The bacterial suspension was prepared at CFU / mL; the preparation method for the Fusarium verticillatum GQBF-1 bacterial suspension was the same as in Example 1, and an equal volume of sterile water was prepared for use. In the treatment group, the apple powdery mildew bacterial suspension was evenly applied to both sides of the 2nd-4th true leaves of apple seedlings using a sterile brush. After inoculation, the seedlings were placed in an artificial climate chamber with the same conditions as in Example 1. One day later, the Fusarium verticillatum GQBF-1 bacterial suspension was applied and cultured further. In the blank control group, the inoculation and initial culture conditions for apple powdery mildew were the same as in the treatment group. One day later, an equal volume of sterile water was applied, and subsequent culture conditions were the same.
[0061] (1) Both groups were observed after 9 days of culture. The results of optical microscopy observation are shown in the figure. Figure 3 In the blank control group, the conidia of *Powdery mildew* germinated normally and the germ tubes extended smoothly. In the treatment group, the hyphae of *Fusarium verticillatum* GQBF-1 tightly covered the conidia of *Powdery mildew* and inhibited their germination.
[0062] (2) The statistical criteria and replication settings for conidial germination were the same as in Example 3. The germination rate of the blank control group was 88%, the germination rate of the treatment group was 7.9%, and the final inhibition rate of Fusarium verticillatum GQBF-1 on the germination of conidia of Powdery Mildew of Apple reached 91%.
[0063] The isolation process of the above-mentioned apple powdery mildew [Podosphaera leucotricha] was as follows: In a plant culture box, apple variety Qingzhen 1 was planted. After 30 days, healthy seedlings were obtained. Naturally diseased apple powdery mildew was artificially inoculated onto the leaves of healthy Qingzhen 1 seedlings. After 15 days, a single apple powdery mildew conidia was picked from the diseased leaves and inoculated onto the leaves of healthy Qingzhen 1 seedlings. This was repeated 3 times to obtain purified apple powdery mildew conidial strains, which were sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. The sequencing result was Podosphaera leucotricha.
[0064] Example 5
[0065] (1) Activation of strain: Take a piece of the slant of GQBF-1 strain stored at 4℃ with a sterile inoculation needle, inoculate it on PDA medium, and incubate it in an incubator at 25℃ for 7 days.
[0066] (2) Culture of strain: The GQBF-1 strain cultured for 7 days in step (1) was transferred to fresh PDA medium and cultured for another 7 days in an incubator at 25°C.
[0067] (3) Fermentation: Using a sterile punch with a diameter of 6 mm, make several mycelial cakes at the edge of the GQBF-1 strain colony in step (2). Inoculate 5 mycelial blocks into each 100 mL PDB culture medium and culture the fermentation broth rich in live cells and spores at 150 rpm and 25 °C for 6 days.
[0068] Example 6
[0069] Similar to Example 5, except that the fermentation broth, after 6 days of cultivation, was filtered through four layers of gauze to collect the live bacterial cells. The live bacterial cells were then mixed with 20% glycerol (a carrier) at a mass ratio of 1:10 to obtain Fusarium verticillatum GQBF-1 inoculum.
[0070] Example 7
[0071] Similar to Example 5, the difference is that after step (2), the edge hyphae of the PDA medium are picked, placed in a 10mL centrifuge tube, 10mL of distilled water is added, the mixture is shaken for 10min, filtered through a 300-mesh sterile sieve to remove hyphae fragments, and the spore suspension is collected.
[0072] Example 8
[0073] The test materials included: powdery mildew of Lycium barbarum [Arthrocladiella mougeotii] isolated and purified from naturally diseased Lycium barbarum leaves, fermentation broth of Fusarium verticillata GQBF-1 prepared in Example 5, and robust and uniformly growing potted Lycium barbarum seedlings (45 days old, 6-8 true leaves). The potting substrate was humus:perlite = 3:1, and the seedlings were acclimatized for 5 days in an artificial climate chamber (temperature 25±1℃, relative humidity 60%-70%, photoperiod 12h light / 12h dark).
[0074] The experiment included a control group and a blank control group, with three biological replicates in each group, and three potted wolfberry seedlings in each replicate. Fresh conidia of *Powdery mildew* were first collected and diluted with sterile water to a concentration of 10. 8 A bacterial suspension was prepared at CFU / mL and evenly sprayed onto both sides of the leaves of all potted wolfberry seedlings using a sterile sprayer to ensure that a uniform water film forms on the leaf surface. After inoculation, the seedlings were cultured in the artificial climate chamber. Further treatment was carried out when obvious powdery mildew spots appeared on the leaves (in the early stage of the disease, the area of the spots accounted for 10%-15% of the leaf area).
[0075] The control group used a sterile sprayer to evenly spray the fermentation broth of Fusarium verticillatum GQBF-1 onto both sides of the diseased wolfberry leaves, with the standard being that the leaves were moist but not dripping water; the blank control group was sprayed with an equal amount of sterile water, and both groups were placed in the same environmental conditions for cultivation after treatment.
[0076] After one week of cultivation, the changes in powdery mildew lesions on wolfberry leaves were observed and recorded, and the results are shown in Figure 4. As shown in Figure 4, in the blank control group (Figure 4A), the powdery mildew lesions on wolfberry leaves continued to expand, the proportion of lesion area increased significantly, and the mold layer thickened, indicating a worsening of the disease. In the control group (Figure 4B), the powdery mildew lesions on wolfberry leaves were effectively controlled; the original lesions no longer expanded, some lesion edges dried and faded, the mold layer gradually thinned and fell off, and no new lesions appeared on the leaves. This indicates that the fermentation broth of *Fusarium verticillata* GQBF-1 has a significant potted control effect on powdery mildew of wolfberry.
Claims
1. A type of Fusarium verticillatum GQBF-1, characterized in that, The accession number of Fusarium verticillatum GQBF-1 is CCTCC M 2026195, the depositary institution is China Center for Type Culture Collection, and the deposit date is January 22, 2026.
2. The *Fusarium verticillatum* GQBF-1 according to claim 1, characterized in that, It has an ITS sequence as shown in SEQ ID NO.
1.
3. The application of Fusarium verticillatum GQBF-1 according to claim 1 in the control of powdery mildew in plants, characterized in that, Fusarium verticillata GQBF-1 was used to inhibit the germination of conidia of the plant powdery mildew pathogen and kill it. The powdery mildew diseases mentioned include powdery mildew of wolfberry and powdery mildew of apple.
4. The application according to claim 3, characterized in that, The pathogen causing powdery mildew in wolfberry is *Hylocereus muscaria*, belonging to the genus *Hylocereus*; the pathogen causing powdery mildew in apple is *Phyllostachys macrantha*, belonging to the genus *Hylocereus*.
5. A Fusarium verticillata GQBF-1 inoculant for controlling powdery mildew in plants, characterized in that, Contains one or more of the following: live Fusarium verticillata GQBF-1 cells, Fusarium verticillata GQBF-1 metabolites, Fusarium verticillata GQBF-1 spore suspension, and an agriculturally acceptable liquid carrier; The liquid carrier includes water, sugar solution, polyol solution, Tween 80, and Span 60.
6. The *Fusarium verticillata* GQBF-1 inoculant according to claim 5, characterized in that, The formulation of the microbial agent is water-dispersible granules or suspension.
7. The method for preparing the Fusarium verticillata GQBF-1 inoculant according to claim 5, characterized in that, Includes the following steps: S1. Strain activation: Inoculate the preserved Fusarium verticillata GQBF-1 onto PDA medium and incubate at 25-28℃ for 4-7 days; S2. Strain transfer: Transfer the strain cultured in step S1 to fresh PDA medium and continue to culture in an incubator at 25~28℃ for 4~7 days; S3. Fermentation culture: Inoculate the strain from step S2 into PDB culture medium and culture with shaking at 25~28℃ and 150~200rpm for 4~7 days to obtain a fermentation broth rich in live cells and spores.
8. The method for preparing the Fusarium verticillata GQBF-1 inoculant according to claim 7, characterized in that, Spore suspension can also be prepared after step S2. The specific steps include: picking mycelia from the edge of the PDA medium, placing them in a centrifuge tube, adding distilled water, shaking thoroughly to mix, filtering, and removing mycelial fragments to obtain the spore suspension.
9. The method for preparing the Fusarium verticillata GQBF-1 inoculant according to claim 7, characterized in that, Step S3 is followed by step S4, preparation processing: the fermentation broth from step S3 is centrifuged / filtered to collect live cells, and the live cells are mixed with the carrier at a mass ratio of 1:10 to 1:
50.
10. The method of applying the *Fusarium verticillatum* GQBF-1 inoculant according to any one of claims 5-6, characterized in that, The Fusarium verticillata GQBF-1 inoculum was diluted with sterile water to a viable cell concentration of 10. 3 A bacterial suspension of CFU / mL can be applied to the leaves of wolfberry or apple seedlings by smearing or spraying for 7-9 days to prevent powdery mildew in wolfberry or apple.