Application of GNAT family inferred N-acetyltransferase and mutants thereof in production of L-threonine
By mutating and overexpressing GNAT family putative N-acetyltransferases, the problem of low efficiency in L-threonine production by Escherichia coli was solved, and efficient production of L-threonine and other amino acids was achieved.
Patent Information
- Application Number
- CN202511989771.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-26
- Publication Date
- 2026-04-03
AI Technical Summary
In the existing technology, the efficiency of producing L-threonine using Escherichia coli is relatively low, and it is necessary to increase the L-threonine yield of the strain to meet market demand.
By mutating the putative N-acetyltransferases of the GNAT family, particularly by mutating the asparagine residue at position 152 to tyrosine, and then overexpressing or upregulating their expression in E. coli, recombinant strains were constructed to improve the production capacity of L-threonine.
It significantly improved the L-threonine production capacity of Escherichia coli and enhanced the production capacity of other amino acids, such as glutamic acid and valine, thereby improving production efficiency.
Smart Images

Figure FT_1 
Figure FT_2 
Figure SMS_1
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology, specifically relating to the application of GNAT family putative N-acetyltransferases and their mutants in the production of L-threonine. Background Technology
[0002] L-Threonine is a limiting amino acid that promotes the development of mammalian mammary cells, improves the immune status of animals, and accelerates muscle tissue repair. It is widely used in the pharmaceutical, food, and feed industries. Currently, L-Threonine is mainly produced industrially through microbial fermentation. With the increasing market demand for L-Threonine, researchers are increasingly focusing on optimizing the fermentation performance of production strains and developing more economical and efficient fermentation processes to improve threonine production efficiency.
[0003] The application of *E. coli* in threonine production can be traced back to the late 20th and early 21st centuries. With advancements in biotechnology, scientists discovered that by modifying *E. coli* through metabolic engineering, L-threonine could be produced efficiently. The application of metabolic engineering technology has made *E. coli* the primary strain for industrial L-threonine production due to its short growth cycle, high cell strength, and low equipment requirements.
[0004] In Escherichia coli, the synthesis of L-threonine begins with aspartic acid and is gradually converted to L-threonine through a series of enzymatic reactions. These reactions are controlled by a variety of enzymes, and changes in each step of the metabolic pathway affect the system's parameters and metabolic flux.
[0005] yhbS The gene-encoded protein belongs to the GNAT family of putative N-acetyltransferases and has a conserved ATP-binding cassette domain. There are currently no reports on the production of L-threonine by Enterobacteriaceae using GNAT family putative N-acetyltransferases and their mutants. Summary of the Invention
[0006] The purpose of this invention is to improve the L-threonine production of the strain.
[0007] This invention first protects GNAT family-proposed N-acetyltransferase mutants, which may include at least any of the following:
[0008] C1) The protein obtained by mutating the asparagine residue at position 152 in the amino acid sequence of the GNAT family of presumed N-acetyltransferases; C2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in C1).
[0009] The GNAT family of N-acetyltransferases is presumed to be E1, E2, or E3. E1) contains at least the amino acid sequence shown in SEQ ID No. 5; E2) is a protein with 98% or more identity and the same function as E1) obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence of E1. E3) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of E1) or E2).
[0010] The phrase "having 98% or more identity with E1" can specifically mean having 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% identity with C1).
[0011] Any of the GNAT family putative N-acetyltransferase mutants described above may comprise a protein obtained by mutating the asparagine residue at position 152 of the amino acid sequence of the GNAT family putative N-acetyltransferase to a tyrosine residue.
[0012] The GNAT family of proposed N-acetyltransferase mutants described above may contain an amino acid sequence as shown in SEQ ID No. 9.
[0013] Specifically, the amino acid sequence of the GNAT family presumed N-acetyltransferase described above is shown in SEQ ID No. 5. The amino acid sequence of the GNAT family presumed N-acetyltransferase mutant is shown in SEQ ID No. 9.
[0014] Nucleic acid molecules encoding any of the GNAT family putative N-acetyltransferase mutants described above, or expression cassettes, recombinant vectors, and / or recombinant microorganisms containing said nucleic acid molecules, are also within the scope of protection of this invention.
[0015] Any of the above-mentioned nucleic acid molecules may contain B1) or B2): B1) A DNA molecule containing the coding sequence shown in SEQ ID No. 8; B2) has 75% or more identity with the nucleotide sequence defined in B1) and encodes a DNA molecule that is a presumed N-acetyltransferase mutant of any of the GNAT family described above.
[0016] The nucleic acid molecule mentioned above can specifically be B1 or B2.
[0017] Specifically, the nucleotide sequence of any of the above-described nucleic acid molecules may be as shown in SEQ ID No. 8.
[0018] The aforementioned identity refers to the degree of similarity between the nucleotide sequences of two nucleic acid molecules or the amino acid sequences of two protein molecules in molecular evolution studies.
[0019] The recombinant microorganism containing the aforementioned nucleic acid molecule can specifically be the recombinant bacterium W3110 mentioned in the examples. Ptrc-yhbS Recombinant strain W3110- yhbS N152Y Recombinant strain W3110- Ptrc - yhbS N152Y Recombinant bacteria YPThr- Ptrc - yhbS, Recombinant bacteria YPThr- yhbS N152Y Or recombinant bacteria YPThr- Ptrc - yhbS N152Y .
[0020] This invention also protects an engineered bacterium, which may include Escherichia coli that has undergone any or more of the following modifications in vivo; A1) Upregulate the expression level and / or activity of any of the GNAT family N-acetyltransferases mentioned above; A2) Expressing any of the GNAT family putative N-acetyltransferase mutants described above; A3) Mutate any of the above-described GNAT family-proposed N-acetyltransferases into any of the above-described GNAT family-proposed N-acetyltransferase mutants.
[0021] The aforementioned engineered bacteria are generally applicable to all Escherichia coli, with a preference for Escherichia coli capable of producing L-threonine; however, no further limitations are made here. Specifically, the Escherichia coli may be Escherichia coli capable of producing L-threonine (…). Escherichia coli YP0158 CGMCC No.25404. The *E. coli* mentioned may specifically be *E. coli* W3110. *E. coli* W3110 produces a low amount of L-threonine and is generally not used for L-threonine production.
[0022] The engineered bacteria obtained by modifying E. coli in vivo using A1) can specifically be the recombinant bacteria YPThr- mentioned in the examples. Ptrc - yhbS Or recombinant strain W3110- Ptrc-yhbS .
[0023] The engineered bacteria obtained by modifying E. coli (A2) in vivo can specifically be the recombinant bacteria YPThr- mentioned in the examples. Ptrc - yhbS N152Y Or recombinant strain W3110- Ptrc -yhbS N152Y .
[0024] The engineered bacteria obtained by modifying E. coli in vivo using A3 can specifically be the recombinant bacteria YPThr- mentioned in the examples. yhbS N152Y Or recombinant strain W3110- yhbS N152Y .
[0025] In A2) above, the expression can be an overexpression.
[0026] Any of the above-mentioned recombinant bacteria YPThr- Ptrc - yhbS It is Escherichia coli ( Escherichia coli The genome of YP0158 CGMCC No.25404, as shown in SEQ ID No.1 adhE The integration site sequence was replaced with the DNA sequence shown in SEQ ID No. 3, positions 501-1078 from the 5' end, while maintaining Escherichia coli (E. coli). Escherichia coli The recombinant *E. coli* strain YP0158 (CGMCC No. 25404) was obtained with the other nucleotide sequences of its genome unchanged. The recombinant strain YPThr- Ptrc-yhbS The genome contains wild-type yhbS Genes and overexpression yhbS Genes (from) Ptrc (Bootbox startup) Two copies.
[0027] Any of the above-mentioned recombinant bacteria W3110- Ptrc-yhbS It is the genome of Escherichia coli W3110 represented by SEQ ID No. 1 adhE The integration site sequence was replaced with the DNA sequence shown in SEQ ID No. 3, positions 501-1078 from the 5' end, while keeping the other nucleotide sequences of the *E. coli* W3110 genome unchanged, resulting in recombinant *E. coli*. Recombinant strain W3110- [[ID=3l]]Ptrc-yhbS The genome contains wild-type yhbS Genes and overexpression yhbS Genes (from) Ptrc (Bootbox startup) Two copies.
[0028] Any of the above-mentioned recombinant bacteria YPThr- yhbS N152Y It is Escherichia coli ( Escherichia coli YP0158 CGMCC No.25404 genome yhbS Gene mutation yhbS N152Y Genes and maintain Escherichia coli ( Escherichia coliThe recombinant E. coli with YP0158 CGMCC No.25404 and other nucleotide sequences of the genome remained unchanged was obtained. yhbS N152Y The nucleotide sequence of the gene is shown in SEQ ID No. 8, and the encoding amino acid sequence is shown in SEQ ID No. 9. N152Y protein. yhbS N152Y Genes are yhbS The mutation at nucleotide 454 of the gene, A, is replaced by T, and subsequently, the yhbS protein undergoes a mutation from asparagine to tyrosine at position 152 from the N-terminus.
[0029] Any of the above-mentioned recombinant bacteria W3110- [[ID=A3]]yhbS N152Y It is the genome of Escherichia coli W3110 yhbS Gene mutation yhbS N152Y The recombinant E. coli was obtained by extracting the gene while keeping other nucleotide sequences of the E. coli W3110 genome unchanged. Recombinant strain W3110- yhbS N152Y The genome contains yhbS N152Y Genes that do not contain wild-type genes. yhbS Gene.
[0030] Any of the above-mentioned recombinant bacteria YPThr- Ptrc - yhbS N152Y It is Escherichia coli ( Escherichia coli The genome of YP0158 CGMCC No.25404, as shown in SEQ ID No.1 adhE The integration site sequence was replaced with the DNA sequence shown in SEQ ID No. 10, positions 501-1078 from the 5' end, while maintaining Escherichia coli (E. coli). Escherichia coli The recombinant *E. coli* strain YP0158 (CGMCC No. 25404) was obtained with the other nucleotide sequences of its genome unchanged. The recombinant strain YPThr- Ptrc - yhbS N152Y The genome contains wild-type yhbS Genes and overexpression yhbS N152Y Genes (from) Ptrc (Startup sub-boot).
[0031] Any of the above-mentioned recombinant bacteria W3110- Ptrc - yhbS N152YIt is the genome of Escherichia coli W3110 represented by SEQ ID No. 1 adhE The integration site sequence was replaced with the DNA sequence shown in SEQ ID No. 10, positions 501-1078 from the 5' end, while keeping the other nucleotide sequences of the *E. coli* W3110 genome unchanged, resulting in recombinant *E. coli*. Recombinant strain W3110- Ptrc - yhbS N152Y The genome contains wild-type yhbS Genes and overexpression yhbS N152Y Genes (from) Ptrc (Startup sub-boot).
[0032] The present invention also protects a method for preparing engineered bacteria for producing L-threonine, which may include the following steps: using Escherichia coli as the starting bacteria, performing any one or more of the following modifications to obtain the engineered bacteria for producing L-threonine; A1) Upregulate the expression level and / or activity of any of the GNAT family N-acetyltransferases mentioned above; A2) Expressing any of the GNAT family putative N-acetyltransferase mutants described above; A3) Mutate any of the above-described GNAT family-proposed N-acetyltransferases into any of the above-described GNAT family-proposed N-acetyltransferase mutants.
[0033] In the above method, the upregulation of the expression level and / or activity of any of the GNAT family putative N-acetyltransferases is achieved by knocking in or introducing the encoding gene of the GNAT family putative N-acetyltransferase into Escherichia coli.
[0034] In the above method, the expression of any of the GNAT family putative N-acetyltransferase mutants is achieved by knocking in or introducing the coding gene of the GNAT family putative N-acetyltransferase mutant into Escherichia coli.
[0035] In the above method, the mutation of any of the above-mentioned GNAT family putative N-acetyltransferases into any of the above-mentioned GNAT family putative N-acetyltransferase mutants is achieved by mutating nucleotide A to T at position 454 of the coding gene of the GNAT family putative N-acetyltransferase, whose amino acid sequence is shown in SEQ ID No. 5.
[0036] The above method is generally applicable to all Escherichia coli, preferably Escherichia coli that can produce L-threonine, but no further limitations are made here.
[0037] In the above method, the Escherichia coli can specifically be Escherichia coli YP0158 CGMCC No.25404, which can produce L-threonine.
[0038] In the above method, the *Escherichia coli* can specifically be *Escherichia coli* W3110. *Escherichia coli* W3110 produces a low amount of L-threonine and is generally not used for L-threonine production.
[0039] In the above method, any one or more of the following modifications can specifically be modifications A1), A2), or A3).
[0040] In A2), the expression can be overexpression.
[0041] The engineered bacteria obtained through A1) modification can specifically be the recombinant bacteria YPThr- mentioned in the examples. Ptrc - yhbS Or recombinant strain W3110- Ptrc-yhbS .
[0042] The engineered bacteria obtained through A2) modification can specifically be the recombinant bacteria YPThr- mentioned in the examples. Ptrc - yhbS N152Y Or recombinant strain W3110- Ptrc - yhbS N152Y .
[0043] The engineered bacteria obtained through A3) modification can specifically be the recombinant bacteria YPThr- mentioned in the examples. yhbS N152Y Or recombinant strain W3110- yhbS N152Y .
[0044] Any of the above-mentioned GNAT family putative N-acetyltransferase mutants (i.e., yhbS) N152Y The gene encoding the protein (i.e.) yhbS N152Y The nucleotide sequence of the gene may be as shown in SEQ ID No. 8.
[0045] The gene encoding the presumed N-acetyltransferase (i.e., yhbS protein) of any of the aforementioned GNAT family members (i.e. yhbS The nucleotide sequence of the gene may be as shown in SEQ ID No. 4.
[0046] In the above method, the mutation of nucleotide A to T at position 454 of the gene encoding the GNAT family of putative N-acetyltransferases, as shown in SEQ ID No. 5, is specifically performed using the CRISPR-Cas9 gene editing method. The gRNA sequence of the CRISPR-Cas9 gene edit is shown in SEQ ID No. 6.
[0047] This invention also protects any of the above-described GNAT family putative N-acetyltransferase mutants or any of the above-described nucleic acid molecules encoding the GNAT family putative N-acetyltransferase mutants, or expression cassettes, recombinant vectors, and / or recombinant microorganisms containing any of the above-described nucleic acid molecules encoding the GNAT family putative N-acetyltransferase mutants, or engineered bacteria prepared by any of the above-described methods, for any of the following uses: D1) Production of L-threonine; D2) Preparation of products for the production of L-threonine; D3) Increases L-threonine production; D4) Prepare products for increasing L-threonine production.
[0048] This invention also protects a method for producing L-threonine, comprising the following steps: fermenting and culturing any of the engineered bacteria described above or engineered bacteria prepared by any of the methods described above, collecting the fermentation product, and obtaining L-threonine therefrom.
[0049] In the above method, the solutes and their concentrations in the fermentation medium used during fermentation can be glucose 35-45 g / L, (NH4)2SO4 10-14 g / L, KH2PO4 0.6-1.0 g / L, MgSO4•7H2O 0.6-1.0 g / L, FeSO4•7H2O 0.005-0.015 g / L, MnSO4•H2O 0.005-0.015 g / L, FM902 yeast powder 1.0-2.0 g / L, and calcium carbonate 0.4-0.6 g / L. The solvent can be water, and the pH value can be adjusted to pH 6.8-7.2 using sodium hydroxide.
[0050] In the above method, the solute and concentration of the fermentation medium used during fermentation can be glucose 1-5 g / L, peptone 5-10 g / L, beef extract 5-10 g / L, yeast powder 1-5 g / L and NaCl 1-2.5 g / L, the solvent can be water, and the pH value can be 7.0-7.2.
[0051] Experiments have shown that upregulating the expression of GNAT family putative N-acetyltransferases, overexpressing GNAT family putative N-acetyltransferase mutants, or performing point mutations on GNAT family putative N-acetyltransferases (specifically, mutating the asparagine residue at position 152 from the N-terminus of the amino acid sequence of GNAT family putative N-acetyltransferases to a tyrosine residue) can significantly improve the L-threonine production capacity of Escherichia coli. Furthermore, upregulating the expression level of GNAT family putative N-acetyltransferases in *E. coli*, overexpressing GNAT family putative N-acetyltransferase mutants, or performing point mutations on GNAT family putative N-acetyltransferases (specifically, mutating the asparagine residue at position 152 from the N-terminus of the amino acid sequence of the GNAT family putative N-acetyltransferase to a tyrosine residue) can significantly increase the production capacity of glutamic acid, valine, glycine, alanine, leucine, isoleucine, methionine, proline, tryptophan, serine, tyrosine, cysteine, phenylalanine, asparagine, glutamine, aspartic acid, arginine, histidine, shikimic acid, protocatechuic acid, succinic acid, α-ketoglutarate, citric acid, ornithine, and citrulline. This invention has significant application value.
[0052] Depository Instructions Bacterial species name: Escherichia coli Latin name: Escherichia coli Classification and nomenclature: Escherichia coli Escherichia coli Strain number: YP0158 Preservation Institution: China General Microbiological Culture Collection Center, China Microbiological Culture Collection Committee Collection institution abbreviation: CGMCC Address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing Date of preservation: July 25, 2022 CGMCC Registration Number: CGMCC No. 25404 Attached Figure Description Figure 1 This is a map of plasmid pGRB.
[0053] Figure 2 This is a map of plasmid pREDCas9. Detailed Implementation
[0054] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0055] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0056] In the quantitative experiments in the following examples, three replicate experiments were set up, and the average value of the results was taken.
[0057] In the following examples, the yhbS protein is a putative N-acetyltransferase of the GNAT family. N152Y The protein is a putative N-acetyltransferase mutant of the GNAT family.
[0058] Example 1, Recombinant bacteria YPThr- Ptrc - yhbS and recombinant strain W3110- Ptrc-yhbS Construction I. Recombinant strain YPThr- Ptrc - yhbS Construction Using the CRISPR-Cas9 gene editing method to edit E. coli yhbS Gene overexpression in L-threonine-producing strains—Escherichia coli ( Escherichia coli YP0158 CGMCC No.25404 adhE Site, to obtain recombinant bacteria YPThr- Ptrc-yhbS .
[0059] 1. Plasmid adhE- Building pGRB Constructing plasmids adhE- The purpose of pGRB is to transcribe the corresponding gRNA, thereby forming a complex with the Cas9 protein. It then uses base pairing and PAM to recognize the target gene site, resulting in a double-strand break in the target DNA. (See pGRB plasmid diagram). Figure 1 This is an Addgene product, catalog number #71539. The plasmid pGRB uses pUC18 as its backbone and includes the promoter J23119, the gRNA-Cas9 binding region sequence, and a terminator sequence. It is ampicillin resistant (working concentration: 100 mg / L) and cultured at 37°C.
[0060] Plasmids are constructed by recombination of DNA fragments containing target sequences with linearized vector fragments. adhE- pGRB. The specific steps are as follows: (1) Target sequence and primer design The target sequence (PAM:5'-NGG-3') was designed using CRISPR RGEN Tools, and the forward primer gRNA-F1 and reverse primer gRNA-R1 for amplifying the sgRNA fragment were artificially designed and synthesized based on the target sequence, as detailed below: Forward primer gRNA-F1: 5'-tgacagctagctcagtcctaggtataatactagt ggaaactcacttcga agagc gttttagagctagaaatagcaagttaaaataagg-3' (underscores are...) adhE Target sequence).
[0061] Reverse primer gRNA-R1: 5'-CCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC gctcttcgaagtgag tttcc ACTAGTATTATACCTAGGACTGAGCTAGCTGTCA-3' (underscores are...) adhE Target sequence).
[0062] (2) Preparation of DNA fragments containing target sequences ① Preparation of the annealing reaction system. The annealing reaction system consists of 10 μL of aqueous solution of forward primer gRNA-F1 (concentration of 10 μmol / L) and 10 μL of aqueous solution of reverse primer gRNA-R1 (concentration of 10 μmol / L).
[0063] ② Anneal the annealing reaction system to obtain a DNA fragment containing the target sequence.
[0064] Reaction conditions: pre-denaturation at 95℃ for 5 min; annealing at 50℃ for 1 min.
[0065] (3) Preparation of linearized cloning vectors The linearization of the vector was achieved using reverse PCR amplification. Specifically, using plasmid pGRB as a template, PCR amplification was performed using PrimeSTAR HS enzyme (Takara) and primer pairs (composed of pGRB-F: 5'-actagtattatacctaggactgagc-3' and pGRB-R: 5'-gttttagagctagaaatagcaagtt-3') to obtain the linearized cloning vector.
[0066] The reaction procedure was as follows: pre-denaturation at 95℃ for 5 min; denaturation at 98℃ for 10 s; annealing at 58℃ for 15 s; extension at 72℃ for 120 s, for 30 cycles; extension at 72℃ for another 10 min; and maintenance at 4℃.
[0067] (4) Recombination reaction ① Preparation of the recombinant system. The recombinant system consisted of 20 μL and was composed of 4 μL 5×CEⅡ Buffer, 1 μL linearized cloning vector, 1 μL DNA fragment containing the target sequence, 2 μL LExnase Ⅱ and 12 μL ddH2O.
[0068] Exnase II and 5×CE II Buffer are both components of the ClonExpress® II One Step Cloning Kit (Novizan, C112).
[0069] ② The recombinant system is recombined to obtain a reaction solution.
[0070] The recombination conditions were: 37℃, 30 min.
[0071] (5) Plasmid transformation Add the reaction solution obtained in step (4) to 100 mL of E. coli DH5α competent cells, mix gently, incubate on ice for 20 min, heat shock at 42℃ for 45-90 s, immediately incubate on ice for 2-3 min, add 900 μL of SOC medium, and revive at 37℃ for 1 h. Then centrifuge at 8000 rpm for 2 min, discard part of the supernatant, and resuspend the bacterial cells in about 200 μL. Spread the resuspended cells onto LB agar plates containing 100 mg / L ampicillin, invert the plates, and incubate overnight at 37℃ to obtain resistant colonies.
[0072] (6) Cloning identification The resistant colonies obtained in step (5) were inoculated into LB liquid medium containing 100 mg / L ampicillin, cultured overnight at 37°C, and then plasmids were extracted and identified by enzyme digestion. Plasmids identified as correctly inserted were named plasmids. adhE- pGRB.
[0073] plasmid adhE- pGRB can transcribe gRNA with nucleotide sequences as shown in SEQ ID No. 2, thereby forming a complex with the Cas9 protein, and achieving double-strand breaks in the target DNA by recognizing the target gene site through base pairing and PAM.
[0074] Sequencing revealed plasmids adhE- pGRB is a recombinant plasmid obtained by replacing the DNA fragment between the DNA sequence K: 5'-gctcagtcctaggtataatactagt-3' and the DNA sequence M: 5'-gttttagagctagaaatagcaagt-3' in plasmid pGRB with the DNA fragment W: 5'-GGAAACTCACTTCGAAGAGC-3', while keeping other nucleotide sequences unchanged.
[0075] 2.Ptrc - yhbS Fabrication of the integrated frame Ptrc - yhbS The integration box is composed of upstream homologous arms - Ptrc - yhbS- Downstream homologous arm composition, for use adhE Site integration yhbS The integration frame of the gene. The specific steps are as follows: (1) The following primers were designed and synthesized artificially: Primers Ptrc-yhbS -up-F:5'-agcgggtaacgcgggttag-3'; Primers Ptrc-yhbS -up-R: 5'-CCGCTCACAATTCCACACATTATACGAGCCCGGATGATTAATTGTCAAgaatatctgccagcgtcctac-3'; Primers Ptrc-yhbS -F: 5'-ATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGACCATGCTAATTCGAGTAGAAATTC-3'; Primers Ptrc-yhbS -R: 5'-caccaacaaagcggctgatatTTAAAAGCGATTGAAATGCTC--3'; Primers Ptrc-yhbS -down-F: 5'-GAGCATTTCAATCGCTTTTAAatatcagccgctttgttggtg-3'; Primers Ptrc-yhbS -down-R: 5'-agcagatgatttactaaaaaagtttaacattatcagg-3'.
[0076] Primers containing "-F" in their names are upstream primers, and primers containing "-R" in their names are downstream primers.
[0077] (2) Escherichia coli (Escherichia coli) Escherichia coli Using the genomic DNA of YP0158 CGMCC No.25404 as a template, primers were used respectively. Ptrc-yhbS -up-F and primers Ptrc-yhbS Primer pair A, composed of -up-R, and primers Ptrc- yhbS -down-F and primers Ptrc-yhbS Primer pair B consisting of -down-R and primers Ptrc-yhbS -F and primersPtrc- yhbS PCR amplification was performed using primers composed of -R, yielding the upstream homologous arm, downstream homologous arm, and... Ptrc-yhbS .
[0078] The reaction system consisted of 50 μL of each sample, with 2 μL of template (i.e., Escherichia coli) Escherichia coli The mixture consisted of genomic DNA from YP0158CGMCC No.25404, 1 μL of upstream primer aqueous solution (10 μmol / L), 1 μL of downstream primer aqueous solution (10 μmol / L), 4 μL of dNTP mixture (10 mmol / L), 10 μL of 5× Buffer, 0.5 μL of RimeSTAR HS enzyme (Takara) (concentration of 5 U / μL) and 31.5 μL of ddH2O.
[0079] (3) Overlap PCR ①Preparation of the overlap PCR reaction system. The overlap PCR reaction system is 50 μL, consisting of 2 μL of template (composed of the upstream homologous arm, the downstream homologous arm, and...). Ptrc-yhbS (mixed), 1μL primer Ptrc-yhbS -up-F aqueous solution (10 μmol / L), 1 μL primer Ptrc-yhbS- The solution consisted of a down-R aqueous solution (10 μmol / L), 4 μL dNTP mixture (10 mmol / L), 10 μL 5× Buffer, 0.5 μL RimeSTAR HS enzyme (Takara) (concentration of 5 U / μL), and 31.5 μL ddH2O.
[0080] ② Perform overlap PCR on the overlap PCR reaction system to obtain homologous recombination. Ptrc - yhbS Integration box.
[0081] Overlap PCR reaction conditions: 95℃ pre-denaturation for 5 min; 98℃ denaturation for 10 s, 58℃ annealing for 15 s, 72℃ extension for 90 s, 30 cycles; 72℃ extension for 10 min; 4℃ maintenance.
[0082] Ptrc - yhbS The nucleotide sequence of the integration frame is shown in SEQ ID No. 3. From the 5' end, positions 1-500 of SEQ ID No. 3 represent the nucleotide sequence of the upstream homologous arm, and positions 501-574 represent... Ptrc The nucleotide sequence of the promoter, positions 575-1078 are... yhbS The nucleotide sequence of the gene, with positions 1079-1578 being the nucleotide sequence of the downstream homologous arm.
[0083] yhbS The nucleotide sequence of the gene is shown in SEQ ID No. 4, and it encodes the yhbS protein with the amino acid sequence shown in SEQ ID No. 5.
[0084] 3. Preparation of Escherichia coli competent cells containing plasmid pREDCas9 The plasmid pREDCas9 is a product of Addgene, catalog number #71541. A graph of plasmid pREDCas9 can be found here. Figure 2 The plasmid pREDCas9 carries the elimination system of the gRNA expression plasmid pGRB, the Red recombination system of λ phage, and the Cas9 protein expression system. It is incubated with zirconia resistance (working concentration: 100 mg / L) at 32°C.
[0085] (1) Transformation of plasmid pREDCas9 The plasmid pREDCas9 was electroporated into the L-threonine-producing strain, *Escherichia coli*. Escherichia coli In competent cells of YP0158 CGMCC No.25404, after cell resuscitation and culture, the cells were plated on LB agar plates containing zizomycin and incubated overnight at 32°C. Single colonies growing on the plates were subjected to colony PCR using identification primers (specifically 5'-gcagtggcggttttcatggc-3' and 5'-ccttggtgatctcgcctttcacg-3') to screen for positive recombinants (positive recombinants yielded a 943bp DNA fragment during colony PCR), i.e., Escherichia coli containing plasmid pREDCas9.
[0086] (2) Preparation of competent Escherichia coli cells containing plasmid pREDCas9 The *Escherichia coli* containing plasmid pREDCas9 obtained in step (1) was inoculated into LB medium and cultured at 32°C to obtain OD. 600nm The bacterial culture solution 1 was prepared with a concentration of 0.1–0.2 mM. IPTG was then added to the bacterial culture solution 1 to achieve a final concentration of 0.1 mM, and the culture was continued at 32°C to obtain the OD. 600nm The bacterial culture solution 2 was prepared at a concentration of 0.6–0.7 g / mL. The purpose of adding IPTG was to induce the expression of the recombinase on plasmid pREDCas9. Competent cells were prepared from bacterial culture solution 2, ultimately yielding Escherichia coli competent cells containing plasmid pREDCas9. The culture medium and preparation process for competent cells followed standard operating procedures.
[0087] 4. Plasmids adhE- pGRB and Ptrc - yhbS Conversion of integration box The plasmid constructed in step 1adhE- pGRB and the preparation in step 2 Ptrc - [[ID=A4]]yhbS The integrated frame was simultaneously electroporated into competent *Escherichia coli* cells containing plasmid pREDCas9 prepared in step 3. The electroporated and revived bacterial cells were plated onto LB agar plates containing ampicillin and zithromycin and incubated overnight at 32°C. Single colonies grown on the plates were then analyzed using primers. Ptrc-yhbS -up-F and primers Ptrc-yhbS The primer pair consisting of -R and primers A1 and Ptrc-yhbS-F and primers Ptrc-yhbS- Colony PCR was performed using primer pair A2 (comprising down-R primers) to screen for positive recombinant 1 (when performing colony PCR on positive recombinant 1, primer pair A1 can obtain a DNA fragment of 1099 bp, and primer pair A2 can obtain a DNA fragment of 1051 bp) and the bacteria were preserved.
[0088] 5. Plasmid elimination (1) Plasmid adhE -pGRB elimination The positive recombinant 1 obtained in step 4 was placed in LB liquid medium containing 0.2% arabinose and cultured overnight. After appropriate dilution, it was spread onto LB solid plates containing zirconia-resistant bacteria and cultured overnight at 32°C. Single colonies were picked and streaked one-to-one onto LB solid plates containing ampicillin (i.e., ampicillin-resistant plates) and LB solid plates containing zirconia-resistant bacteria (i.e., zirconia-resistant plates). Single colonies that did not grow on ampicillin-resistant plates but grew on zirconia-resistant plates were selected and preserved to obtain positive recombinant 2.
[0089] (2) Elimination of plasmid pREDCas9 Positive recombinant 2 was transferred to antibiotic-free LB liquid medium and incubated overnight at 42°C. After appropriate dilution, it was spread onto antibiotic-free LB solid plates and incubated overnight at 37°C. Single colonies were picked and streaked one-to-one onto zirconia-resistant plates and LB solid plates respectively. Single colonies that did not grow on zirconia-resistant plates but grew on LB solid plates were selected for preservation to obtain positive recombinant 3.
[0090] The obtained positive recombinant 3 was sequenced. Sequencing results showed that positive recombinant 3 was a recombinant of *Escherichia coli* (Escherichia coli). Escherichia coli The genome of YP0158 CGMCC No.25404, as shown in SEQ ID No.1 adhE The integration site sequence was replaced with the DNA sequence shown in SEQ ID No. 3, positions 501-1078 from the 5' end, while maintaining Escherichia coli (E. coli). Escherichia coliThe recombinant *E. coli* strain YP0158 (CGMCC No. 25404) was obtained with the other nucleotide sequences remaining unchanged. The positive recombinant 3 was named recombinant strain YPThr- Ptrc - yhbS .
[0091] Recombinant bacteria YPThr- Ptrc-yhbS The genome contains wild-type yhbS Genes and overexpression yhbS Genes (from) Ptrc (Bootbox startup) Two copies.
[0092] II. Recombinant strain W3110- Ptrc-yhbS Construction Following step one, Escherichia coli ( Escherichia coli Replace YP0158 CGMCC No.25404 with Escherichia coli W3110, keeping all other steps unchanged, to obtain recombinant strain W3110- Ptrc-yhbS .
[0093] Recombinant strain W3110- Ptrc-yhbS Sequencing was performed. Sequencing results showed that the recombinant strain W3110- Ptrc-yhbS It is the genome of Escherichia coli W3110 represented by SEQ ID No. 1 adhE The integration site sequence was replaced with the DNA sequence shown in SEQ ID No. 3 from position 501 to 1078 from the 5' end, while keeping the other nucleotide sequences of the E. coli W3110 genome unchanged, resulting in recombinant E. coli.
[0094] Recombinant strain W3110- Ptrc-yhbS The genome contains wild-type yhbS Genes and overexpression yhbS Genes (from) Ptrc (Bootbox startup) Two copies.
[0095] Example 2, Recombinant bacteria YPThr- yhbS N152Y and recombinant strain W3110- yhbS N152Y Construction I. Recombinant strain YPThr- yhbS N152Y Construction Using the CRISPR-Cas9 gene editing method, Escherichia coli ( Escherichia coli YP0158CGMCC No.25404 genome yhbS The 454th nucleotide of the gene is mutated from A to T, which will change the wild-type gene. yhbS Gene mutation yhbS N152Y Genes were used to obtain recombinant bacteria YPThr- yhbS N152Y .
[0096] 1. Plasmid yhbS- Building pGRB Following the method in step 1 of Example 1, replace the forward primer gRNA-F1 with the forward primer gRNA-F2: 5'-tgacagctagctcagtcctaggtataatactagt tgagttcggctatgccgcag gttttagagctagaaatagcaagttaaaataagg-3' (underscores are...) yhbS gRNA sequence), reverse primer gRNA-R1 replaced with reverse primer gRNA-R2: 5'-CCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC ctgcggcatagccgaactca ACTAGTATTATACCTAGGACTGAGCTAGCTGTCA-3' (underscores are...) yhbS (gRNA sequence), all other steps remain unchanged, to obtain the plasmid. yhbS- pGRB.
[0097] plasmid yhbS- pGRB can transcribe gRNA with nucleotide sequences as shown in SEQ ID No. 6, thereby forming a complex with the Cas9 protein, and recognizing the target gene (i.e., through base pairing and PAM) yhbS (Gene) target sites to achieve the desired DNA double-strand break.
[0098] 2. yhbS N152Y Fabrication of the integrated frame For yhbS N152Y Point mutation yhbS N152Y The integration frame consists of an upstream and a downstream homologous arm. The specific steps are as follows: (1) According to yhbS N152Y Based on the upstream and downstream homologous arm sequences of the gene, the following primers were designed and synthesized: Primers yhbS -F:5'-ggcattagcgcaccagagttc-3'; Primers yhbS N152Y -R: 5'-cggatgacgcgctgTatggcgttacc-3'; Primers yhbS N152Y-F:5'-ggtaacgccatAcagcgcgtcatccg-3'; Primers yhbS -R:5'-gcgcctgaaaccaaacagac-3'.
[0099] (2) Escherichia coli (Escherichia coli) Escherichia coli Using the genomic DNA of YP0158 CGMCC No.25404 as a template, primers were used respectively. yhbS -F and primers yhbS N152Y Primer pair 1 and primers consisting of -R yhbS N152Y -F and primers yhbS PCR amplification was performed using primer pair 2 composed of -R, resulting in an upstream homologous arm of 500bp and a downstream homologous arm of 500bp.
[0100] The reaction system is the same as step 2 in Example 1.
[0101] (3) Overlap PCR ①Preparation of the overlapping PCR reaction system. The overlapping PCR reaction system is 50 μL, consisting of 2 μL template (a mixture of the upstream and downstream homologous arms obtained in step (2)) and 1 μL primer. yhbS -F aqueous solution (10 μmol / L), 1 μL primer yhbS The mixture consisted of 10 μmol / L aqueous solution of R, 4 μL dNTP mixture (10 mmol / L), 10 μL 5× Buffer, 0.5 μL RimeSTAR HS enzyme (Takara) (concentration of 5 U / μL) and 31.5 μL ddH2O.
[0102] ② Perform overlap PCR on the overlap PCR reaction system to obtain homologous recombination. yhbS N152Y Integration box.
[0103] yhbS N152Y The nucleotide sequence of the integration frame is shown in SEQ ID No. 7. Starting from the 5' end, positions 1-500 of SEQ ID No. 7 are the nucleotide sequences of the upstream homologous arm, positions 475-974 are the nucleotide sequences of the downstream homologous arm, and there is a 26 bp overlap sequence in between.
[0104] 3. Preparation of Escherichia coli competent cells containing plasmid pREDCas9 Same as step 3 in Example 1.
[0105] 4. Plasmids yhbS- pGRB and yhbS N152Y Conversion of integration box The plasmid constructed in step 1 yhbS- pGRB and the preparation in step 2 yhbS N152Y The integration frame was simultaneously electroporated into competent *Escherichia coli* cells containing plasmid pREDCas9 prepared in step 3. The electroporated and revived bacterial cells were plated onto LB agar plates containing ampicillin and zithromycin and incubated overnight at 32°C. Single colonies grown on the plates were sequenced to screen for cells containing pREDCas9. yhbS N152Y Genes yhbS N152Y Positive mutant 1.
[0106] 5. Plasmid elimination (1) Plasmid adhE -pGRB elimination Following the method in step 5 of Example 1, replace positive recombinant 1 with the one obtained in step 4. yhbS N152Y Positive mutant 1, with all other steps unchanged, yielded yhbS N152Y Positive mutant 2.
[0107] (2) Elimination of plasmid pREDCas9 Following the method in step 5 (2) of Example 1, replace positive recombinant 2 with yhbS N152Y Positive mutant 2, with all other steps unchanged, yielded yhbS N152Y Positive mutant 3.
[0108] The above obtained yhbS N152Y Positive mutant 3 was sequenced. Sequencing results showed that... yhbS N152Y Positive mutant 3 is Escherichia coli (Escherichia coli) Escherichia coli YP0158 CGMCC No.25404 genome yhbS Gene mutation yhbS N152Y Genes and maintain Escherichia coli ( Escherichia coli The recombinant *E. coli* strain YP0158 CGMCC No.25404 was obtained with the other nucleotide sequences of its genome unchanged. yhbS N152Y Positive mutant 3 was named recombinant bacteria YPThr- yhbS N152Y .
[0109] yhbS N152Y The nucleotide sequence of the gene is shown in SEQ ID No. 8, and the encoding amino acid sequence is shown in SEQ ID No. 9. N152Y protein. yhbS N152Y Genes are yhbS The mutation at nucleotide 454 of the gene, A, is replaced by T, and subsequently, the yhbS protein undergoes a mutation from asparagine to tyrosine at position 152 from the N-terminus.
[0110] This invention uses the CRISPR-Cas9 gene editing method to edit Escherichia coli (Escherichia coli) Escherichia coli The wild-type genome of YP0158 CGMCC No.25404 yhbS Gene mutation yhbS N152Y Genes were used to obtain recombinant bacteria YPThr- yhbS N152Y .
[0111] Recombinant bacteria YPThr- yhbS N152Y The genome contains yhbS N152Y Genes that do not contain wild-type genes. yhbS Gene.
[0112] II. Recombinant strain W3110- yhbS N152Y Construction Following step one, Escherichia coli ( Escherichia coli Replace YP0158 CGMCC No.25404 with Escherichia coli W3110, keeping all other steps unchanged, to obtain recombinant strain W3110- yhbS N152Y .
[0113] Recombinant strain W3110- yhbS N152Y It is the genome of Escherichia coli W3110 yhbS Gene mutation yhbS N152Y The genes were extracted while keeping the other nucleotide sequences of the E. coli W3110 genome unchanged, resulting in recombinant E. coli.
[0114] Recombinant strain W3110- yhbS N152Y The genome contains yhbS N152Y Genes that do not contain wild-type genes. yhbS Gene.
[0115] Example 3, Recombinant bacteria YPThr- Ptrc - yhbS N152Y and recombinant strain W3110- Ptrc - yhbS N152Y Construction I. Recombinant strain YPThr- Ptrc - yhbS N152Y Construction Using CRISPR-Cas9 gene editing method to yhbS N152Y Gene overexpression in L-threonine-producing strains—Escherichia coli ( Escherichia coli YP0158 CGMCC No.25404 adhE Site, to obtain recombinant bacteria YPThr- Ptrc - yhbS N152Y .
[0116] 1. Ptrc - yhbS N152Y Fabrication of the integrated frame For adhE Site integration yhbS N152Y The integration frame of genes — Ptrc - yhbS N152Y The integration box is composed of upstream homologous arms - Ptrc - yhbS N152Y - The downstream homologous arm is formed. The specific steps are as follows: (1) The following primers were designed and synthesized artificially: Primers Ptrc-yhbS -up-F:5'-agcgggtaacgcgggttag-3'; Primers Ptrc-yhbS -up-R: 5'-CCGCTCACAATTCCACACATTATACGAGCCCGGATGATTAATTGTCAAgaatatctgccagcgtcctac-3'; Primers Ptrc-yhbS -F: 5'-ATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGACCATGCTAATTCGAGTAGAAATTC-3'; Primers Ptrc-yhbS N152Y-R: 5'-accaacaaagcggctgatatTTAAAAGCGATTGAAATGCTCGTGATACTCAACCAGGCCGGTAACGCCATACAGC-3'; Primers Ptrc-yhbS N152Y -down-F: 5'-TGTATGGCGTTACCGGCCTGGTTGAGTATCACGAGCATTTCAATCGCTTTTAAatatcagccgctttgttggtg-3'; Primers Ptrc-yhbS -down-R: 5'-agcagatgatttactaaaaaagtttaacattatcagg-3'.
[0117] Primers containing "-F" in their names are upstream primers, and primers containing "-R" in their names are downstream primers.
[0118] (2) Escherichia coli (Escherichia coli) Escherichia coli Using the genomic DNA of YP0158 CGMCC No.25404 as a template, primers were used respectively. Ptrc-yhbS -up-F and primers Ptrc-yhbS Primer pair A, composed of -up-R, and primers Ptrc- yhbS N152Y -down-F and primers Ptrc-yhbS Primer pair B consisting of -down-R and primers Ptrc-yhbS -F and primers Ptrc-yhbS N152Y PCR amplification was performed using primers consisting of -R, yielding the upstream homologous arm, downstream homologous arm, and... Ptrc- yhbS N152Y .
[0119] The reaction system is the same as step 2 in Example 1.
[0120] (3) Overlap PCR ①Preparation of the overlap PCR reaction system. The overlap PCR reaction system is 50 μL, consisting of 2 μL of template (composed of the upstream homologous arm, the downstream homologous arm, and...). Ptrc-yhbS N152Y (mixed), 1μL primer Ptrc-yhbS -up-F aqueous solution (10 μmol / L), 1 μL primer Ptrc-yhbS- The solution consisted of a down-R aqueous solution (10 μmol / L), 4 μL dNTP mixture (10 mmol / L), 10 μL 5× Buffer, 0.5 μL RimeSTAR HS enzyme (Takara) (concentration of 5 U / μL), and 31.5 μL ddH2O.
[0121] ② Perform overlap PCR on the overlap PCR reaction system to obtain homologous recombination. Ptrc - yhbS N152Y Integration box.
[0122] Ptrc - yhbS N152Y The nucleotide sequence of the integration frame is shown in SEQ ID No. 10. From the 5' end, positions 1-500 of SEQ ID No. 10 represent the nucleotide sequence of the upstream homologous arm, and positions 501-574 represent... Ptrc The nucleotide sequence of the promoter, positions 575-1078 are... yhbS N152Y The nucleotide sequence of the gene, with positions 1079-1578 being the nucleotide sequence of the downstream homologous arm.
[0123] 2. Preparation of competent Escherichia coli cells containing plasmid pREDCas9 Same as step 3 in Example 1.
[0124] 3. Plasmids adhE- pGRB and Ptrc - yhbS N152Y Conversion of integration box The plasmid constructed in Example 1, step 1 adhE- pGRB and the pGRB prepared in step 1 Ptrc - yhbS The integrated frame was simultaneously electroporated into competent *Escherichia coli* cells containing plasmid pREDCas9 prepared in step 2. The electroporated and revived bacterial cells were plated onto LB agar plates containing ampicillin and zithromycin and incubated overnight at 32°C. Single colonies grown on the plates were then analyzed using primers. Ptrc-yhbS -up-F and primers Ptrc-yhbS N152Y - Primer pair a and primer R are composed of R. Ptrc-yhbS-F and primers Ptrc-yhbS- Colony PCR was performed using primer pair b (composed of down-R primers) to screen for positive recombinants a (when performing colony PCR on positive recombinants a, primer pair a can obtain a DNA fragment of 1098 bp, while primer pair b can obtain a DNA fragment of 1051 bp) and the bacteria were preserved.
[0125] 4. Plasmid elimination (1) Plasmid adhE -pGRB elimination Following the method in step 5 of Example 1, positive recombinant 1 is replaced with positive recombinant a obtained in step 3, while other steps remain unchanged, to obtain positive recombinant b.
[0126] (2) Elimination of plasmid pREDCas9 Following the method in step 5 (2) of Example 1, positive recombinant 2 is replaced with positive recombinant b, and all other steps remain unchanged to obtain positive recombinant c.
[0127] The obtained positive recombinant c was sequenced. Sequencing results showed that positive recombinant c is a recombinant of *Escherichia coli* (Escherichia coli). Escherichia coli The genome of YP0158 CGMCC No.25404, as shown in SEQ ID No.1 adhE The integration site sequence was replaced with the DNA sequence shown in SEQ ID No. 10, positions 501-1078 from the 5' end, while maintaining Escherichia coli (E. coli). Escherichia coli The recombinant E. coli with YP0158 CGMCC No.25404 and other nucleotide sequences of the genome remained unchanged was obtained.
[0128] The positive recombinant c was named recombinant bacteria YPThr- Ptrc - yhbS N152Y .
[0129] Recombinant bacteria YPThr- Ptrc - yhbS N152Y The genome contains wild-type yhbS Genes and overexpression yhbS N152Y Genes (from) Ptrc (Startup sub-boot).
[0130] II. Recombinant strain W3110- Ptrc - yhbS N152Y Construction Following step one, Escherichia coli ( Escherichia coli Replace YP0158 CGMCC No.25404 with Escherichia coli W3110, keeping all other steps unchanged, to obtain recombinant strain W3110- Ptrc - yhbS N152Y .
[0131] Recombinant strain W3110- Ptrc - yhbS N152Y Sequencing was performed. Sequencing results showed that the recombinant strain W3110- Ptrc - yhbS N152Y It is the genome of Escherichia coli W3110 represented by SEQ ID No. 1 adhE The integration site sequence was replaced with the DNA sequence shown in SEQ ID No. 10 from position 501 to 1078 from the 5' end, while keeping the other nucleotide sequences of the E. coli W3110 genome unchanged, resulting in recombinant E. coli.
[0132] Recombinant strain W3110- Ptrc - yhbS N152Y The genome contains wild-type yhbS Genes and overexpression yhbS N152Y Genes (from) Ptrc (Startup sub-boot).
[0133] Example 4: Production of L-threonine by fermentation using strains constructed in Examples 1-3 The tested strains were Escherichia coli (Escherichia coli) Escherichia coli YP0158 CGMCC No.25404, Escherichia coli W3110, Recombinant strain W3110- Ptrc-yhbS Recombinant strain W3110- yhbS N152Y Recombinant strain W3110- Ptrc - yhbS N152Y Recombinant bacteria YPThr- Ptrc - yhbS、 Recombinant bacteria YPThr- yhbS N152Y and recombinant bacteria YPThr- Ptrc - yhbS N152Y .
[0134] The test strain was streaked onto an agar slant and incubated at 37°C for 12 h. Then, a loopful of the agar slant seed culture was scraped and inoculated into a 500 mL Erlenmeyer flask containing 30 mL of seed culture medium. The flask was sealed with nine layers of gauze and incubated at 37°C and 200 rpm for 7-10 h. After that, 1 mL of the culture was inoculated into a 50 mL shake flask fermentation medium and fermented at 37°C and 200 rpm for 36 h to obtain the fermentation broth. Finally, the yield of L-threonine in the fermentation broth was determined by HPLC.
[0135] The HPLC chromatographic conditions were as follows: Method: 2,4-dinitrofluorobenzene (DNFB) pre-column derivatization liquid chromatography; Mobile phase: 55% acetonitrile-water solution (phase B), 5.44 g / L KH2PO4 solution (pH 7.20) (phase D); Flow rate: 1.0 mL / min; Detection wavelength: 360 nm.
[0136] Experimental data were processed using Excel. Three batches of biological replicates were set up for each strain, and significance tests (t-test method, p<0.05 indicates significant difference, p<0.01 indicates extremely significant difference) were used.
[0137] The solutes and their concentrations in the slant culture medium are peptone 16 g / L, yeast extract 10 g / L, NaCl 5 g / L, and agar 15-20 g / L. The solvent is water, and the pH value is 7.0-7.2.
[0138] The solutes and their concentrations in the seed culture medium are glucose 1-5 g / L, peptone 5-10 g / L, beef extract 5-10 g / L, yeast extract 1-5 g / L and NaCl 1-2.5 g / L, with water as the solvent and a pH of 7.0-7.2.
[0139] The solutes and their concentrations in the shake-flask fermentation medium were: glucose 40 g / L, (NH4)2SO4 12 g / L, KH2PO4 0.8 g / L, MgSO4•7H2O 0.8 g / L, FeSO4•7H2O 0.01 g / L, MnSO4•H2O 0.01 g / L, FM902 yeast extract 1.5 g / L, and calcium carbonate 0.5 g / L. The solvent was water, and the pH was adjusted to 7.0 with sodium hydroxide.
[0140] The test results are shown in Table 1. P A value < 0.05 indicates a significant difference. P Values <0.01 indicate highly significant differences. The results show that, regardless of the specific strain of *Escherichia coli* producing high levels of L-threonine (…),… Escherichia coli YP0158 CGMCC No. 25404 is still the type strain Escherichia coli W3110, overexpressing yhbS Genes, will yhbS Gene mutation yhbS N152Y Gene or overexpression yhbS N152Y All genes can increase L-threonine production, with significant or highly significant differences.
[0141] Table 1. L-Threoamino acid production of strains
[0142] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.
Claims
1. A GNAT family presumed N-acetyltransferase mutant, comprising at least one of the following: C1) The protein obtained by mutating the asparagine residue at position 152 in the amino acid sequence of the GNAT family of presumed N-acetyltransferases; C2) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the protein shown in C1); The GNAT family is presumed to contain N-acetyltransferases of type E1, E2, or E3. E1) contains at least the amino acid sequence shown in SEQ ID No. 5; E2) is a protein with 98% or more identity and the same function as E1) obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence of E1. E3) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of E1) or E2).
2. The GNAT family putative N-acetyltransferase mutant according to claim 1, characterized in that: The GNAT family putative N-acetyltransferase mutant comprises a protein obtained by mutating the asparagine residue at position 152 of the amino acid sequence of the GNAT family putative N-acetyltransferase to a tyrosine residue.
3. The GNAT family putative N-acetyltransferase mutant according to claim 1, characterized in that: The GNAT family presumed N-acetyltransferase mutant contains the amino acid sequence shown in SEQ ID No.
9.
4. A nucleic acid molecule encoding a GNAT family presumed N-acetyltransferase mutant of any one of claims 1 to 3, or an expression cassette, recombinant vector, and / or recombinant microorganism containing said nucleic acid molecule.
5. The nucleic acid molecule according to claim 4, characterized in that: The nucleic acid molecule contains either B1 or B2. B1) A DNA molecule containing the coding sequence shown in SEQ ID No. 8; B2) has 75% or more identity with the nucleotide sequence defined in B1) and encodes a DNA molecule that is a presumed N-acetyltransferase mutant of the GNAT family.
6. An engineered bacterium, including *Escherichia coli* that has undergone any one or more of the following modifications in vivo; A1) Upregulate the expression level and / or activity of the GNAT family of putative N-acetyltransferases as described in claim 1; A2) Expressing a GNAT family putative N-acetyltransferase mutant as described in any one of claims 1 to 3; A3) Mutate the GNAT family presumed N-acetyltransferase of claim 1 into any of the GNAT family presumed N-acetyltransferase mutants of claims 1 to 3.
7. A method for preparing engineered bacteria for producing L-threonine, comprising the following steps: using Escherichia coli as the starting bacterium, performing any one or more of the following modifications to obtain the engineered bacteria for producing L-threonine; A1) Upregulate the expression level and / or activity of the GNAT family of putative N-acetyltransferases as described in claim 1; A2) Expressing a GNAT family putative N-acetyltransferase mutant as described in any one of claims 1 to 3; A3) Mutate the GNAT family presumed N-acetyltransferase of claim 1 into any of the GNAT family presumed N-acetyltransferase mutants of claims 1 to 3.
8. The method according to claim 7, characterized in that: The upregulation of the expression level and / or activity of the GNAT family putative N-acetyltransferase described in claim 1 is achieved by knocking in or introducing the encoding gene of the GNAT family putative N-acetyltransferase into Escherichia coli. The expression of the GNAT family putative N-acetyltransferase mutant according to any one of claims 1 to 3 is achieved by knocking in or introducing the coding gene of the GNAT family putative N-acetyltransferase mutant into Escherichia coli; The mutation of the GNAT family putative N-acetyltransferase of claim 1 to any of the GNAT family putative N-acetyltransferase mutants of claims 1 to 3 is achieved by mutating nucleotide A to T at position 454 of the gene encoding the GNAT family putative N-acetyltransferase, whose amino acid sequence is shown in SEQ ID No.
5.
9. Any of the following uses of the GNAT family presumed N-acetyltransferase mutants of any of claims 1 to 3, or the nucleic acid molecules of claims 4 or 5, or expression cassettes, recombinant vectors, and / or recombinant microorganisms containing the nucleic acid molecules of claims 4 or 5, or the engineered bacteria of claim 6, or the engineered bacteria prepared by the method of claim 7 or 8: D1) Production of L-threonine; D2) Preparation of products for the production of L-threonine; D3) Increases L-threonine production; D4) Prepare products for increasing L-threonine production.
10. A method for producing L-threonine, comprising the following steps: fermenting and culturing the engineered bacteria of claim 6 or the engineered bacteria prepared by the method of claim 7 or 8, collecting the fermentation product, and obtaining L-threonine therefrom.